Nucleic acid compound formulations and uses thereof

Abstract

The present disclosure relates to high concentration siRNA compositions suitable for subcutaneous administration. The composition contains cyclodextrin as a viscosity reducer. The present disclosure also relates to methods of treating or preventing diseases using the formulations.

Description

Related applications

[0001] This application claims the benefit and priority of U.S. Provisional Application No. 63 / 513,429, filed July 13, 2023, which is incorporated herein by reference in its entirety.

[0002] Reference to the electronic sequence list The contents of the electronic sequence list (CMCH_012_001WO_SeqList_ST26.xml; size: 95,210 bytes; and creation date: July 11, 2024) are incorporated herein by reference in their entirety. Background Technology

[0003] Therapeutic administration of siRNA typically requires high doses due to low cellular uptake and insufficient potency. Furthermore, the preferred method of siRNA delivery, subcutaneous injection, limits the volume of the administered dose. Therefore, high-concentration formulations are necessary to avoid multiple injections.

[0004] However, these formulations may exhibit high viscosity, leading to manufacturing difficulties, increased tissue back pressure, and injection pain. High-concentration oligonucleotide solutions exhibit concentration-dependent viscosity increases due to self-association caused by overcrowding of nucleotide chains. Several reversible interactions, including electrostatics, hydrophobicity, hydrogen bonding, and van der Waals forces, can promote the self-association of nucleotide chains, resulting in supramolecular structures. Due to the diversity of interactions specific to nucleotide sequences, a unified theoretical and mechanistic understanding is lacking in the development of stable, high-concentration nucleic acid formulations with relatively low viscosity.

[0005] Therefore, there is still a need to develop high-concentration, low-viscosity nucleic acid preparations to make them suitable for subcutaneous injection. Summary of the Invention

[0006] In some aspects, this disclosure provides a formulation comprising: (i) Nucleic acid molecules (e.g., dsRNA molecules); and (ii) Cyclodextrin agents.

[0007] In some aspects, this disclosure provides a formulation comprising: (i) Two nucleic acid molecules (e.g., a first dsRNA molecule and a second dsRNA molecule); and (ii) Cyclodextrin agents.

[0008] In some aspects, this disclosure provides a formulation comprising: (i) dsRNA molecules, wherein the dsRNA molecules are present at a concentration of at least about 150 mg / mL; and (ii) Cyclodextrins present at a concentration of about 5% w / v to about 35% w / v.

[0009] In some aspects, this disclosure provides a formulation comprising: (ii) dsRNA molecules, wherein the dsRNA molecules are present at a concentration of about 150 mg / mL to about 250 mg / mL; and (ii) A cyclodextrin agent present at a concentration of about 5% w / v to about 10% w / v (preferably about 6.5% w / v).

[0010] In some aspects, this disclosure provides a formulation comprising: (i) a first dsRNA molecule and a second dsRNA molecule, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of at least 150 mg / mL; and (ii) Cyclodextrins present at a concentration of about 5% w / v to about 35% w / v.

[0011] In some aspects, this disclosure provides a formulation comprising: (i) a first dsRNA molecule and a second dsRNA molecule, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of about 150 mg / mL to about 250 mg / mL; and (ii) A cyclodextrin agent present at a concentration of about 5% w / v to about 10% w / v (preferably about 6.5% w / v).

[0012] In some aspects, this disclosure provides a formulation comprising: (i) dsRNA molecules, wherein the dsRNA molecules are present at a concentration of about 150 mg / mL to about 250 mg / mL; and (ii) A cyclodextrin agent present in the preparation at a cyclodextrin:dsRNA molar ratio not exceeding 5.

[0013] In some respects, this disclosure provides a method for treating or preventing disease, which includes administering the disclosed formulation to a subject in need.

[0014] In some respects, this disclosure provides formulations disclosed herein for the treatment or prevention of diseases in subjects in need.

[0015] In some aspects, this disclosure provides a method for inhibiting the secretion of soluble fms-like tyrosine kinase-1 (sFLT1) by a subject, comprising administering the formulation disclosed herein to the subject.

[0016] In some respects, this disclosure provides formulations disclosed herein for inhibiting sFLT1 in subjects.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. In this specification, the singular form includes the plural form unless the context clearly requires otherwise. While similar or equivalent methods and materials to those described and used herein may be used in practice or testing of this disclosure, suitable methods and materials are described below. All disclosures, patent applications, patents, and other references mentioned herein are incorporated herein by reference. References cited herein are not recognized as prior art to the claimed invention. In case of conflict, this specification (including definitions) shall prevail. Furthermore, these materials, methods, and examples are illustrative only and are not intended to be restrictive. In case of conflict between the chemical structures and names of compounds disclosed herein, the chemical structure shall prevail.

[0018] Other features and advantages of this disclosure will become apparent from the following detailed description and claims. Brief description of the attached diagram Figure 1A-1D Four exemplary structural formulas of the antisense or sense strand of nucleic acid molecules are described.

[0020] Figure 2A-2B The study described the effect of not adding HPBCD at a concentration of 150 mg / mL. Figure 2A Or add 6.5%wt HPBCD ( Figure 2B The viscosity of a formulation containing a first dsRNA molecule and a second dsRNA molecule in a 1:1 ratio.

[0021] Figure 3 The viscosity of the formulation containing a 1:1 ratio of first dsRNA molecules and second dsRNA molecules at different HPBCD concentrations was described.

[0022] Figures 4A-4C To depict the first dsRNA molecule when prepared using water or HPBCD as a medium ( Figure 4A ), second dsRNA molecule ( Figure 4B ) and the combination of the first dsRNA molecule and the second dsRNA molecule ( Figure 4C A set of graphs showing the UV absorption rate curves of ).

[0023] Figure 5 A diagram illustrating an exemplary method for preparing a formulation.

[0024] Figure 6A graph depicting the plasma concentration distribution of each siRNA (i.e., the first dsRNA and the second dsRNA in a 1:1 ratio) after subcutaneous administration of 50 mg / kg in HPBCD and PBS. Detailed Implementation

[0025] Due to the unique properties of nucleic acid compounds, the discovery and development of formulations containing them face numerous challenges. One major challenge is how to achieve high concentrations of nucleic acid compounds while controlling the resulting increase in viscosity. As the concentration of nucleic acids increases, intermolecular interactions lead to increased viscosity, making it challenging to formulate suitable delivery systems.

[0026] This disclosure especially Based on the discovery that cyclodextrins can significantly reduce the viscosity of high-concentration oligonucleotide formulations, cyclodextrins have traditionally been widely used as solubilizers for hydrophobic molecules. Their ability to form inclusion complexes with hydrophobic portions can improve solubility and bioavailability. However, the finding that cyclodextrins can also significantly affect the viscosity of high-concentration nucleic acid formulations at concentrations below commonly used levels is novel and unexpected. This has important implications for the formulation and development of high-concentration nucleic acid formulations, especially for applications requiring lower viscosity, such as subcutaneous injection. The ability to reduce viscosity while maintaining high oligonucleotide concentrations can improve ease of administration, enhance patient comfort, and facilitate the effective delivery of therapeutic drugs.

[0027] The formulation disclosed herein This article provides formulations of nucleic acid molecules, such as formulations suitable for administration by subcutaneous injection or application.

[0028] In some aspects, this disclosure provides a formulation comprising: (i) Nucleic acid molecules (e.g., dsRNA molecules); and (ii) Cyclodextrin agents.

[0029] In some implementations, the formulation comprises: (i) Two or more nucleic acid molecules (e.g., two or more dsRNA molecules); and (ii) Cyclodextrin agents.

[0030] In some implementations, the formulation comprises: (i) Two nucleic acid molecules (e.g., a first dsRNA molecule and a second dsRNA molecule); and (ii) Cyclodextrin agents.

[0031] In some implementations, the formulation also includes a buffer.

[0032] In some implementations, the formulation also includes a tension modifier.

[0033] In some aspects, this disclosure provides a formulation comprising: (i) Two nucleic acid molecules (e.g., a first dsRNA molecule and a second dsRNA molecule); (ii) Cyclodextrin agents; (iii) Buffers; and (iv) Tension regulators.

[0034] In some implementations, the formulation also includes one or more excipients.

[0035] In some implementations, the formulation also includes a solvent.

[0036] Nucleic acid reagent In some implementations, nucleic acid molecules are suitable for therapeutic, diagnostic, clinical, or drug delivery purposes.

[0037] In some implementations, the nucleic acid molecule is a copy DNA (cDNA), DNA aptamer, DNA enzyme, RNA aptamer, external guide sequence, RNA interference molecule, morpholino, messenger RNA (mRNA), or long non-coding RNA (lincRNA).

[0038] In some implementations, the nucleic acid molecule is an RNA interference molecule.

[0039] In some implementations, nucleic acid molecules include small interfering RNA (siRNA), double-stranded RNA (dsRNA), antisense RNA, short hairpin RNA, or microRNA (miRNA).

[0040] In some implementations, the nucleic acid molecule is a dsRNA molecule.

[0041] In some embodiments, the nucleic acid is a high molecular weight nucleic acid with a molecular weight greater than about 10,000 g / mol. In other embodiments, the nucleic acid is a low molecular weight nucleic acid with a molecular weight less than about 10,000 g / mol. In some embodiments, the molecular weight of the polymer is determined by methods known in the art (such as mass spectrometry), and the molecular weight value is determined using methods known in the art (e.g., number-average molecular weight, weight-average molecular weight, or peak-average molecular weight). In some embodiments, the molecular weight of the nucleic acid is about 1000-5000 g / mol, or about 5000-10000 g / mol, or about 5000-15000 g / mol, or about 10000-20000 g / mol.

[0042] In some implementations, nucleic acid molecules induce gene silencing through RNA interference. RNA interference (RNAi) can effectively silence gene expression in a highly specific manner.

[0043] Small interfering RNA (siRNA) is a double-stranded RNA (dsRNA) that can induce sequence-specific posttranscriptional gene silencing, thereby reducing or even suppressing gene expression. In one example, siRNA triggers specific degradation of homologous RNA molecules (such as mRNA) within a region of sequence identity between the siRNA and the target RNA. For instance, WO 02 / 44321 discloses an siRNA that, when paired with a 3' overhang base, can perform sequence-specific degradation of target mRNA.

[0044] Synthesized short double-stranded RNAs (siRNAs) produced using the mimicry enzyme Dicer can achieve sequence-specific gene silencing in mammalian cells (Elbashir et al. (2001) Nature, 411:494-498) (Ui-Tei et al. (2000) FEBS Lett 479:79-82). siRNAs can be chemically or enzymatically synthesized, or they can be the result of short double-stranded hairpin RNAs (shRNAs) processed into siRNAs within the cell.

