Application of StIQD20 gene related biological product in improvement of plant salt tolerance

By overexpressing the StIQD20 gene in potatoes, the salt tolerance of potatoes was improved using recombinant plasmids and Agrobacterium-mediated transformation, solving the problem of reduced yield and quality of potatoes in saline soils and achieving significant improvement in salt tolerance and antioxidant defense.

CN121538263APending Publication Date: 2026-02-17SHANXI AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610034920.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-12
Publication Date
2026-02-17

AI Technical Summary

Technical Problem

In existing technologies, potato salt tolerance breeding lacks efficient molecular targets, and traditional breeding methods are inefficient, making it difficult to effectively utilize the salt tolerance potential of wild potatoes, resulting in a decline in potato yield and quality in saline soils.

Method used

By overexpressing the StIQD20 gene, the StIQD20 gene was introduced into potato material C65 using recombinant plasmids and Agrobacterium-mediated transformation, thereby increasing the expression level and protein activity of the StIQD20 gene and enhancing the salt tolerance of potatoes.

Benefits of technology

Under salt stress, potato plants overexpressing the StIQD20 gene showed significantly increased plant height, leaf number, and fresh weight, enhanced antioxidant enzyme activity, and reduced cell damage, demonstrating significant agronomic advantages and antioxidant defense capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121538263A_ABST
    Figure CN121538263A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant molecular breeding, and particularly relates to application of a related biological product of an StIQD20 gene to improvement of plant salt tolerance. The nucleotide sequence of the StIQD20 gene is shown as SEQ ID NO.1, the StIQD20 gene can regulate and control the influence of salt stress on the growth and development of potato seedlings, and a potato strain which is over-expressed with the StIQD20 gene and is cultivated by using related biological products of the StIQD20 gene shows remarkable agronomic advantages under the salt stress: under the treatment condition of 100 mmol / L NaCl, the salt stress of the potato strain is reduced, and the salt stress of the potato strain is reduced. The plant height, the leaf number and the fresh weight of a potato plant over-expressed with the StIQD20 gene are 1.2-3.8 times of those of a wild type, the activity of superoxide dismutase and peroxidase is improved by 1.25-3.3 times, and the malondialdehyde content is reduced by 10-70%. By using related biological products of the StIQD20 gene, the anti-oxidation defense capability of plants to salt stress can be improved, and cell damage is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, specifically involving StIQD20 Application of gene-related bioproducts in improving plant salt tolerance. Background Technology

[0002] Currently, soil salinization is a serious global problem. Statistics show that approximately 20% of irrigated farmland is affected by salinization to varying degrees, and this trend continues to worsen. Potatoes ( Solanum tuberosum L. As the world's fourth largest staple crop, potatoes are extremely sensitive to salt stress. When soil salinity exceeds 0.3%, their tuber yield and quality decline significantly. However, to date, potato salt tolerance breeding still lacks efficient molecular targets. Existing research mainly focuses on the physiological level, with insufficient exploration and functional analysis of key regulatory genes, which seriously restricts the breeding progress of salt-tolerant varieties.

[0003] Traditional breeding methods mainly rely on phenotypic screening and hybridization, which are characterized by long cycles, low efficiency, and high randomness. Although some wild potato germplasm has been reported to have certain salt tolerance potential, its complex genetic background and low frequency of superior alleles make it difficult to utilize effectively through conventional hybridization methods. Therefore, it is urgent to use modern molecular biology techniques to systematically discover and identify key candidate genes that can significantly enhance potato salt tolerance, and to develop products that improve potato salt tolerance. This is of great significance for advancing the breeding process of new potato varieties and ensuring high and stable potato yields. Summary of the Invention

[0004] To address the above problems, the present invention provides StIQD20 Application of gene-related bioproducts in improving plant salt tolerance, overexpression StIQD20 Genes can improve the salt tolerance of potatoes, utilizing... StIQD20 Gene-related bioproducts can be used to genetically modify potatoes.

[0005] To achieve the above objectives, the specific technical solution of the present invention is as follows: The first aspect of the present invention provides StIQD20 The application of gene-related bioproducts in improving plant salt tolerance, the aforementioned StIQD20 The nucleotide sequence of the gene is shown in SEQ ID NO.1; [This is to] improve the [specific effects] in plants. StIQD20 The expression level of genes is adjusted to enhance plant salt tolerance; or to increase the expression level of genes described in plants. StIQD20 The expression level or activity of genes-encoded proteins can be adjusted to improve plant salt tolerance.

[0006] Furthermore, the aforementioned StIQD20 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0007] Furthermore, the biological product is a recombinant plasmid or recombinant Agrobacterium containing the gene shown in SEQ ID NO.1.

[0008] Furthermore, the recombinant plasmid is obtained by inserting the gene shown in SEQ ID NO.1 into the pMDC85 vector.

[0009] Furthermore, the recombinant plasmid is derived from the gene shown in SEQ ID NO.1 via... Hind III and Sac I. Obtained by inserting the restriction enzyme site into the pMDC85 vector.