[0045] In some embodiments, the active agent is a double-stranded RNA (dsRNA) molecule or a pharmaceutically acceptable salt thereof as described in WO2022271786A1, the contents of which are incorporated herein by reference in their entirety for any purpose. In some embodiments, the formulations of this disclosure comprise dsRNA molecules. In some embodiments, the formulations of this disclosure comprise two dsRNA molecules (e.g., a first dsRNA molecule and a second dsRNA molecule).

[0046] In some embodiments, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modification; (4) any one or more nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are interconnected by phosphate thionucleotide internucleotide bonds; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0047] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modification; (4) any one or more nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; and (5) the nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are inter-nucleotides linked by phosphate thioester bonds. (6) A portion of the antisense strand is complementary to a portion of the sense strand; (7) The sense strand is at least 15 nucleotides in length; (8) The sense strand contains at least 65% 2'-O-methyl modification; (9) The nucleotides at any one or more positions at positions 4, 6, 8, 10 and 14 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; and (10) The nucleotides at positions 1-2 from the 5' end of the sense strand are linked together by phosphate thionucleotide inter-linkages.

[0048] In some implementations, the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20, starting from the 5' end of the antisense strand, are not 2'-methoxy-ribonucleotides.

[0049] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (3) the nucleotides at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (4) the nucleotides at positions 1-2 to 1-7 from the 3' end of the antisense strand are interconnected by phosphate thionucleotide internucleotide bonds; and (5) a portion of the antisense strand is complementary to a portion of the sense strand.

[0050] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; and (3) the nucleotides at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides. (4) Nucleotides at positions 1-2 to 1-7 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (5) A portion of the antisense strand is complementary to a portion of the sense strand; (6) The sense strand contains alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; and (7) Nucleotides at positions 1-2 from the 5' end of the sense strand are linked together by phosphate thionucleotide bonds.

[0051] In some embodiments, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modification; (4) any one or more nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are interconnected by phosphate thionucleotide internucleotide bonds; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0052] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:1). NO:2) The sequences are substantially complementary; (2) The length of the antisense strand is at least 20 nucleotides; (3) The antisense strand contains at least 50% 2'-O-methyl modification; (4) The nucleotides at any one or more positions from the 5' end of the antisense strand at positions 2, 4, 5, 6, 8, 10, 12, 14, 16 and 18 are not 2'-methoxy-ribonucleotides; (5) The nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are interconnected by thiophosphate nucleotide bonds; (6) A portion of the antisense strand is complementary to a portion of the sense strand; (7) The length of the sense strand is at least 15 nucleotides; (8) The sense strand contains at least 80% 2'-O-methyl modification; (9) The nucleotides at any one or more positions from the 5' end of the sense strand at positions 7, 9 and 11 are not 2'-methoxy-ribonucleotides; and (10) The nucleotides at positions 1-2 from the 5' end of the sense strand are interconnected by thiophosphate nucleotide bonds.

[0053] In some implementations, the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18, starting from the 5' end of the antisense strand, are not 2'-methoxy-ribonucleotides.

[0054] In some implementations, the nucleotides at positions 7, 9, and 11 starting from the 5' end of the positive strand are not 2'-methoxy-ribonucleotides.

[0055] In some embodiments, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 70% 2'-O-methyl modification; (4) any one or more nucleotides at positions 2, 4, 5, 6, 8, and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are interconnected by phosphate thionucleotide internucleotide bonds; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0056] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 70% 2'-O-methyl modification; and (4) the nucleotides at any one or more positions from the 5' end of the antisense strand at positions 2, 4, 5, 6, 8, and 14 are not 2'-methoxy-ribonucleotides; (5) Nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense strand is complementary to a portion of the sense strand; (7) The sense strand is at least 15 nucleotides in length; (8) The sense strand contains 100% 2'-O-methyl modification; and (9) Nucleotides at positions 1-2 from the 5' end of the sense strand are linked together by phosphate thionucleotide bonds.

[0057] In some implementations, the nucleotides at positions 2, 4, 5, 6, 8, and 14, starting from the 5' end of the antisense strand, are not 2'-methoxy-ribonucleotides.

[0058] In some embodiments, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 75% 2'-O-methyl modification; (4) any one or more nucleotides at positions 2, 4, 5, 6, and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are interconnected by phosphate thionucleotide internucleotide bonds; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0059] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 75% 2'-O-methyl modification; and (4) the nucleotides at any one or more positions from the 5' end of the antisense strand at positions 2, 4, 5, 6, and 14 are not 2'-methoxy-ribonucleotides; (5) Nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense strand is complementary to a portion of the sense strand; (7) The sense strand is at least 15 nucleotides in length; (8) The sense strand contains 100% 2'-O-methyl modification; and (9) Nucleotides at positions 1-2 from the 5' end of the sense strand are linked together by phosphate thionucleotide bonds.

[0060] In some embodiments, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 85% 2'-O-methyl modification; (4) any one or more nucleotides at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are interconnected by phosphate thionucleotide internucleotide bonds; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0061] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 85% 2'-O-methyl modification; and (4) the nucleotides at any one or more positions at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) Nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense strand is complementary to a portion of the sense strand; (7) The sense strand is at least 15 nucleotides in length; (8) The sense strand contains 100% 2'-O-methyl modification; and (9) Nucleotides at positions 1-2 from the 5' end of the sense strand are linked together by phosphate thionucleotide bonds.

[0062] In some embodiments, the antisense strand is 20 nucleotides long. In some embodiments, the antisense strand is 21 nucleotides long. In some embodiments, the antisense strand is 22 nucleotides long.

[0063] In some embodiments, the length of the positive strand is 15 nucleotides. In some embodiments, the length of the positive strand is 16 nucleotides. In some embodiments, the length of the positive strand is 18 nucleotides. In some embodiments, the length of the positive strand is 20 nucleotides.

[0064] In some embodiments, the dsRNA molecule contains a double-stranded region of 15 to 20 base pairs. In some embodiments, the dsRNA molecule contains a double-stranded region of 15 base pairs. In some embodiments, the dsRNA molecule contains a double-stranded region of 16 base pairs. In some embodiments, the dsRNA molecule contains a double-stranded region of 18 base pairs. In some embodiments, the dsRNA molecule contains a double-stranded region of 20 base pairs.

[0065] In some implementations, the dsRNA molecule contains a blunt end.

[0066] In some implementations, the dsRNA molecule contains at least one single-stranded nucleotide overhang.

[0067] In some implementations, the dsRNA molecule contains a single-stranded nucleotide overhang of about 2 to 5 nucleotides.

[0068] In some embodiments, the dsRNA molecule contains 4-16 phosphate-thionucleotide bonds. In other embodiments, the dsRNA molecule contains 8-13 phosphate-thionucleotide bonds.

[0069] In some implementations, the sense strand contains one or more nucleotide mismatches between the antisense strand and the sense strand.

[0070] In some implementations, the antisense chain comprises a 5'-phosphate ester, a 5'-alkylphosphonate, a 5'-alkylenephosphonate, or a 5'-alkenylphosphonate.

[0071] In some implementations, the complementary region is complementary to at least 15, 16, 17 or 18 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2.

[0072] In some implementations, the complementary region contains no more than three mismatches with SEQ ID NO: 1 or SEQ ID NO: 2.

[0073] In some implementations, the complementary region is completely complementary to SEQ ID NO: 1 or SEQ ID NO: 2.

[0074] In some implementations, the antisense strand contains (e.g., consists of) the nucleic acid sequence 5'UAAAUUUGGAGAUCCGAGAGA 3' (SEQ ID NO: 3), and the sense strand contains or consists of the nucleic acid sequence 5'CGGAUCUCCAAAUUUA 3' (SEQ ID NO: 4).

[0075] In some implementations, the antisense strand comprises or consists of the nucleic acid sequence 5' UAUAAAUGGUAGCUAUGAUGA 3' (SEQ ID NO: 5), and the sense strand comprises or consists of the nucleic acid sequence 5' AUAGCUACCAUUUAUA 3' (SEQ ID NO: 6).

[0076] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) Antisense chain contains and (2) The chain of justice includes (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA)(SEQ ID NO: 8), Where “m” corresponds to 2’-O-methyl modification, “f” corresponds to 2’-fluorine modification, and “#” corresponds to the internucleotide bond of thiophosphate ester.

[0077] In some respects, dsRNA molecules contain antisense and sense strands, each with a 5' end and a 3' end, wherein: (1) Antisense chain contains and (2) The chain of justice includes (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA)(SEQ ID NO: 10), Where “m” corresponds to 2’-O-methyl modification, “f” corresponds to 2’-fluorine modification, and “#” corresponds to the internucleotide bond of thiophosphate ester.

[0078] In some implementations, the antisense chain comprises 5' vinylphosphonate.

[0079] In some implementations, the functional portion is connected to the 3' end of the justice chain.

[0080] In some implementations, the functional portion includes a hydrophobic portion.

[0081] In some implementations, the hydrophobic portion is selected from the group consisting of: fatty acids, steroids, open-ring steroids, lipids, gangliosides, nucleotide analogs, endocannabinoids, vitamins, and mixtures thereof.

[0082] In some implementations, the steroid is selected from the group consisting of cholesterol and lithocholic acid (LCA).

[0083] In some embodiments, the fatty acid is selected from the group consisting of eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and docosahexaenoic acid (DCA). In some embodiments, the fatty acid is EPA. In some embodiments, the fatty acid is DHA. In some embodiments, the fatty acid is DCA. In some embodiments, the fatty acid is PC-DCA.

[0084] In some implementations, the vitamins are selected from the group consisting of choline, vitamin A, vitamin E, and their derivatives or metabolites.

[0085] In some implementations, the functional portion is connected to the Justice Chain via a connector.

[0086] In some implementations, the dsRNA molecule contains a docosanoic acid (DCA) conjugate attached to the 3' end of the positive strand.

[0087] In some implementations, the DCA is connected to the Chain of Justice via a connector.

[0088] In some implementations, the connector is a pyrolytic connector.

[0089] In some implementations, the cleavable linker includes a phosphate diester bond, a disulfide bond, an acid-labile bond, or a photocleavable bond.

[0090] In some implementations, the cleavable linker comprises a dTdT dinucleotide having an internucleotide bond between phosphodiester nucleotides.

[0091] In some implementations, the acid-unstable bonds include β-thiopropionate bonds or carboxydimethylmaleic anhydride (CDM) bonds.

[0092] In some implementations, the connector includes a bivalent or trivalent connector.

[0093] In some implementation schemes, divalent or trivalent is , , , or ; Where n is 1, 2, 3, 4 or 5.

[0094] In some embodiments, the linker includes an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a thiophosphate, a phosphoramide, an amide, a carbamate, or a combination thereof.

[0095] In some implementations, when the connector is a trivalent connector, the connector is further connected to a phosphate diester or a phosphate diester derivative.

[0096] In some implementations, the connector is further connected to a phosphate diester or a phosphate diester derivative.

[0097] In some implementations, phosphate diesters or phosphate diester derivatives are , , or ; Where X is O, S or BH3.

[0098] In some implementations, the nucleotides at positions 1 and 2 starting from the 3' end of the sense strand and the nucleotides at positions 1 and 2 starting from the 5' end of the antisense strand are linked to adjacent ribonucleotides via phosphate thioester bonds.

[0099] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) Antisense chain contains and (2) The chain of justice includes (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA)(T)(T)-PCDCA (SEQ ID NO: 12), Where “m” corresponds to 2'-O-methyl modification, “f” corresponds to 2'-fluorine modification, “T” corresponds to thymidine DNA nucleotide, “#” corresponds to the internucleotide bond of thiophosphate, “V” corresponds to 5'-vinylphosphonate, and “PCDCA” corresponds to the 3'-C7-phosphocholine-docosahexaenoic acid conjugate via a phosphate linker.

[0100] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) Antisense chain contains and (2) The chain of justice includes (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA)(T)(T)-PCDCA (SEQ ID NO: 14), Where “m” corresponds to 2'-O-methyl modification, “f” corresponds to 2'-fluorine modification, “T” corresponds to thymidine DNA nucleotide, “#” corresponds to the internucleotide bond of thiophosphate, “V” corresponds to 5'-vinylphosphonate, and “PCDCA” corresponds to the 3'-C7-phosphocholine-docosahexaenoic acid conjugate via a phosphate linker.

[0101] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) Antisense chain inclusion formula I( Figure 1A ) or its salt; and (2) Justice Chain Inclusion II Figure 1B ) or its salt.

[0102] In some implementations, the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) Antisense chain inclusion formula III ( Figure 1C ) or its salt; and (2) Justice Chain Inclusion IV( Figure 1D ) or its salt.

[0103] In some implementations, the dsRNA molecule is a neutral molecule, its ionic form, or a salt thereof.

[0104] In some implementations, the dsRNA molecule is a pharmaceutically acceptable salt.

[0105] In some implementations, the dsRNA molecule is a sodium or potassium salt.

[0106] In some implementations, the dsRNA molecule is a sodium salt.

[0107] In some implementations, the dsRNA molecule is a potassium salt.

[0108] First and second dsRNA molecules In some implementations, the formulation contains two or more dsRNA molecules.

[0109] In some implementations, the formulation comprises: A first dsRNA molecule comprising a first sense strand and a first antisense strand, wherein the first antisense strand contains a complementary region substantially complementary to SEQ ID NO: 1; and A second dsRNA molecule comprising a second sense strand and a second antisense strand, wherein the second antisense strand comprises a complementary region substantially complementary to SEQ ID NO: 2.

[0110] In some implementations, the formulation comprises: A first dsRNA molecule comprising a first sense strand and a first antisense strand (each strand having a 5' end and a 3' end), wherein the first antisense strand contains a complementary region substantially complementary to SEQ ID NO: 1; and A second dsRNA molecule comprising a second sense strand and a second antisense strand (each strand having a 5' end and a 3' end), wherein the second antisense strand comprises a complementary region substantially complementary to SEQ ID NO: 2; For each of the first and second dsRNA molecules: (1) the antisense strand is at least 20 nucleotides long; (3) the antisense strand contains at least 50% 2'-O-methyl modification; and (4) the nucleotides at any one or more positions from the 5' end of the antisense strand at positions 2, 4, 5, 6, 8, 10, 12, 14, 16 and 20 are not 2'-methoxyribonucleotides. (5) The nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense strand is complementary to a portion of the sense strand; (7) The sense strand is at least 15 nucleotides in length; (8) The sense strand contains at least 65% 2'-O-methyl modification; (9) The nucleotides at any one or more positions 4, 6, 8, 10 and 14 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; and (10) The nucleotides at positions 1-2 from the 5' end of the sense strand are linked together by phosphate thionucleotide bonds.

[0111] In some implementations, the formulation comprises: (a) A first dsRNA molecule comprising a first antisense strand and a first sense strand (each strand having a 5' end and a 3' end), wherein: (a-1) The first antisense chain contains and (a-2) The first chain of justice includes (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA)(SEQ ID NO: 8), (b) A second dsRNA molecule comprising a second antisense strand and a second sense strand (each strand having a 5' end and a 3' end), wherein: (b-1) The second antisense chain contains and (b-2) The second chain of justice includes (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA)(SEQ ID NO: 10), Where “m” corresponds to 2’-O-methyl modification, “f” corresponds to 2’-fluorine modification, and “#” corresponds to the internucleotide bond of thiophosphate ester.

[0112] In some implementations, the formulation comprises: (a) A first dsRNA molecule comprising a first antisense strand and a first sense strand (each strand having a 5' end and a 3' end), wherein: (a-1) The first antisense chain contains and (a-2) The first chain of justice includes (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA)(T)(T)-PCDCA (SEQ ID NO: 12), (b) A second dsRNA molecule comprising a second antisense strand and a second sense strand (each strand having a 5' end and a 3' end), wherein: (b-1) The second antisense chain contains and (b-2) The second chain of justice includes (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA)(T)(T)-PCDCA (SEQ ID NO: 14), Where “m” corresponds to 2'-O-methyl modification, “f” corresponds to 2'-fluorine modification, “T” corresponds to thymidine DNA nucleotide, “#” corresponds to the internucleotide bond of thiophosphate, “V” corresponds to 5'-vinylphosphonate, and “PCDCA” corresponds to the 3'-C7-phosphocholine-docosahexaenoic acid conjugate via a phosphate linker.

[0113] In some implementations, the formulation comprises: (a) A first dsRNA comprising a first antisense strand and a first sense strand (each strand having a 5' end and a 3' end), wherein: (a-1) First antisense chain inclusion formula I( Figure 1A ) or its salt; and (a-2) Justice Chain Inclusion II Figure 1B ) or its salt; and (b) A second dsRNA containing a second antisense strand and a second sense strand (each strand having a 5' end and a 3' end), wherein: (b-1) Second antisense chain inclusion formula III ( Figure 1C ) or its salt; and (b-2) Second Chain of Justice Inclusion IV ( Figure 1D ) or its salt.

[0114] Table 1 provides the molecular formula, molecular weight, and sequence of exemplary first and second dsRNA molecules.

[0115] Nucleic acid molecule (dsRNA molecule) concentration In some embodiments, nucleic acid molecules (e.g., dsRNA molecules) are present in the formulation at a total concentration of about 100 mg / mL or higher, about 110 mg / mL or higher, about 120 mg / mL or higher, about 130 mg / mL or higher, about 140 mg / mL or higher, about 150 mg / mL or higher, about 160 mg / mL or higher, about 170 mg / mL or higher, about 180 mg / mL or higher, about 190 mg / mL or higher, about 200 mg / mL or higher, about 250 mg / mL or higher, about 300 mg / mL or higher, about 350 mg / mL or higher, about 400 mg / mL or higher, about 450 mg / mL or higher, or about 500 mg / mL or higher.

[0116] In some implementations, nucleic acid molecules (e.g., dsRNA molecules) are present at concentrations of approximately 100 mg / mL, approximately 105 mg / mL, approximately 110 mg / L, approximately 115 mg / mL, approximately 120 mg / L, approximately 125 mg / mL, approximately 130 mg / mL, approximately 135 mg / mL, approximately 140 mg / L, approximately 145 mg / L, approximately 150 mg / L, approximately 155 mg / L, approximately 160 mg / mL, approximately 165 mg / mL, approximately 170 mg / L, approximately 175 mg / L, approximately 180 mg / L, approximately 185 mg / L, approximately 190 mg / mL, approximately 195 mg / mL, approximately 200 mg / L, approximately 205 mg / L, approximately 210 mg / L, approximately 215 mg / L, approximately 220 mg / L, approximately 225 mg / L, approximately 230 mg / L, approximately 235 mg / L, approximately 240 mg / mL, approximately 20 ... The formulation is present at a total concentration of approximately 245 mg / L or approximately 250 mg / L.

[0117] In some embodiments, the first dsRNA molecule and the second dsRNA molecule are in concentrations of approximately 100 mg / mL, approximately 105 mg / mL, approximately 110 mg / L, approximately 115 mg / mL, approximately 120 mg / L, approximately 125 mg / mL, approximately 130 mg / mL, approximately 135 mg / mL, approximately 140 mg / L, approximately 145 mg / L, approximately 150 mg / L, approximately 155 mg / L, approximately 160 mg / mL, approximately 165 mg / mL, approximately 170 mg / L, approximately 175 mg / L, approximately 180 mg / L, approximately 185 mg / L, approximately 190 mg / mL, approximately 195 mg / mL, approximately 200 mg / L, approximately 205 mg / L, approximately 210 mg / L, approximately 215 mg / L, approximately 220 mg / L, approximately 225 mg / L, approximately 230 mg / L, approximately 235 mg / L, approximately 240 mg / mL, approximately 20 ... The formulation is present at a total concentration of approximately 245 mg / L or approximately 250 mg / L.

[0118] In some embodiments, the first dsRNA molecule is present in the formulation at a concentration of about 50 mg / mL, about 55 mg / mL, about 60 mg / mL, about 65 mg / mL, about 70 mg / mL, about 75 mg / mL, about 80 mg / mL, about 85 mg / mL, about 90 mg / mL, about 95 mg / mL, about 100 mg / mL, about 105 mg / mL, about 110 mg / mL, about 115 mg / mL, about 120 mg / mL, or about 125 mg / mL.

[0119] In some embodiments, the second dsRNA molecule is present in the formulation at concentrations of about 50 mg / mL, about 55 mg / mL, about 60 mg / mL, about 65 mg / mL, about 70 mg / mL, about 75 mg / mL, about 80 mg / mL, about 85 mg / mL, about 90 mg / mL, about 95 mg / mL, about 100 mg / mL, about 105 mg / mL, about 110 mg / mL, about 115 mg / mL, about 120 mg / mL, or about 125 mg / mL.