[0010] Furthermore, the recombinant Agrobacterium is a recombinant Agrobacterium containing the recombinant plasmid.

[0011] Furthermore, the Agrobacterium is GV3101.

[0012] Furthermore, the plant in question is a potato.

[0013] A second aspect of the present invention provides a method for cultivating salt-tolerant transgenic potatoes, comprising the following steps: Constructing a system that includes the above-described features StIQD20 A recombinant expression vector is used to introduce the recombinant expression vector into the gene of the target potato, so that... StIQD20 Gene overexpression yielded the salt-tolerant transgenic potato.

[0014] Furthermore, the recombinant expression vector is pMDC-85- StIQD20 .

[0015] Furthermore, the salt-tolerant genetically modified potato has a higher salt tolerance than the target potato.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides StIQD20 The application of gene-related bioproducts in improving plant salt tolerance. StIQD20 The nucleotide sequence of the gene is shown in SEQ ID NO.1. This invention utilizes Agrobacterium-mediated transformation to... StIQD20 After the gene was introduced into potato material C65, the following was obtained: StIQD20 Transgenic potato plants with overexpressed genes were found in experiments. StIQD20 Genes can alleviate the effects of salt stress on the growth and development of potato seedlings, utilizing... StIQD20 Overexpression of gene-related bioproducts StIQD20 Potato lines with the overexpressed gene exhibited significant agronomical advantages under salt stress: at the same salt concentration, potato lines overexpressing the gene showed higher agronomical performance. StIQD20Potato plants with the overexpressed gene were 1.2 to 3.8 times taller, had more leaves, and weighed 1.2 to 3.8 times more than wild-type plants; StIQD20 The activities of superoxide dismutase, peroxidase, and catalase, as well as proline content, were increased by 1.25 to 3.3 times in the genetically modified potato plants compared to the wild type, while malondialdehyde content was reduced by 10% to 70%. StIQD20 Gene-related bioproducts can enhance plants' antioxidant defense against salt stress and reduce cell damage. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 For potatoes StIQD20 Gene PCR amplification results, lanes 1 to 8 were all StIQD20 Gene amplification results, M stands for DNA Marker.

[0019] Figure 2 For potatoes StIQD20 The results of the overexpression vector digestion and identification are as follows: Lane 1 shows the digestion results of plasmid pMDC85, and Lane 2 shows the digestion results of recombinant plasmid pMDC85-. StIQD20 The enzyme digestion results show that M is the DNA Marker.

[0020] Figure 3 For potatoes StIQD20 The diagram shows the process of cultivating gene overexpression lines, from left to right: positive monoclonal screening, pre-culture, callus formation, callus emergence, and rooting culture.

[0021] Figure 4 For potatoes StIQD20 Results of gene overexpression line screening. Figure 4 A in the context is a combination of... StIQD20 The image shows the PCR verification of recombinant Agrobacterium. Both CW lanes are wild-type controls, and the two P lanes contain samples with the target gene. StIQD20 The recombinant plasmid was used, and lanes 1-6 were selected positive plaques for identification. Figure 4 B in the text represents overexpression. StIQD20 Image showing the identification of potato plants that are positive for the target gene. Lane CW represents the wild-type control, and lane P represents plants containing the target gene. StIQD20The recombinant plasmids were used to construct samples in lanes 8, 9, 13, 14, and 18, which were overexpression-positive plants OE-8, OE-9, OE-13, OE-14, and OE-18, respectively.

[0022] Figure 5 Wild-type and overexpression lines StIQD20 Gene expression level detection: different lowercase letters a, b, c, d, e indicate significant differences between groups.

[0023] Figure 6 The effects of three NaCl concentrations (0 mmol / L, 50 mmol / L, and 100 mmol / L) on wild-type and overexpression-positive plants were investigated. Figure 6 In the figure, A, B, and C represent the effects on plant height, fresh weight, and number of leaves, respectively. Different lowercase letters a, b, and c indicate significant differences between groups.

[0024] Figure 7 The expression level was compared with the wild-type growth status after 30 days of salt stress. Figure 7 A, B, and C in the table represent the plant growth status under salt treatment concentrations of 0 mmol / L, 50 mmol / L, and 100 mmol / L, respectively.

[0025] Figure 8 The effects of different concentrations of CaCl2 on the growth and development of potato seedlings under salt stress were investigated. Figure 8 In the figure, A, B, and C represent the plant growth status under the following conditions: 50 mmol / L treatment, 50 mmol / L NaCl + 50 μmol / L CaCl2 treatment, and 50 mmol / L NaCl + 100 μmol / L CaCl2 treatment, respectively.

[0026] Figure 9 For potatoes StIQD20 Results of the analysis of the effects of genes on potato physiological indicators. Figure 9 In the table, A, B, C, D, and E represent, in order, the levels of superoxide dismutase activity, peroxidase activity, catalase activity, proline content, and malondialdehyde content. Different lowercase letters a, b, c, and d indicate significant differences between groups.

[0027] Figure 10 KEGG annotation analysis for differentially expressed genes.

[0028] Figure 11 For the validation results of differentially expressed genes by qRT-PCR, Figure 11 The genes corresponding to A, B, C, D, E, F, G, H, I, J, K, and L in the above are, in order: WRKY70 , WRKY40 , WRKY6 ,CYP732 , CYP72A219 , GABA , LEA5 , LOX , CYP71D11 , SAM , CML and GS7 .

[0029] Figure 12 For overexpression StIQD20 Analysis of the expression levels of stress-related response genes in positive plants. Figure 12 The genes corresponding to A, B, C, D, E, and F in the above are, in order: SNRK2S , ABF4 , ABI3 , MYB2 , DREB2A , ABI5 Different lowercase letters a, b, and c indicate significant differences between groups. Detailed Implementation

[0030] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0031] Potato material C65 originates from the Potato Planting Resource Bank of the Institute of Potato Science, Yunnan Normal University, and was donated by the Institute of Potato Science, Yunnan Normal University. Those skilled in the art can apply to the International Potato Center (CIP) to obtain this biomaterial.

[0032] Example 1: StIQD20 Construction of gene overexpression vectors In previous studies of this invention, a candidate gene associated with salt stress resistance in potatoes was discovered, namely... StIQD20 Gene, StIQD20 The complete nucleotide sequence of the gene is shown in SEQ ID NO.1 (the underlined base sequence is the exon region of the gene). StIQD20 The CDS sequence of the gene is shown in SEQ ID NO.2. StIQD20 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0033] SEQ ID NO.1: ATGGGGAAAAAAGGCAGTTGGTTTTCTGCCATCAAAAGGGTGTTTACACCTAGCTCAAAGGAGAAATT ACCTAATGTAAGTTTATTTTACACTCTCACAAGGTCTATTTGCTACTCTCTTCCTTTATTTTTTCTCGTACATGCGAACAAAGTTTCATATTGATAGGGAGGCTACATATAAAGTGTAGGATCTCTTAATGGTATGAGGTCTTTTGGAGAAAACCGTGCAGGTTTGGCCCAAAGCATACAATATCACTCCTTGTTAACAGTATTTAGGGCTTACCATTACTAAAAAAGGCAAAAAAAAAAACGATAGACAAAAAAGTTACGGAGTGCGTTGCTCCAAAAAAGCGACGACAAATGGATGTTGTTCGTCGTTTTATATTTGTTTTTTTTACTAGAAAACGACGCAGTCCGTAGCATTTGGCTATCGTTTTTCCAGGCATTTTTTAGTAGTATGCATAGACCAACACTTGCTTATTTCAAAATTAGCTTTCTCCTAAAAAATAGAGTTGAAGGGTTAAAATGTAACAAGGTTAAG ATGGAGTGTCGAAATGAAAATTGATGGCAAATTAGAGAGGTTGTTTATGTATTTGGCCACAAATTAATGACAGAAAAATGTAATTGATGTTTATTATAGTTTACATAAATAAGAATTCAGATGATAATAGAGATCTACAAAACTAATCTATGAACCAATTTCAACAAGTAGTGTCTTACTTCCTCTTGACTGAAAAAATATATGCATGTAGCTATTGAAGTTAACTTAAAATCCCTCAAAACTATTTGAAATCGAGTTGTTCGAAAGGGGAGCATTATTCACATAATATGTTTGCTCTGTAGTATGTGCAAGTTGGCGTTGGCTTTATGAAGTCTCACTGTCCATGTCGCTACATTTAAGCTCATCTTAGTTAGTATTTCAGTGTTATATGTGGTGTAACATCTATATGCCTCACATGTTTCTGGAAGGATCATGTAGTACTTACCTGAATCGGACGATTGTTGCAG [[ID= ​ ​ ​ ​​ ​ GTAAGTTCCTATATAATTTCGCCTTGCAAATGTTTGGCTAACTCTCTTTTGTCAGAAGCTTGTGATTTAGTTTTTGATGCAGCAAGTAGAGGAAAACTGATTGTTAATTGAGTCCAGGCTCTATGGAAGCAACCTCTCTACCTCACGAAGGTAGGGGTAAGGTCTGTGTACACTCCATCCTCCCCAGACCCCACTTATGGTACTATACTAGTATGTTGTACTGTGAAAGAGTAAAGCAATTCATTCGATAGAGTGGACTGCAGCACACATTGTCTAATCAAATCCAATCCAATTCTCTCTCGATCAATATGTTCCTCAAAAATCCGATTCAGGGCAGATTCTTCTCCCAACTAAGCACAGACCCCACATTCAACCCCCCGTTTTACGGAATTTCAACAATTGCTTCATATTATGCTCCTTAGTCAATGGGAAGTACGGAGTGTGCATTCATCCATTGAGGAATTCTATCATATTGCTAAGTTTGTTCTAATTGCCTACTAGGAATAACATCTTATGTCAAAGCGGAGACATGTAACGTTTTGTGACTGTCACATCTACAGCTCAACGAGAACATGATCCTAGATAGGAAAGCATGGAGGTAGAGGGTTAGTACATAGTCGAGTGATTCCTCCTTTTCGTGAGGGAGAACATGGTTCTATTGATCAGTATCATGGTTTTACTTGGGTTATTTGTACTAATTTTGTTGTCGATACTTCCCTTTATTCAGTATTTTTCATTGTAGCTTTTACTCTTGTATTTGTCAAACCTGTTTTTGAAAACACTTTTCTTGAGCGGAGGGTTTATCAGAAACAACATCTTTACCTCTCACAAGGCAGGGGTAAGGCCTGACCCCACCCTCCCCAGACCCCAGAATTACACTAGACGTTTGTTTATCAATTGTTAATAGACGTTACGTTCTAATCTGAGTGCTTTCTGTTTTGACAG ​ AGCTTTGAGGGGTTTAGTAAGGCTTCAAGGAGTTGTGAGAAGTAGTAATGTAAAAAGCAAACAGCAAATGCCATG AAACAGATGCAACTTCTCGTTAGAGTACAAACTCAAATTCAGTCGAGGAGGATCCAAATGTTGGAAAACCAAGCAC TTCAACACCAAGCATATAGAAACGACAAGGAAGTCGAGAGCACCATCAGTAAATGGACTCAACTG GTATGTTTGAACCATCTTTCATGAAGTTACATTCCTATTTAGTGGTTTATAAAAAGTCGTCATTTCCAAAACGATAGTTGTTGATGTTTGATGAACAATGTTGGTATAG TGTGAGGCAGGTAACAATGATAATTGGGATGATAGTTTGCTGACTAAAGAAGAAG TAGAAGGAAGGCTGAGGAAAAAAGTGGAGGCAGTCATCAAGAGGGAGAGAGCAATGGCATATGCATATTCTCACCG G GTACAATAACACCTCTATCTTTGGTGGATTCAACATTTAAAGTTTTTACTATATATATCTATGCTCCATGTTGAAAAAATGATAAGTTCATCCAACGTATGGTCCATCGACTCTCTACATTTTGACAGTTAAGTAGCTCTCTTACAAACTTTTCAAGGCTAATCTTGTTAAATTACCTCTTTTATCAG CTATGGAAAAATGATCCAAATCGGGTTTGGACATGGGA GCTAATGGTTTTCCATGGTGGTGGAATTGGTTAGAACGTCAACTACCTTCAAGAAATGCTAACAAAACTCCATCTG CTGTGAAAGATATCAAACTAACACCACCAAGGGCTATTTCAGAGCACAAACCAAGTCCAACGCCTCTAAACAACGT TACTTTCAGACGTATACTCTCTGATTACGATAACAATGAATCATCAGTCACACCAATGTCAACCAAGTCAGCAATT CCAACGAGGGGAAACAGATGCATACTCCAATTAGAACACCACCAATGAACAACTCAAGTCTAAAGAAGCACTCGA GAGCTCGAGCTAGTGCTTCTAACTACCCTTTTGATCTTCCATTAAAAAGACGATGATAGCCTCACGAGTTGTCCTCC GTTTTCAGTACCACATTACATGTCACAAACAGCATCAGCTAAAGCCAGAGCAAATAGCAATCCTAAGGAGAGAAAT CCAGAAAAACAATCCAATGACACAAAAGAAAGATTTTCATTTCCTTTAACTCCAAATATATGGTCATCCAAATGGA GTAAAGGCTCTGGAAAGGATCCAACTTCTCGAAAGAAGTCGATAAACACGAGTCCATGGCTGATCATATAAGTGT GGATTCAACTGTTTCGATGCCCGCGGTTGTTGGTGGGAGGAGACCATTTAACAGATTTGTGTGA 。