[0120] In some embodiments, the first dsRNA molecule is present in the formulation at concentrations of about 50 mg / mL, about 55 mg / mL, about 60 mg / mL, about 65 mg / mL, about 70 mg / mL, about 75 mg / mL, about 80 mg / mL, about 85 mg / mL, about 90 mg / mL, about 95 mg / mL, about 100 mg / mL, about 105 mg / mL, about 110 mg / mL, about 115 mg / mL, about 120 mg / mL, or about 125 mg / mL; and the second dsRNA molecule is present in the formulation at concentrations of about 50 mg / mL, about 55 mg / mL, about 60 mg / mL, about 65 mg / mL, about 70 mg / mL, about 75 mg / mL, about 80 mg / mL, about 85 mg / mL, about 90 mg / mL, about 95 mg / mL, about 100 mg / mL, about 105 mg / mL, about 110 mg / mL, about 115 mg / mL, or about 120 mg / mL; and the second dsRNA molecule is present in the formulation at concentrations of about 50 mg / mL, about 55 mg / mL, about 60 mg / mL, about 65 mg / mL, about 70 mg / mL, about 75 mg / mL, about 80 mg / mL, about 85 mg / mL, about 90 mg / mL, about 95 mg / mL, about 100 mg / mL, about 105 mg / mL, about 110 mg / mL, about 115 mg / mL, or about 120 mg / mL. It exists in the formulation at a concentration of mg / mL or about 125 mg / mL.

[0121] In some embodiments, the first dsRNA molecule is present in the formulation at a concentration of about 87.5 ± 30 mg / mL, about 87.5 ± 25 mg / mL, about 87.5 ± 20 mg / mL, about 87.5 ± 15 mg / mL, about 87.5 ± 10 mg / mL, about 87.5 ± 5 mg / mL, about 87.5 ± 4 mg / mL, about 87.5 ± 3 mg / mL, about 87.5 ± 2 mg / mL, or about 87.5 ± 1 mg / mL (e.g., about 87.5 mg / mL).

[0122] In some embodiments, the second dsRNA molecule is present in the formulation at a concentration of about 87.5 ± 30 mg / mL, about 87.5 ± 25 mg / mL, about 87.5 ± 20 mg / mL, about 87.5 ± 15 mg / mL, about 87.5 ± 10 mg / mL, about 87.5 ± 5 mg / mL, about 87.5 ± 4 mg / mL, about 87.5 ± 3 mg / mL, about 87.5 ± 2 mg / mL, or about 87.5 ± 1 mg / mL (e.g., about 87.5 mg / mL).

[0123] In some embodiments, the first dsRNA molecule is present in the formulation at concentrations of about 87.5 ± 30 mg / mL, about 87.5 ± 25 mg / mL, about 87.5 ± 20 mg / mL, about 87.5 ± 15 mg / mL, about 87.5 ± 10 mg / mL, about 87.5 ± 5 mg / mL, about 87.5 ± 4 mg / mL, about 87.5 ± 3 mg / mL, about 87.5 ± 2 mg / mL, or about 87.5 ± 1 mg / mL (e.g., about 87.5 mg / mL); and the second dsRNA molecule is present in the formulation at concentrations of about 87.5 ± 30 mg / mL, about 87.5 ± 25 mg / mL, about 87.5 ± 20 mg / mL, about 87.5 ± 15 mg / mL, about 87.5 ± 10 mg / mL, about 87.5 ± 5 mg / mL, about 87.5 ± 4 mg / mL, or about 87.5 ± 3 mg / mL. The formulation is present at concentrations of mg / mL, about 87.5 ± 2 mg / mL, or about 87.5 ± 1 mg / mL (e.g., about 87.5 mg / mL).

[0124] Cyclodextrin While not wanting to be bound by theory, it is understood that cyclodextrins can significantly reduce (e.g., by up to nine times) the viscosity of formulations containing nucleic acid molecules. This viscosity reduction is observed using significantly lower concentrations of cyclodextrin compared to concentrations typically used to enhance molecular solubility.

[0125] In some implementations, the cyclodextrin agent is a substituted or unsubstituted cyclodextrin.

[0126] In some embodiments, the cyclodextrin agent is a substituted or unsubstituted α-cyclodextrin, a substituted or unsubstituted β-cyclodextrin, or a substituted or unsubstituted γ-cyclodextrin.

[0127] Cyclodextrins are non-reducing cyclic glucose oligosaccharides made from starch. There are three common types of cyclodextrins, each composed of 6, 7, or 8 glucose units (α-, β-, and γ-cyclodextrins, respectively) linked by α-1,4 glycosidic bonds. Cyclodextrins act as molecular containers, encapsulating guest molecules within their internal cavities to form inclusion complexes. α-Cyclodextrins have smaller cavities, while β- and γ-cyclodextrins have larger cavities.

[0128] Suitable cyclodextrins include α-cyclodextrins, β-cyclodextrins, and γ-cyclodextrins, but β-cyclodextrins and γ-cyclodextrins are preferred due to their larger internal cavities. Cyclodextrins, particularly β-cyclodextrins, are chemically modified to improve the solubility of the base cyclodextrin. Hydroxyethyl β-cyclodextrin, hydroxypropyl β-cyclodextrin (e.g., 2-hydroxypropyl-β-cyclodextrin), methylated β-cyclodextrin, glucosyl β-cyclodextrin, and sulfobutyl ether β-cyclodextrin are examples of cyclodextrins chemically modified to improve solubility. In some embodiments, β-cyclodextrins, including chemically modified β-cyclodextrins, will be used. In some embodiments, the chemically modified β-cyclodextrin will be hydroxypropyl β-cyclodextrin or sulfobutyl ether β-cyclodextrin. In some embodiments, the cyclodextrin will be γ-cyclodextrin, including chemically modified γ-cyclodextrins. In some embodiments, the cyclodextrin will be hydroxypropyl cyclodextrin (e.g., HP4.3-β-cyclodextrin, HP5.5-β-cyclodextrin, HP7.6-β-cyclodextrin, and HP4.5-γ-cyclodextrin). In some embodiments, the cyclodextrin will be sulfobutyl ether β-cyclodextrin (e.g., SBE6.6-β-cyclodextrin, SBE6.7-β-cyclodextrin, SBE6.8-β-cyclodextrin, SBE4.1-β-cyclodextrin, and SBE4.6Et3.5-β-cyclodextrin). In some embodiments, the cyclodextrin will be sulfobutyl ether γ-cyclodextrin (e.g., SBE4.3-γ-cyclodextrin, SBE4.6-γ-cyclodextrin, SBE5.2-γ-cyclodextrin, and SBE5.6Et6.3-γ-cyclodextrin). As used in this article, "chemically modified β-cyclodextrin" refers to β-cyclodextrin that has been chemically modified to improve its solubility by at least the level of its base cyclodextrin (i.e., unmodified cyclodextrin).

[0129] In some implementations, the cyclodextrin agent is a substituted or unsubstituted β-cyclodextrin.

[0130] In some implementations, the cyclodextrin agent is an unsubstituted β-cyclodextrin.

[0131] In some implementations, the cyclodextrin agent is a substituted β-cyclodextrin.

[0132] Hydroxypropyl (HP) substitution in β-cyclodextrin (BCD) refers to the modification of attaching a hydroxypropyl group to the BCD molecule. HP substitution levels can vary, typically categorized as low, medium, or high. Essentially, this level refers to the average number of hydroxypropyl groups added per cyclodextrin molecule. For medium molar hydroxypropyl substitution, the nominal substitution value for HPBCD is approximately 0.61; for high molar hydroxypropyl substitution, the nominal substitution value is approximately 0.9.

[0133] In some implementations, the cyclodextrin agent is hydroxypropyl β-cyclodextrin (HPBCD).

[0134] In some implementations, the w / v of HPBCD is 5% to 10%.

[0135] In some implementations, the cyclodextrin agent (e.g., HPBCD) is present in the formulation at a concentration of about 5% w / v or higher.

[0136] In some implementations, HPBCD is present in the formulation at a concentration ranging from about 5% w / v to about 10% w / v.

[0137] In some implementations, HPBCD is present in the formulation at concentrations of about 5.0% w / v, about 5.5% w / v, about 6.0% w / v, about 6.5% w / v, about 7.0% w / v, about 7.5% w / v, about 8% w / v, about 8.5% w / v, about 9% w / v, about 9.5% w / v, or about 10% w / v.

[0138] In some embodiments, HPBCD is present in the formulation at concentrations of about 6.5 ± 3.0% w / v, about 6.5 ± 2.5% w / v, about 6.5 ± 2.0% w / v, about 6.5 ± 1.0% w / v, about 6.5 ± 0.9% w / v, about 6.5 ± 0.8% w / v, about 6.5 ± 0.7% w / v, about 6.5 ± 0.6% w / v, about 6.5 ± 0.5% w / v, about 6.5 ± 0.4% w / v, about 6.5 ± 0.3% w / v, about 6.5 ± 0.2% w / v, or about 6.5 ± 0.1% w / v.

[0139] In some implementations, HPBCD is present in the formulation at a concentration of approximately 6.5% w / v.

[0140] In some implementations, HPBCD is present in the formulation at a concentration not exceeding 10% w / v.

[0141] In some embodiments, HPBCD is present in the formulation at concentrations of about 65±30 mg / mL, about 65±25 mg / mL, about 65±20 mg / mL, about 65±15 mg / mL, about 65±10 mg / mL, about 65±5 mg / mL, about 65±4 mg / mL, about 65±3 mg / mL, about 65±2 mg / mL, or about 65±1 mg / mL (e.g., about 65 mg / mL).

[0142] In some embodiments, the molar ratio of HPBCD:dsRNA in the formulation does not exceed 5. In some embodiments, the molar ratio of HPBCD:dsRNA in the formulation is between 2.5 and 5. In some embodiments, the molar ratio of HPBCD:dsRNA in the formulation is about 2.5, about 3.0, about 3.5, about 4.0, about 4.5, or about 5.0. In some embodiments, the molar ratio of HPBCD:dsRNA in the formulation is between 3 and 15, 5 and 13, 6 and 11, or 6.5 and 10. In some embodiments, the molar ratio of HPBCD:dsRNA in the formulation is about 3.0, about 4.0, about 5.0, about 6.0, about 7.0, about 8.0, about 9.0, about 10.0, about 11.0, about 12.0, about 13.0, about 14.0, or about 15.0.

[0143] buffer Not wanting to be bound by theory, buffers can maintain the pH range required for the formulation.