[0034] SEQ ID NO.2:

[0035] SEQ ID NO.3: *

[0036] 1. StIQD20 Cloning of genes RNA was extracted from leaves of C65 potato seedlings grown in vitro (using a TIANGEN kit). The extracted total RNA was reverse transcribed into cDNA (using a Promega kit). Then, using the cDNA from C65 potato seedlings as a template, cloning primers were designed using Primer Premier 6.0. StIQD20 The full-length CDS of the gene was amplified by PCR, and the primer sequences are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0037] Upstream primer: 5'-ATGGGGAAAAAAGGCAGTTGG-3', SEQ ID NO.4; Downstream primer: 5'-TCACACAAATCTGTTAAATGGTC-3', SEQ ID NO.5.

[0038] Each 20 μL PCR reaction mixture contains: 1 μL cDNA, 10 μM 0.5 μL upstream primer, 10 μM 0.5 μL downstream primer, and 10 μL 2×SevenBasis Taq PCR Mix (Dye). + ), add ddH2O to make up to 20μL.

[0039] PCR reaction program: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

[0040] PCR amplification results as follows Figure 1 As shown, under the comparison with the DL 2000 DNA Marker, the size of the amplified bands in lanes 1-8 is similar to... StIQD20 The fact that the nucleotide sequences encoding the genes are of the same size indicates that... StIQD20 Gene cloning was successful.

[0041] 2. StIQD20 Construction of gene overexpression vectors Using pMDC85 as the vector backbone, the amplified material from step 1 was reproduced via homologous recombination. StIQD20 The CDS fragment was inserted into the linearized pMDC85 vector, and the recombinant plasmid pMDC85- was obtained by enzyme digestion verification. StIQD20 .

[0042] like Figure 2 As shown, lane 1 is Hind III and Sac I. Double enzyme digestion diagram. Lane 2 is the recombinant plasmid pMDC85- StIQD20 Enzyme digestion verification results Figure 2 The large fragment band shown is the pMDC85 vector band after enzyme digestion; the band size of 1608 bp is the fragment after enzyme digestion. StIQD20 Gene fragments.

[0043] Example 2: StIQD20 Construction of overexpression plants Genetic transformation of potato material C65 was performed using Agrobacterium-mediated transformation. The procedure is as follows: Figure 3 , Figure 3 The images from left to right are, in order: screening for Agrobacterium-positive monoclonal plaques, pre-culture of C65 potato stem segments for genetic transformation, callus induction culture, callus differentiation culture, and culture in culture bottles.

[0044] Obtaining recombinant bacteria: The recombinant expression vector pMDC85- obtained in Example 1 was used... StIQD20Transformation was performed on *E. coli* DH5α competent cells via heat shock. The transformed competent cells were cultured in LB liquid medium and then plated onto LB solid medium containing kanamycin. After plaque growth, single colonies were picked and first verified by PCR. If the PCR verification was correct, the colonies were preliminarily identified as positive. Then, positive single-clone colonies were selected and cultured in a shaker, and the bacterial culture was sent for sequencing to obtain the results. StIQD20 The recombinant Escherichia coli positive strain was obtained; the recombinant expression vector pMDC85- was extracted from the above-mentioned recombinant Escherichia coli positive clone strain using a plasmid extraction kit. StIQD20 After transformation into Agrobacterium competent GV3101 cells, and selection by rifampicin and kanamycin resistance, followed by identification by colony PCR, the obtained positive clones are those containing [the active ingredient]. StIQD20 Agrobacterium recombinant strain, containing StIQD20 The recombinant Agrobacterium was stored in a refrigerator at -80°C.

[0045] Stem segment pre-culture: Cut a number of stem segments, place them on a pre-culture medium, and culture them under light for 48 hours.

[0046] Strain activation: Take the Agrobacterium recombinant bacterial suspension from the -80℃ freezer and add it to a 50mL centrifuge tube containing 20mL of LB liquid medium containing 50mg / L rifampin and 50mg / L kanamycin. Activate the culture by constant temperature shaking at 28℃ and 220rpm for 2 days for later use.

[0047] Infection: Aliquot the Agrobacterium recombinant bacterial suspension into centrifuge tubes and centrifuge (4000 r / min, 15 min), collecting the bacterial pellet. Pipette the supernatant into a waste bottle, leaving the bacterial pellet. Add 1 mL of MS20 liquid medium, pipette to mix the bacterial pellet, and transfer the entire mixture into a 50 mL centrifuge tube. OD... 600 Adjust to 1.5. Using tweezers, place the pre-cultured stem segments into the resuspended bacterial solution and incubate for 30 minutes. Then, remove the stem segments and air-dry them in an empty petri dish lined with filter paper to remove excess bacterial solution. Place the stem segments in a co-culture medium, seal them with sealing film, and then wrap the entire petri dish with newspaper. Incubate the stem segments in the dark at 28°C for 48 hours. Afterward, transfer the stem segments to callus induction medium and incubate in a light incubator for 3 weeks. Next, transfer all stem segments to callus differentiation medium. Once shoots emerge, transfer them to sterile rooting bottles. Once the plants have rooted, they are new genetically transformed and regenerated plants.

[0048] After the leaves of the newly genetically transformed and regenerated plants have grown in sterile rooting bottles, total DNA is extracted from the leaves of both the new genetically transformed and regenerated plants and wild-type plants as templates for subsequent PCR reactions. The pMDC85 vector sequence is then compared with the gene... StIQD20PCR was performed using specific primers designed for the coding sequence. The reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 1 min, for 35 cycles; final extension at 72℃ for 5 min; and storage at 4℃. The PCR products were detected and identified by gel electrophoresis, and the selected products were... StIQD20 Plants with positive gene overexpression were propagated and preserved.

[0049] Figure 4 In the diagram, A represents the PCR verification image of Agrobacterium-positive plaques transformed with the recombinant vector; lane CW represents the wild-type control; and lane P represents the plaque containing the target gene. StIQD20 The recombinant plasmid was used, and lanes 1-6 were selected positive plaques for identification. Figure 4 B in the text represents overexpression. StIQD20 Image showing identification of gene-positive plants; lane CW represents the wild-type control, and lane P represents plants containing the target gene. StIQD20 The recombinant plasmids were used to construct samples in lanes 8, 9, 13, 14, and 18, which were overexpression-positive plants OE-8, OE-9, OE-13, OE-14, and OE-18, respectively.