[0144] Pharmaceutically acceptable buffers are well known in the art and include, but are not limited to, phosphate buffer, histidine, sodium citrate, HEPES, Tris, Bicine, glycine, N-glycylglycine, sodium acetate, sodium carbonate, glycylglycine, lysine, arginine, sodium phosphate, and mixtures thereof. In some embodiments, the buffer is selected from histidine, phosphate buffer, HEPES, and sodium citrate. In some embodiments, the buffer is selected from disodium hydrogen phosphate, potassium dihydrogen phosphate, or any combination thereof.

[0145] In some embodiments, the concentration of the buffer in the formulation is about 0.10% w / v, about 0.09% w / v, about 0.08% w / v, about 0.07% w / v, about 0.06% w / v, about 0.05% w / v, about 0.04% w / v, about 0.03% w / v, about 0.02% w / v, or about 0.01% w / v.

[0146] Exemplary concentrations of the buffer solution in the formulations disclosed herein are about 5 mM to about 100 mM, about 50 mM, about 10 mM to about 40 mM, or about 20 mM. In some embodiments, the concentration of Tris is about 5 mM to about 50 mM, about 10 mM to about 40 mM, or about 20 mM.

[0147] In some implementations, the pH range of the formulation is from about 6.5 to about 9.0.

[0148] In some embodiments, the pH of the formulation is about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, about 8.0, about 8.1, about 8.2, about 8.3, about 8.4, about 8.5, about 8.6, about 8.7, about 8.8, about 8.9, or about 9.0.

[0149] In some implementations, the pH range of the formulation is from about 6.0 to about 8.0.

[0150] In some implementations, the pH range of the formulation is from about 6.5 to about 7.5.

[0151] In some embodiments, the pH of the formulation is about 7.0±2.0, about 7.0±1.5, about 7.0±1.0, about 7.0±0.9, about 7.0±0.8, about 7.0±0.7, about 7.0±0.6, about 7.0±0.5, about 7.0±0.4, about 7.0±0.3, about 7.0±0.2, or about 7.0±0.1 (e.g., about 7.0).

[0152] Tension regulator In some implementations, the formulation includes a tension modifier (also known as an osmotic agent or osmotic pressure regulator) to regulate and maintain the osmotic pressure or tension of the formulation to match the osmotic pressure or tension of the target biological environment or target tissue.

[0153] In some embodiments, the tension modifier can be selected from a variety of tension modifiers, including sodium chloride, potassium chloride, glucose, mannitol, glycerol, and sorbitol. In some embodiments, the tension modifier is selected from sodium chloride, potassium chloride, and any combination thereof.

[0154] In some embodiments, the concentration of the tension modifier in the formulation is about 0.50% w / v, about 0.45% w / v, about 0.40% w / v, about 0.35% w / v, about 0.30% w / v, about 0.25% w / v, about 0.20% w / v, about 0.15% w / v, or about 0.10% w / v.

[0155] Exemplary concentrations of the tension modifier in the formulations disclosed herein are about 50 mM, about 100 mM, about 150 mM, about 200 mM, about 250 mM, or about 300 mM.

[0156] Solvents and other suitable excipients In some implementations, the solvent includes water.

[0157] In some implementations, the solvent is water.

[0158] In some implementations, the excipients include preservatives, humectants, or chelating agents.

[0159] In some embodiments, the preservatives include sorbic acid, parabens (e.g., methylparaben or propylparaben), sodium methylparaben, sodium propylparaben, sorbitol solution, thimerosal, and quaternary ammonium salts (NH4). + Salts), benzalkonium chloride, potassium permanganate, citalopram chloride, hexadecylpyridine chloride, cetrimonium bromide, quaternary ammonium salt-15, sodium benzoate, imidazolidinyl urea, diazolidinyl urea, chlorhexidine gluconate, urea, DMDM ​​hydantoin, isochlorothiazoline, benzoic acid, benzyl alcohol, phenoxyethanol, or any combination thereof (e.g., concentrations ranging from about 0.1% w / w to about 10% w / w).

[0160] In some implementations, the preservatives include sorbic acid, methylparaben, and propylparaben.

[0161] In some implementations, the moisturizers include glycerin, sorbitol, propylene glycol, butylene glycol, hexanediol, and polyethylene glycol. n( Where n = 200, 300, 400, 550, 600 or 1000), water or combinations thereof (e.g., concentrations ranging from about 0.1% w / w to about 50% w / w).

[0162] In some embodiments, the chelating agent includes ethylenediaminetetraacetic acid (EDTA), disodium ethylenediaminetetraacetic acid, calcium EDTA, or combinations thereof (e.g., concentrations ranging from about 0.1% w / w to about 10% w / w).

[0163] Formulation characteristics In some implementations, after administration to a subject (e.g., subcutaneous administration), the formulation exhibits improved pharmacokinetic characteristics compared to a reference formulation (e.g., without HPBCD). Without being bound by theory, the improved pharmacokinetic characteristics of the formulation may result in reduced local interactions of the first and / or second dsRNA molecules at or near the subcutaneous injection site. Without being bound by theory, the increased solubility of the formulation in the extracellular matrix may be attributed to the complexation of the first and / or second dsRNA molecules with HPBCD, which may contribute to improved absorption.

[0164] In some implementations, after administration to subjects (e.g., subcutaneous administration), the formulation exhibits interspecies T-cell differentiation compared to a reference formulation (e.g., without HPBCD). max The relative variability is reduced.

[0165] In some embodiments, after administration (e.g., subcutaneous administration), the formulation showed a T-cell ratio between mice and monkeys compared to a reference formulation (e.g., without HPBCD). max The relative variability is reduced.

[0166] In some embodiments, after administration (e.g., subcutaneous administration), the formulation showed a Tg difference between rats and monkeys compared to a reference formulation (e.g., without HPBCD). max The relative variability is reduced.

[0167] In some implementations, after administration (e.g., subcutaneous administration), the formulation exhibits a T-cell ratio between mice and humans compared to a reference formulation (e.g., without HPBCD). max The relative variability is reduced.

[0168] In some embodiments, after administration (e.g., subcutaneous administration), the formulation exhibits a T-cell ratio between rats and humans compared to a reference formulation (e.g., without HPBCD). max The relative variability is reduced.

[0169] In some embodiments, after administration (e.g., subcutaneous administration), the formulation showed a Tg difference between monkeys and humans compared to a reference formulation (e.g., without HPBCD). max The relative variability is reduced.

[0170] In some implementations, after administration to subjects (e.g., subcutaneous administration), the formulation exhibits improved local tolerability compared to a reference formulation (e.g., without HPBCD) due to reduced immune and / or inflammatory responses.

[0171] In some implementations, immune and / or inflammatory responses are determined by histopathological analysis or measurement.

[0172] In some implementations, the immune and / or inflammatory response is determined by histopathological analysis or measurement, wherein the analysis is determined by microscopic measurement.

[0173] In some implementations, the immune response is determined by a clinical scoring or grading system.

[0174] In some implementations, the immune response is determined by histopathological analysis or measurement at the injection site of the formulation.

[0175] In some implementations, the immune response is determined by histopathological analysis or measurement at the skin injection site.

[0176] In some implementations, the immune response is determined by histopathological analysis or measurement of the skin injection site where immune cells are present or infiltrated.

[0177] In some embodiments, improved pharmacokinetic characteristics are determined by comparing the pharmacokinetic characteristics of a formulation disclosed herein (e.g., containing a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin agent) with a reference formulation (e.g., containing a first dsRNA molecule and a second dsRNA molecule, but without a cyclodextrin agent).

[0178] In some embodiments, the formulations disclosed herein (e.g., containing a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin agent) produce improved pharmacokinetic results compared to a reference formulation (e.g., containing a first dsRNA molecule and a second dsRNA molecule, but without a cyclodextrin agent). The improved pharmacokinetics are achieved by reaching the maximum concentrations (T0) of the first and second dsRNA molecules after administration. max It is measured by the reduction or decrease in the time required to reach peak value.

[0179] In some embodiments, the T compared to a reference formulation (e.g., containing a first dsRNA molecule and a second dsRNA molecule, but without a cyclodextrin agent) max In comparison, T max The reduction was measured as T in the formulations disclosed herein (e.g., comprising a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin agent). max The multiple change decreases, where T maxThe multiple variation is reduced to at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 4.5 times, at least about 5 times, at least about 5.5 times, at least about 6 times, at least about 6.5 times, at least about 7 times, at least about 7.5 times, at least about 8 times, at least about 8.5 times, at least about 9 times, at least about 9.5 times, or at least about 10 times. In some embodiments, T max The reduction is more than 10 times.

[0180] In some embodiments, the formulations disclosed herein (e.g., containing a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin agent) produce improved pharmacokinetic results compared to a reference formulation (e.g., containing a first dsRNA molecule and a second dsRNA molecule, but without a cyclodextrin agent), wherein the improved pharmacokinetics are measured by the maximum concentrations (C0) of the first and second dsRNA molecules after administration of the formulation disclosed herein. max The increase of ) is used to indicate.

[0181] In some embodiments, compared to a reference formulation (e.g., containing a first dsRNA molecule and a second dsRNA molecule, but without a cyclodextrin agent), C max The increase was measured as C in the formulations disclosed herein (e.g., comprising a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin agent). max The multiple change increases, where C max The multiple change increases to at least 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 4.5 times, at least about 5 times, at least about 5.5 times, at least about 6 times, at least about 6.5 times, at least about 7 times, at least about 7.5 times, at least about 8 times, at least about 8.5 times, at least about 9 times, at least about 9.5 times, or at least about 10 times. In some embodiments, C max The increase is more than 10 times.

[0182] In some implementations, after administration to a subject (e.g., subcutaneous administration), the formulation (e.g., containing a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin) exhibited a reduced T value compared to a reference formulation (e.g., without HPBCD). max And / or the added C max .

[0183] In some implementations, after administration to a subject (e.g., subcutaneous administration), the formulation (e.g., containing a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin) exhibited a reduced T value compared to a reference formulation (e.g., without HPBCD). max .

[0184] In some implementations, after administration to a subject (e.g., subcutaneous administration), the Tg of the formulation (e.g., containing a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin) is compared to a reference formulation (e.g., without HPBCD). max It reduced by at least approximately 1.1 times, at least approximately 1.5 times, at least approximately 2 times, at least approximately 2.5 times, at least approximately 3 times, at least approximately 3.5 times, at least approximately 4 times, at least approximately 4.5 times, at least approximately 5 times, at least approximately 5.5 times, at least approximately 6 times, at least approximately 6.5 times, at least approximately 7 times, at least approximately 7.5 times, at least approximately 8 times, at least approximately 8.5 times, at least approximately 9 times, at least approximately 9.5 times, or at least approximately 10 times.