[0050] 3. Overexpression strains StIQD20 Gene expression level detection Extracting OE-8, OE-9, OE-13, OE-14, and OE-18 from overexpressing positive plants StIQD20 The concentration and purity of extracted RNA, including genomic RNA and wild-type plant RNA, were determined using a UV spectrophotometer. The quality of RNA extraction significantly affects the reliability of the experimental results. After purification with DNase I, the extracted RNA was retained at concentrations above 100 ng / μL and expressed as OD0.05. 260 / OD 280 RNA samples with a cDNA concentration between 1.8 and 2.1 (as the selection criterion) were subjected to cDNA reverse transcription. The diluted reverse transcription product was then used as a template. StIQD20 -F and StIQD20 -R was used for qRT-qPCR detection. qRT-PCR primers were designed using NCBI Primer-BLAST, and Actin was selected as the internal reference gene.

[0051] StIQD20 -F: 5'-GCTTGACTTTGATGGAGTGGTGG-3', SEQ ID NO.6; StIQD20 -R: 5'-AAGATTGGCTATCGGAGGTGC-3', SEQ ID NO. 7.

[0052] The reaction system is as follows: TB Green Premix Ex Taq II (Tli RNaseH Plus) (2×) 10µL, 10µmol / L StIQD20 -F and StIQD20 0.8 µL of each of -R, 2 µL of diluted cDNA, 0.4 µL of Dye II (50×), and 6 µL of sterile water.

[0053] The quantitative fluorescence reaction program was set as follows: pre-denaturation at 95℃ for 30 s; then cycling, each cycle consisting of denaturation at 95℃ for 5 s, annealing at 60℃ for 34 s, followed by melting curve analysis at 95℃ for 15 s, 60℃ for 60 s, and 95℃ for 15 s, for a total of 40 cycles.

[0054] The response results of wild-type plants were used as a control group, and 2 -ΔΔCt The relative expression levels of genes were calculated using formulas, and the significance of differences was analyzed using SPSS software and Duncan's new multiple range method.

[0055] like Figure 5 , StIQD20 The relative expression levels of the overexpression positive plants were all higher than those of the wild-type plants. OE-8, OE-9, OE-14, and OE-18 increased the expression levels of wild-type potato material C65 by 1.5 times, 2.5 times, 2.9 times, and 1.9 times, respectively, and there were also differences in the expression levels among the various overexpression positive plants.

[0056] Example 3: StIQD20 Application of genes in improving salt tolerance of potatoes 1. Determination of phenotypic traits of potatoes under salt stress treatment Five replicates were performed at salt concentrations of 0 mmol / L, 50 mmol / L, and 100 mmol / L, with six seedlings placed in each culture flask. Wild-type and overexpression-positive plants were grown in MS medium at different salt concentrations. After 30 days, the seedlings of each line were measured. The plant height and root length of each seedling were measured using a graduated steel ruler, the fresh weight of each seedling was weighed using an electronic balance, and the number of leaves and roots per plant was recorded.

[0057] like Figure 6As shown, both 50 mmol / L and 100 mmol / L NaCl concentrations significantly affected the plant height, fresh weight, and leaf number of both overexpression-positive and wild-type plants. The order of potato plant height, fresh weight, and leaf number from highest to lowest salt concentration was: 0 mmol / L, 50 mmol / L, and 100 mmol / L. However, the plant height of overexpression-positive plants treated with 50 mmol / L was higher than that of wild-type plants. As the salt concentration gradually increased, the observation data on plant height, fresh weight, and leaf number of both overexpression-positive and wild-type plants showed a decreasing trend. Significantly, the decrease in plant height, leaf number, and fresh weight of overexpression-positive plants was significantly smaller than that of wild-type plants, and at the same salt concentration, the plant height, leaf number, and fresh weight of overexpression-positive plants were 1.2 to 3.8 times that of wild-type plants. Figure 7 After 30 days of salt stress, the positive seedlings could grow under salt concentrations of 0 mmol / L, 50 mmol / L and 100 mmol / L, while the wild type failed to root under 100 mmol / L NaCl treatment.

[0058] 2. Calcium signaling coordination mechanism Overexpressing plants and wild-type plants were grown in solid MS medium, Ca 2+ The recovery experiments were conducted by subculturing in MS solid medium containing sodium chloride at the same concentration of 50 mmol / L and in MS medium containing different concentrations of calcium chloride (50 μmol / L and 100 μmol / L). The growth phenotype was observed after 30 days. There were 4 strains in this experiment, with 3 biological replicates in each group.