[0185] In some implementations, after administration to a subject (e.g., subcutaneous administration), the formulation (e.g., containing a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin) exhibited increased C compared to a reference formulation (e.g., without HPBCD). max .

[0186] In some implementations, after administration to a subject (e.g., subcutaneous administration), the C1 of the formulation (e.g., containing a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin) is compared to a reference formulation (e.g., without HPBCD). max It increased by at least approximately 1.1 times, at least approximately 1.5 times, at least approximately 2 times, at least approximately 2.5 times, at least approximately 3 times, at least approximately 3.5 times, at least approximately 4 times, at least approximately 4.5 times, at least approximately 5 times, at least approximately 5.5 times, at least approximately 6 times, at least approximately 6.5 times, at least approximately 7 times, at least approximately 7.5 times, at least approximately 8 times, at least approximately 8.5 times, at least approximately 9 times, at least approximately 9.5 times, or at least approximately 10 times.

[0187] In some embodiments, the formulation (e.g., comprising a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin agent) is capable of distributing the first dsRNA and the second dsRNA into the tissue.

[0188] In some embodiments, the formulation (e.g., comprising a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin agent) is capable of distributing the first and second dsRNAs to the liver, brain, heart, skin, lungs, prostate, ovaries, stomach, intestines, muscles, eyes, throat, thymus, kidneys, or placenta.

[0189] In some embodiments, the formulation (e.g., comprising a first dsRNA molecule, a second dsRNA molecule, and a cyclodextrin agent) is capable of distributing the first dsRNA and the second dsRNA into the placenta.

[0190] In some embodiments, the viscosity of the formulation is about 50 cP or less, about 45 cP or less, about 40 cP or less, about 35 cP or less, about 30 cP or less, about 25 cP or less, about 20 cP or less, about 19 cP or less, about 18 cP or less, about 17 cP or less, about 16 cP or less, about 15 cP or less, about 14 cP or less, about 13 cP or less, about 12 cP or less, about 11 cP or less, or about 10 cP or less (as measured at about 25°C).

[0191] In some embodiments, the viscosity of the formulation is about 8 cP, about 9 cP, about 10 cP, about 11 cP, about 12 cP, about 13 cP, about 14 cP, about 15 cP, about 16 cP, about 17 cP, about 18 cP, about 19 cP, or about 20 cP (as measured at about 25°C).

[0192] In some implementations, without the presence of cyclodextrin, the viscosity of the comparable or reference formulation is greater than 20 cP, greater than 50 cP, greater than 100 cP, greater than 150 cP, greater than 200 cP, greater than 300 cP, greater than 500 cP, or even greater than 1,000 cP (as measured at about 25°C).

[0193] In some embodiments, the viscosity of the formulation is about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more than about 90% lower (as measured at about 25°C) compared to a comparable or reference formulation that does not contain cyclodextrin.

[0194] In a preferred embodiment, the formulation contains a therapeutically effective amount of dsRNA in a volume of less than about 2 mL, less than about 1 mL, or less than about 0.75 mL.

[0195] In some implementations, the pH range of the formulation is from about 6.5 to about 9.0.

[0196] In some embodiments, the pH of the formulation is about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, about 8.0, about 8.1, about 8.2, about 8.3, about 8.4, about 8.5, about 8.6, about 8.7, about 8.8, about 8.9, or about 9.0.

[0197] In some implementations, the pH range of the formulation is from about 6.0 to about 8.0.

[0198] In some implementations, the pH range of the formulation is from about 6.5 to about 7.5.

[0199] In some embodiments, the pH of the formulation is about 7.0±2.0, about 7.0±1.5, about 7.0±1.0, about 7.0±0.9, about 7.0±0.8, about 7.0±0.7, about 7.0±0.6, about 7.0±0.5, about 7.0±0.4, about 7.0±0.3, about 7.0±0.2, or about 7.0±0.1 (e.g., about 7.0).

[0200] In some implementations, the pH value of the formulation is measured approximately 1 day, approximately 2 days, approximately 3 days, approximately 4 days, approximately 5 days, approximately 6 days, approximately 7 days, approximately 14 days, approximately 20 days, approximately 30 days, approximately 60 days, and approximately 90 days after formulation preparation.

[0201] In some embodiments, the osmotic pressure of the formulation ranges from about 280 mOsm / L to about 310 mOsm / L.

[0202] In some embodiments, the osmotic pressure of the formulation is greater than about 250 mOsm / L, greater than about 300 mOsm / L, greater than about 350 mOsm / L, greater than about 400 mOsm / L, or greater than about 500 mOsm / L.

[0203] In some embodiments, the osmotic pressure of the formulation ranges from about 200 mOsm / L to about 2,000 mOsm / L or from about 300 mOsm / L to about 1,000 mOsm / L.

[0204] Exemplary implementation schemes of the formulation In some implementations, the formulation comprises: dsRNA molecules, wherein the dsRNA molecules are present at a total concentration of about 150 mg / mL to about 250 mg / mL; and Cyclodextrin agents (e.g., HPBCD) are present at a concentration of about 5% w / v to about 10% w / v (preferably about 6.5% w / v).

[0205] In some implementations, the formulation comprises: dsRNA molecules, wherein the dsRNA molecules are present at a total concentration of about 150 mg / mL to about 250 mg / mL; and Cyclodextrin agents (e.g., HPBCD) are present in the formulation at an HPBCD:dsRNA molar ratio not exceeding 5 (preferably between 2.5 and 5).

[0206] In some implementations, the formulation comprises: A first dsRNA molecule and a second dsRNA molecule, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of about 150 mg / mL to about 250 mg / mL; and Cyclodextrin agents (e.g., HPBCD) are present at a concentration of about 5% w / v to about 10% w / v (preferably about 6.5% w / v).

[0207] In some implementations, the formulation comprises: A first dsRNA molecule and a second dsRNA molecule, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of about 150 mg / mL to about 250 mg / mL; and Cyclodextrin agents (e.g., HPBCD) are present in the formulation at an HPBCD:dsRNA molar ratio not exceeding 5 (preferably between 2.5 and 5).

[0208] In some implementations, the formulation comprises: A first dsRNA molecule and a second dsRNA molecule, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of about 150 mg / mL to about 250 mg / mL. Cyclodextrin agents (e.g., HPBCD) are present at a concentration of about 4% w / v to about 10% w / v (preferably about 6.5% w / v); and Buffers (e.g., disodium hydrogen phosphate, potassium dihydrogen phosphate, or any combination thereof); and Tension modifiers (e.g., sodium chloride, potassium chloride, or combinations thereof).

[0209] In some implementations, the formulation comprises: A first dsRNA molecule and a second dsRNA molecule, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of about 150 mg / mL to about 250 mg / mL; and Cyclodextrin agents (e.g., HPBCD) are present at a concentration of about 4% w / v to about 10% w / v (preferably about 6.5% w / v). The formulation has a physiologically suitable pH value, optionally in the pH range of about 6.0 to about 8.0, about 6.5 to about 7.5, or about 7 to about 7.5.

[0210] In some implementations, the formulation comprises: A first dsRNA molecule and a second dsRNA molecule, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of about 150 mg / mL to about 250 mg / mL; and Cyclodextrin agents (e.g., HPBCD) are present at a concentration of about 5% w / v to about 10% w / v (preferably about 6.5% w / v). The physiological osmotic pressure of the formulation is greater than approximately 250 mOsm / L, greater than approximately 300 mOsm / L, greater than approximately 350 mOsm / L, greater than approximately 400 mOsm / L, or greater than approximately 500 mOsm / L.

[0211] In some implementations, the formulation comprises: A first dsRNA molecule and a second dsRNA molecule, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of about 150 mg / mL to about 250 mg / mL; and Cyclodextrin agents (e.g., HPBCD) are present at a concentration of about 4% w / v to about 10% w / v (preferably about 6.5% w / v). The formulation has a physiologically suitable pH value, optionally with a pH range of about 6.0 to about 8.0, about 6.5 to about 7.5, or about 7 to about 7.5. The physiological osmotic pressure of the formulation is greater than approximately 250 mOsm / L, greater than approximately 300 mOsm / L, greater than approximately 350 mOsm / L, greater than approximately 400 mOsm / L, or greater than approximately 500 mOsm / L.

[0212] In some implementations, the formulation comprises one or more ingredients described in Table A.

[0213] In some implementations, the formulation comprises one or more ingredients described in Table B.

[0214] In some implementations, the formulation also includes one or more ingredients described in Table C.

[0215] In some implementations, the formulation comprises: First dsRNA molecules at concentrations of approximately 87.5 ± 30 mg / mL, approximately 87.5 ± 25 mg / mL, approximately 87.5 ± 20 mg / mL, approximately 87.5 ± 15 mg / mL, approximately 87.5 ± 10 mg / mL, approximately 87.5 ± 5 mg / mL, approximately 87.5 ± 4 mg / mL, approximately 87.5 ± 3 mg / mL, approximately 87.5 ± 2 mg / mL, or approximately 87.5 ± 1 mg / mL (e.g., approximately 87.5 mg / mL); Second dsRNA molecules at concentrations of approximately 87.5 ± 30 mg / mL, approximately 87.5 ± 25 mg / mL, approximately 87.5 ± 20 mg / mL, approximately 87.5 ± 15 mg / mL, approximately 87.5 ± 10 mg / mL, approximately 87.5 ± 5 mg / mL, approximately 87.5 ± 4 mg / mL, approximately 87.5 ± 3 mg / mL, approximately 87.5 ± 2 mg / mL, or approximately 87.5 ± 1 mg / mL (e.g., approximately 87.5 mg / mL); and Cyclodextrin preparations (e.g., HPBCD) at concentrations of about 65±30 mg / mL, about 65±25 mg / mL, about 65±20 mg / mL, about 65±15 mg / mL, about 65±10 mg / mL, about 65±5 mg / mL, about 65±4 mg / mL, about 65±3 mg / mL, about 65±2 mg / mL, or about 65±1 mg / mL (e.g., about 65 mg / mL).

[0216] Formulation preparation process In some embodiments, this disclosure provides a method for preparing the formulation disclosed herein for injection (e.g., subcutaneous injection).

[0217] In some embodiments, the method includes the following steps: (i) combining a cyclodextrin agent and water for injection to form a cyclodextrin solution. In some embodiments, the cyclodextrin agent is HPBCD.

[0218] In some implementations, the method includes the following steps: (ii) mixing a first dsRNA molecule and a second dsRNA molecule in a 1:1 ratio to form a mixture of dsRNA molecules. In some embodiments, the concentration of the first dsRNA molecule is approximately 100 mg / mL, approximately 105 mg / mL, approximately 110 mg / L, approximately 115 mg / mL, approximately 120 mg / L, approximately 125 mg / mL, approximately 130 mg / mL, approximately 135 mg / mL, approximately 140 mg / L, approximately 145 mg / L, approximately 150 mg / L, approximately 155 mg / L, approximately 160 mg / mL, approximately 165 mg / mL, approximately 170 mg / L, approximately 175 mg / L, approximately 180 mg / L, approximately 185 mg / L, approximately 190 mg / mL, approximately 195 mg / mL, approximately 200 mg / L, approximately 205 mg / L, approximately 210 mg / L, approximately 215 mg / L, approximately 220 mg / L, approximately 225 mg / L, approximately 230 mg / L, approximately 235 mg / L, approximately 240 mg / mL ... mg / L, approximately 245 mg / L, or approximately 250 mg / L. In some embodiments, the concentration of the first dsRNA molecule is approximately 190 mg / mL. In some embodiments, the concentration of the second dsRNA molecule is approximately 100 mg / mL, approximately 105 mg / mL, approximately 110 mg / L, approximately 115 mg / mL, approximately 120 mg / L, approximately 125 mg / mL, approximately 130 mg / mL, approximately 135 mg / mL, approximately 140 mg / L, approximately 145 mg / L, approximately 150 mg / L, approximately 155 mg / L, approximately 160 mg / mL, approximately 165 mg / mL, approximately 170 mg / L, approximately 175 mg / L, approximately 180 mg / L, approximately 185 mg / L, approximately 190 mg / mL, approximately 195 mg / mL, approximately 200 mg / L, approximately 205 mg / L, approximately 210 mg / L, approximately 215 mg / L, approximately 220 mg / L, approximately 225 mg / L, approximately 230 mg / L, approximately 235 mg / L, approximately 240 mg / mL ... mg / L, approximately 245 mg / L, or approximately 250 mg / L. In some embodiments, the concentration of the second dsRNA molecule is approximately 190 mg / mL.In some embodiments, the total concentration of the mixture of dsRNA molecules is about 100 mg / mL, about 105 mg / mL, about 110 mg / L, about 115 mg / mL, about 120 mg / L, about 125 mg / mL, about 130 mg / mL, about 135 mg / mL, about 140 mg / L, about 145 mg / L, about 150 mg / L, about 155 mg / L, about 160 mg / mL, about 165 mg / mL, about 170 mg / L, about 175 mg / L, about 180 mg / L, about 185 mg / L, about 190 mg / mL, about 195 mg / mL, about 200 mg / L, about 205 mg / L, about 210 mg / L, about 215 mg / L, about 220 mg / L, about 225 mg / L, about 230 mg / L, about 235 mg / L, about 240 mg / mL ... mg / L, approximately 245 mg / L, or approximately 250 mg / L. In some embodiments, the total concentration of the mixture of dsRNA molecules is approximately 190 mg / mL.

[0219] In some embodiments, the method includes the following steps: (iii) adding a cyclodextrin solution to a mixture of dsRNA molecules to form a bulk solution containing dsRNA molecules. In some embodiments, the bulk solution comprises a total concentration of approximately 100 mg / mL, approximately 105 mg / mL, approximately 110 mg / L, approximately 115 mg / mL, approximately 120 mg / L, approximately 125 mg / mL, approximately 130 mg / mL, approximately 135 mg / mL, approximately 140 mg / L, approximately 145 mg / L, approximately 150 mg / L, approximately 155 mg / L, approximately 160 mg / mL, approximately 165 mg / mL, approximately 170 mg / L, approximately 175 mg / L, approximately 180 mg / L, approximately 185 mg / L, approximately 190 mg / mL, approximately 195 mg / mL, approximately 200 mg / L, approximately 205 mg / L, approximately 210 mg / L, approximately 215 mg / L, approximately 220 mg / L, approximately 225 mg / L, approximately 230 mg / L, approximately 235 mg / L, approximately 240 mg / L, approximately 245 mg / mL. The dsRNA molecules are present at a concentration of mg / L or approximately 250 mg / L. In some embodiments, the bulk solution contains a total concentration of approximately 175 mg / mL of dsRNA molecules. In some embodiments, the cyclodextrin agent is HPBCD. In some embodiments, the concentration of HPBCD in the bulk solution is approximately 5.0% w / v, approximately 5.5% w / v, approximately 6.0% w / v, approximately 6.5% w / v, approximately 7.0% w / v, approximately 7.5% w / v, approximately 8% w / v, approximately 8.5% w / v, approximately 9% w / v, approximately 9.5% w / v, or approximately 10% w / v. In some embodiments, the concentration of HPBCD in the bulk solution is about 6.5 ± 3.0% w / v, about 6.5 ± 2.5% w / v, about 6.5 ± 2.0% w / v, about 6.5 ± 1.0% w / v, about 6.5 ± 0.9% w / v, about 6.5 ± 0.8% w / v, about 6.5 ± 0.7% w / v, about 6.5 ± 0.6% w / v, about 6.5 ± 0.5% w / v, about 6.5 ± 0.4% w / v, about 6.5 ± 0.3% w / v, about 6.5 ± 0.2% w / v, or about 6.5 ± 0.1% w / v. In some embodiments, the concentration of HPBCD in the bulk solution is about 6.5% w / v.In some embodiments, the viscosity of the bulk solution is about 50 cP or less, about 45 cP or less, about 40 cP or less, about 35 cP or less, about 30 cP or less, about 25 cP or less, about 20 cP or less, about 19 cP or less, about 18 cP or less, about 17 cP or less, about 16 cP or less, about 15 cP or less, about 14 cP or less, about 13 cP or less, about 12 cP or less, about 11 cP or less, or about 10 cP or less (as measured at about 25°C). In some embodiments, the viscosity of the bulk solution is about 8 cP, about 9 cP, about 10 cP, about 11 cP, about 12 cP, about 13 cP, about 14 cP, about 15 cP, about 16 cP, about 17 cP, about 18 cP, about 19 cP, or about 20 cP (as measured at about 25°C).

[0220] In some embodiments, the method includes the following step: (iv) Optionally, adjusting the pH by adding a buffer. In some embodiments, the pH of the bulk solution is about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, about 8.0, about 8.1, about 8.2, about 8.3, about 8.4, about 8.5, about 8.6, about 8.7, about 8.8, about 8.9, or about 9.0. In some embodiments, the pH of the bulk solution is about 7.0 ± 2.0, about 7.0 ± 1.5, about 7.0 ± 1.0, about 7.0 ± 0.9, about 7.0 ± 0.8, about 7.0 ± 0.7, about 7.0 ± 0.6, about 7.0 ± 0.5, about 7.0 ± 0.4, about 7.0 ± 0.3, about 7.0 ± 0.2, or about 7.0 ± 0.1 (e.g., about 7.0). In some embodiments, the buffer is selected from disodium hydrogen phosphate, potassium dihydrogen phosphate, or any combination thereof.

[0221] In some implementations, the method includes the following steps: (v) reducing biological load.

[0222] In some implementations, the method includes the following steps: (vi) transferring the bulk solution to a sterile storage container and sterilely filtering the bulk solution in the sterile storage container.

[0223] In some implementations, the method includes the following steps: (vii) filling a sterile vial with the filtered bulk solution and sealing the vial securely with a sterile stopper.

[0224] In some implementations, the method includes one or more of the following steps: (i) HPBCD is combined with water for injection to form an HPBCD solution; (ii) A first dsRNA molecule with a concentration of about 190 mg / mL and a second dsRNA molecule with a concentration of about 190 mg / mL are mixed in a 1:1 ratio to form a mixture of dsRNA molecules with a concentration of about 190 mg / mL. (iii) Add the HPBCD solution to the mixture of dsRNA molecules to form a bulk solution containing dsRNA molecules at a concentration of about 175 mg / mL, wherein the concentration of HPBCD in the bulk solution is about 6.5% w / v; (iv) Optionally, adjust the pH by adding a buffer; (v) Reduce biological load; (vi) Transfer the bulk solution to a sterile storage container and sterilely filter the bulk solution in the sterile storage container; and (vii) Fill the sterile vial with the filtered bulk solution at a concentration of 175 mg / mL and seal the vial securely with a sterile stopper.

[0225] The toxicity and therapeutic efficacy of a formulation can be determined using standard pharmaceutical procedures in cell cultures or laboratory animals, such as those used to determine the LD50 (the dose that is lethal to 50% of the population) and ED50 (the dose that is therapeutically effective to 50% of the population). The dose ratio between toxicity and therapeutic effect is the therapeutic index and can be expressed as the LD50 / ED50 ratio. Compounds exhibiting a large therapeutic index are preferred. Although compounds exhibiting toxic side effects can be used, caution should be exercised in designing delivery systems that target such compounds to sites in affected tissues, thereby minimizing potential damage to uninfected cells and thus reducing side effects.

[0226] Data obtained from cell culture assays and / or animal studies can be used to formulate dosage ranges for human use. The dosage of such compounds is preferably within a range including the ED50 while exhibiting minimal or no toxicity in circulating concentrations. The dosage may vary within this range depending on the dosage form used and the route of administration employed. For any compound used in the methods disclosed herein, the therapeutically effective dose can initially be estimated by cell culture assays. Doses can be formulated in animal models to achieve a range of circulating plasma concentrations including the EC50 (the concentration of the test compound that achieves a half-maximal response) as determined in cell culture. This information can be used to more accurately determine the useful dose in humans. Plasma levels can be measured, for example, by high-performance liquid chromatography.

[0227] The pharmaceutical preparation may be included in a container, package, or dispenser along with optional instructions for use.

[0228] How to use In some respects, this disclosure provides a method for treating or preventing disease, which includes administering the disclosed formulation to a subject in need.

[0229] In some respects, this disclosure provides formulations disclosed herein for the treatment or prevention of diseases in subjects in need.

[0230] In some aspects, this disclosure provides a method for inhibiting the secretion of soluble fms-like tyrosine kinase-1 (sFLT1) by a subject, comprising administering the formulation disclosed herein to the subject.

[0231] In some respects, this disclosure provides formulations disclosed herein for inhibiting sFLT1 in subjects.

[0232] In some implementations, the subjects are animals.

[0233] In some implementations, the subjects are mammals.