[0059] Figure 8 It can be seen that the growth status of overexpressing plants at a salt concentration of 50 mmol / L is better than that of wild-type plants, and the application of Ca under salt stress... 2+ Under these conditions, the growth changes of potato seedlings can be clearly observed when Ca is applied. 2+ Compared to not applying Ca 2+ The changes were quite different. The plant height, number of leaves, number of roots, and root length of wild-type and overexpression plants were significantly improved in 50 mmol / L NaCl + 50 μmol / L CaCl2 and 50 mmol / L NaCl + 100 μmol / L CaCl2 compared to the 50 mmol / L NaCl concentration. This indicates that applying a certain amount of calcium ions under salt stress can alleviate the damage to potato plants under stress. At the same concentration, it can be observed that the plant height, root length, number of roots, and number of leaves of overexpression plants and wild-type plants changed significantly, and the phenotype of overexpression plants was better than that of wild-type plants.

[0060] 3. Physiological index analysis Overexpression-positive plants and wild-type seedlings under simulated salt stress treatment were collected, and three leaves were weighed and ground into samples. The activities of peroxidase (POD), superoxide dismutase (SOD), catalase (CAT), proline (PRO), and malondialdehyde (MDA) were measured using an activity assay kit from Sangon Biotech (Shanghai).

[0061] like Figure 9 As shown, the activities of SOD, POD, and CAT in both wild-type and overexpression-positive plants increased with increasing salt concentration. The SOD enzyme activity in overexpression-positive plants was higher than that in wild-type plants, and the increases in enzyme activities of OE-9, OE-14, and OE-18 were more pronounced with increasing salt concentration. Figure 9 (A) Increased salt concentration also enhanced POD activity in overexpressing positive plants and wild-type plants. As salt concentration continued to increase, the POD activity of OE-14 and OE-18 was higher than that of other lines. Only under normal conditions was there no significant difference in POD activity between OE-18 and wild-type. Figure 9 (B in the text); CAT activity also increases with increasing salt concentration, with OE-9, OE-14, and OE-18 showing particularly high CAT activity at different concentrations. Figure 9 (C in the text); Under 50 mmol / L NaCl treatment, compared with the wild type, the activities of POD, SOD, and CAT in OE-9 were approximately increased by 1.8 times, 1.7 times, and 2 times, respectively, while the activities of these three enzymes in OE-14 were approximately increased by 2.6 times, 1.4 times, and 1.5 times, respectively. The PRO content in both overexpression and wild-type plants increased with increasing salt concentration, and the PRO content in overexpression plants was higher than that in wild-type plants. The most significant increases were observed in OE-9, OE-14, and OE-18. The most significant increases in PRO content were observed when the NaCl concentration was increased from 50 mmol / L to 100 mmol / L. Figure 9 (D in the text). The MDA content in overexpressing positive plants decreased continuously with increasing salt concentration, while the MDA content in wild-type plants increased continuously, and the MDA content in overexpressing plants decreased continuously. Figure 9 (E in the text). In summary, under the same salt concentration treatment, overexpression... StIQD20 The activities of superoxide dismutase, peroxidase, and catalase, as well as proline content, were increased by 1.25 to 3.3 times in gene-positive plants compared to wild-type plants, while malondialdehyde (MDA) content was reduced by 10% to 70%. This indicates that overexpression-positive plants, under salt stress, continuously enhance enzyme activity while reducing MDA content to minimize plant damage and thus resist adverse environmental conditions. StIQD20 Reduce cell damage by enhancing antioxidant defenses.

[0062] Example 4: StIQD20 Analysis of the molecular regulatory network of genes in improving salt tolerance in potatoes Wild-type potato material C65 and overexpression line OE-9 (OE-9 showed better growth under salt stress) were cultivated using tissue culture methods. Aerial tissues from positive overexpression plants and wild-type plants were collected and rapidly cryopreserved in liquid nitrogen after sampling. Each line was replicated three times. Total RNA was extracted from the samples using a kit method, and the concentration and purity of the extracted RNA were determined using a UV spectrophotometer. Transcriptome analysis of wild-type potato material C65 and overexpression line OE-9 was performed to screen for differentially expressed genes. The expression of these differentially expressed genes under salt stress was then analyzed using qRT-PCR. For differentially expressed gene screening, a Fold Change (the ratio of expression levels between two samples or groups) ≥ 2 and a False Discovery Rate (FDR) < 0.05 were used as screening criteria. FDR, adjusted for p-values, was used to measure the significance of the difference. For ease of comparison, the fold change was logarithmic, expressed as log2FC. Genes with larger absolute values ​​of log2FC and smaller FDR values ​​show more significant differences in the two groups of samples.

[0063] KEGG annotation analysis of differentially expressed genes revealed 140 differentially expressed genes that were mapped to 38 metabolic pathways. The first 33 pathways, containing 135 differentially expressed genes, were selected for mapping analysis. These 33 metabolic pathways were categorized into five main groups: Cellular Processes, Environmental Information Processing, Cerebrovascular Information Processing, Metabolism, and Organic Systems. One cellular process pathway was enriched: endocytosis. Three environmental information processing pathways were enriched: the plant MAOKA signaling pathway, plant hormone signal transduction, and the phosphatidylinositol signaling system. Six pathways were enriched: protein processing in the endoplasmic reticulum, spliceosomes, basal transcription factors, RNA transport, protein export, and homologous recombination. Twenty-two metabolic pathways were identified, with starch and sucrose metabolism and phenylpropane biosynthesis having the most genes. One organic system pathway was identified: plant-pathogen interactions. Figure 10 ).

[0064] To verify the reliability of the transcriptome sequencing results, cDNA from the leaf transcriptomes of normally growing wild-type potato material C65 and overexpression line OE-9 were used as templates, and qRT-PCR was used to analyze 12 differentially expressed genes. WRKY70 , WRKY40 , WRKY6 , CYP732 , CYP72A219 , GABA , LEA5 , LOX , CYP71D11 , SAM , CML and GS7 The results were verified. Using leaf cDNA from wild-type potato material C65 and overexpression line OE-9 treated with 25 mmol / L salt as templates, qRT-PCR experiments were performed to analyze the changes in the expression levels of differentially expressed genes under different salt concentrations.

[0065] The results are as follows Figure 11 As shown, under a salt concentration of 25 mmol / L, four genes showed decreased expression levels in the overexpression line OE-9 compared to the wild-type potato material C65. These are: WRKY70 , WRKY40 , WRKY6 , CYP732 Genes, Remaining CYP72A219 , GABA , LEA5 , LOX , CYP71D11 , SAM , CML and GS7 The expression levels of all eight genes in the overexpressing line OE-9 were higher than those in the wild-type potato material C65.

[0066] And positively regulates genes: LEA5 Gene (expression level upregulated by 0.3-fold) GABA Genes (2.4 times) CYP72A219 The gene (upregulated by 1.1-fold) was significantly activated in the overexpression line OE-9.

[0067] Example 5: StIQD20 Bioinformatics analysis Bioinformatics analysis shows that StIQD20 Located on chromosome 8, it encodes a hydrophilic, non-transmembrane protein with 13 serine phosphorylation sites. This is significantly different from the structural features of other plant IQD genes (such as Arabidopsis thaliana AtIQD1), highlighting its species specificity.

[0068] Through phylogenetic tree analysis StIQD20It has the highest homology with the tomato IQD gene, but it is specifically upregulated under salt stress. ABF4 , MYB2 Stress response genes, and ABI5 The expression downregulation is a regulatory pattern that has been less studied in other Solanaceae crops.

[0069] RNA was extracted from leaves of wild-type potato material C65 and overexpression lines OE-14 and OE-18 for qRT-PCR. The overexpression was analyzed using qRT-PCR. StIQD20 Subsequent studies on salt stress response genes in potatoes SNRK2S , ABF4 , ABI3 , MYB2 , DREB2A , ABI5 The impact of transcription.

[0070] The results are as follows Figure 12 As shown, potato salt stress response genes SNRK2S , ABF4 , MYB2 , DREB2A The transcriptional level of ABI3 was significantly higher in overexpressing positive plants than in wild-type plants. The overexpressing plants of ABI3 showed a significant difference from wild-type plants, while the expression of ABI5 was lower in the wild-type plants.

[0071] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0072] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. StIQD20 The use of gene-related biological products in improving plant salt tolerance, characterized in that, The StIQD20 The nucleotide sequence of the gene is shown in SEQ ID NO.1; [This is to] improve the [specific effects] in plants. StIQD20 The expression level of genes is adjusted to enhance plant salt tolerance; or to increase the expression level of genes described in plants. StIQD20 The expression level or activity of genes-encoded proteins can be adjusted to improve plant salt tolerance.

2. Use according to claim 1, characterized in that, The biological product is a recombinant plasmid or a recombinant agrobacterium containing the gene shown in SEQ ID NO.

1.

3. Use according to claim 2, characterized in that, The recombinant plasmid is obtained by inserting the gene shown in SEQ ID NO. 1 into a pMDC85 vector.

4. Use according to claim 2, characterized in that, The recombinant agrobacterium is a recombinant agrobacterium containing the recombinant plasmid.

5. Use according to claim 4, characterized in that, The recombinant agrobacterium is obtained by introducing the recombinant plasmid into agrobacterium.

6. Use according to claim 5, characterized in that, The agrobacterium is GV3101.

7. The use according to claim 1, characterized in that, The plant is potato.

8. A method of breeding a salt tolerant transgenic potato, characterized by, The method comprises the following steps: A recombinant expression vector comprising the gene according to claim 1 is constructed, the recombinant expression vector is introduced into the gene of the target potato, the gene is overexpressed, and the salt-tolerant transgenic potato is obtained. StIQD20 A recombinant expression vector comprising the gene according to claim 1 is constructed, the recombinant expression vector is introduced into the gene of the target potato, the gene is overexpressed, and the salt-tolerant transgenic potato is obtained. StIQD20 A recombinant expression vector comprising the gene according to claim 1 is constructed, the recombinant expression vector is introduced into the gene of the target potato, the 9. The method of claim 8, wherein, The recombinant expression vector is pMDC-85 StIQD20 .

10. The method of claim 8, wherein, The salt tolerance of the salt-tolerant transgenic potato is greater than that of the target potato.