[0234] In some implementation schemes, the required subjects are humans.

[0235] In some implementations, the disease is associated with elevated expression or activity of sFLT1.

[0236] In some implementations, administration of the formulation results in inhibition of sFLT1.

[0237] In some implementations, administration of the formulation leads to a decrease in sFLT1 activity.

[0238] In some embodiments, this disclosure provides preventive and therapeutic methods for treating subjects who are at risk (or susceptible to) a disease or condition wholly or partially caused by secretory Flt1 protein.

[0239] In some implementations, the disease or condition is a liver disease or symptom.

[0240] In some implementations, the disease or condition is a kidney disease or symptom.

[0241] In some implementations, the disease or condition is a placental disease or symptom.

[0242] In some implementations, the disease or condition is a pregnancy-related disease or condition.

[0243] In some implementations, the disease or condition is a symptom associated with the expression of soluble Flt1 protein, wherein overexpression of soluble Flt1 protein leads to clinical manifestations of preeclampsia (PE), postpartum PE, eclampsia, and / or HELLP syndrome.

[0244] In some implementations, the disease or symptom is PE.

[0245] In some implementations, the disease or symptom is postpartum PE.

[0246] In some implementations, the disease or condition is eclampsia.

[0247] In some implementations, the disease or condition is HELLP syndrome.

[0248] In some embodiments, this disclosure provides a method for preventing a disease or condition as described above in a subject by administering a formulation disclosed herein to a subject in need. For example, individuals at risk of disease can be identified by any combination of one or more diagnostic or prognostic methods described herein. Administration of the prophylactic agent can be performed before the characteristic symptoms of the disease or condition appear, thereby preventing the disease or condition or alternatively delaying its progression.

[0249] In some embodiments, this disclosure provides a method of treating a subject by altering the onset of disease or symptom symptoms. In some embodiments, the modulation method disclosed herein includes contacting cells expressing a gain-of-function mutant with a formulation disclosed herein, said formulation comprising a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding such an RNAi agent) targeting one or more target sequences within a gene (e.g., SEQ ID NO:1 or SEQ ID NO:2 or any combination thereof), thereby achieving sequence-specific interference with that gene.

[0250] Preventive and therapeutic approaches to treatment can be specifically tailored or modified based on knowledge gained from the field of pharmacogenomics. As used herein, “pharmacogenomics” refers to the application of genomics technologies (such as gene sequencing, statistical genetics, and gene expression analysis) to drugs in clinical development and marketing. More specifically, the term refers to studying how a patient’s genes determine their response to a drug (e.g., a patient’s “drug response phenotype” or “drug response genotype”). Therefore, another aspect of this disclosure provides methods for tailoring individual preventive or therapeutic treatments based on an individual’s drug response genotype and utilizing formulations containing target gene molecules or target gene modulators disclosed herein. Pharmacogenomics enables clinicians or physicians to provide preventive or therapeutic treatments to patients who will most benefit from treatment and to avoid treating patients who will suffer from drug-related toxic side effects.

[0251] The formulations containing therapeutic agents disclosed herein can be tested in suitable animal models. For example, the RNAi agents (or expression vectors or transgenes encoding them) described herein can be used in animal models to determine the efficacy, toxicity, or side effects of the agents. Alternatively, the formulations containing therapeutic agents disclosed herein can be used in animal models to determine the mechanism of action of such agents. For example, the formulations containing therapeutic agents disclosed herein can be used in animal models to determine the efficacy, toxicity, or side effects of treatment with such agents. Alternatively, the formulations containing therapeutic agents disclosed herein can be used in animal models to determine the mechanism of action of such agents.

[0252] The RNA-containing formulations disclosed herein can be administered to any patient diagnosed with or at risk of pregnancy-related, liver, and / or kidney-related diseases (such as PE and / or eclampsia). In one embodiment, the patient is diagnosed with PE and / or eclampsia, but is otherwise in good health. For example, the patient is not terminally ill and may have at least 2, 3, 5 years, or longer to live after diagnosis. Treatment can be initiated immediately after diagnosis or waited until the patient develops more debilitating symptoms (such as the presence of two or more PE symptoms or one or more eclampsia symptoms). In some embodiments, the patient has not yet reached the late stage of the disease.

[0253] The formulations containing RNA silencing agents disclosed herein can be delivered directly to organs (e.g., directly to the placenta, liver, and / or kidneys), and their dosage can effectively treat or prevent liver, kidney, or pregnancy-related diseases or conditions, such as PE, postpartum PE, eclampsia, and / or HELLP syndrome.

[0254] The concentration of the RNA silencing agent composition is sufficient to effectively treat or prevent human conditions or regulate human physiological states. The concentration or amount of RNA silencing agent applied will depend on the determined pharmaceutical parameters and method of administration, such as intranasal, buccal, or intrapulmonary administration.

[0255] This disclosure relates to the use of the above-described formulations containing a therapeutic agent for preventive and / or therapeutic treatment as described below.

[0256] The delivery route may depend on the patient's condition. In some implementations, the anti-sFlt1 RNA silencer disclosed herein may be administered intravenously or subcutaneously to subjects diagnosed with PE, postpartum PE, eclampsia, and / or HELLP syndrome. In addition to the RNA silencer disclosed herein, a second treatment, such as palliative care and / or disease-specific therapy, may be administered to the patient. Adjunctive therapy may be symptomatic (e.g., for symptom relief), protective (e.g., for slowing or halting disease progression), or reversible (e.g., for reversing disease progression). For example, symptomatic treatment for PE, postpartum PE, eclampsia, and / or HELLP syndrome may also include drugs such as atenolol, hydralazine, labetalol, magnesium sulfate, methyldopa, nicardipine, nifedipine, and sodium nitroprusside.

[0257] Generally, the RNA silencing agents disclosed herein can be administered by any suitable method. As used herein, local delivery can refer to the direct application of the RNA silencing agent to any surface of the body, including the eyes, mucous membranes, body cavity surfaces, or any internal surface. Formulations for local application may include transdermal patches, ointments, lotions, creams, gels, drops, sprays, and liquids. Conventional drug carriers, aqueous, powdered, or oily bases, thickeners, etc., may be necessary or desirable. Local application can also be used as a means of selectively delivering the RNA silencing agent to the epidermis or dermis of a subject, or to a specific layer thereof, or to underlying tissues.

[0258] definition As used herein, the articles “a / an” and “the” refer to the grammatical object of one / an or more (i.e., at least one / an, or one / an or more / an). For example, “a / an nucleic acid molecule” refers to one / an nucleic acid molecule or one / an or more / an nucleic acid molecules.

[0259] As used in this article, the term “w / v” stands for weight / volume, which refers to the weight (usually milligrams or grams) of solute dissolved in a given volume of solution (usually in milliliters).

[0260] As used herein, the term "dsRNA" includes dsRNA itself and its salts. Suitable salts include sodium and potassium salts.

[0261] As used herein, the term “pharmaceutically acceptable” means, to a reasonable extent of medical judgment, those compounds, anions, cations, materials, compositions, carriers and / or dosage forms that are suitable for use in human and animal tissues without excessive toxicity, irritation, allergic reactions or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0262] As used herein, the term "pharmaceuticalally acceptable excipient" means an excipient that can be used in the preparation of a formulation, which is generally safe, non-toxic, and free from biological and other adverse effects, and includes excipients acceptable for veterinary and human pharmaceutical use. As used in this specification and claims, "pharmaceuticalally acceptable excipient" includes one or more such excipients.

[0263] The term "oligonucleotide" refers to a short polymer of nucleotides and / or nucleotide analogs. The term "RNA analog" refers to a polynucleotide (e.g., a chemically synthesized polynucleotide) that, compared to the corresponding unaltered or unmodified RNA, has at least one nucleotide altered or modified, but retains the same or similar properties or functions as the corresponding unaltered or unmodified RNA. As mentioned above, oligonucleotides can be linked to bonds that result in a lower rate of hydrolysis of the RNA analog compared to RNA molecules with phosphodiester bonds. For example, the nucleotides of the analog may include methylene glycol, ethylene glycol, oxymethylthio, oxyethio, oxycarbonyloxy, diaminophosphate, aminophosphate, and / or thiophosphate bonds. Preferred RNA analogs include ribonucleotides and / or deoxyribonucleotides with sugar modifications and / or backbone modifications. Such alterations or modifications may also include the addition of non-nucleotide substances, such as addition to the ends or interior of the RNA (at one or more nucleotides of the RNA). RNA analogs only need to be sufficiently similar to native RNA to mediate RNA interference.

[0264] As used herein, the term “RNA interference” (“RNAi”) refers to the selective intracellular degradation of RNA. RNAi occurs naturally in cells to clear foreign RNA (e.g., viral RNA). Natural RNAi occurs through fragments cut from free dsRNA that direct the degradation mechanism to other similar RNA sequences. Alternatively, RNAi can be artificially initiated, for example, to silence the expression of target genes.

[0265] RNAi agents, such as RNA silencing agents, have a chain that is “fully complementary to the target mRNA sequence to guide target-specific RNA interference (RNAi),” meaning that the chain has a sequence sufficient to trigger the destruction of the target mRNA through the RNAi mechanism or process.

[0266] As used herein, the term "isolated RNA" (e.g., "isolated siRNA" or "isolated siRNA precursor") refers to an RNA molecule that is substantially free of other cell material or culture medium when produced by recombinant technology, or that is substantially free of chemical precursors or other chemicals when chemically synthesized.

[0267] As used in this article, the term "RNA silencing" refers to a set of sequence-specific regulatory mechanisms mediated by RNA molecules (such as RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-repression, and translational repression) that result in the suppression or "silencing" of the expression of the corresponding protein-coding genes. RNA silencing has been observed in a variety of organisms, including plants, animals, and fungi.

[0268] As used herein, the term "transgenic" refers to any nucleic acid molecule that is artificially inserted into a cell and becomes part of the genome of an organism from which that cell develops. Such transgenics may contain genes that are partially or entirely heterologous (i.e., exogenous) to the transgenic organism, or may represent genes homologous to the organism's endogenous genes. The term "transgenic" also refers to a nucleic acid molecule containing one or more selected nucleic acid sequences (e.g., DNA) that encode one or more engineered RNA precursors that will be expressed in a transgenic organism (e.g., an animal) that are partially or entirely heterologous (i.e., exogenous) to the transgenic animal, or homologous to the transgenic animal's endogenous genes, but designed to be inserted into a location in the animal's genome different from the natural gene. Transgenics include one or more promoters and any other DNA (such as introns) necessary for the expression of the selected nucleic acid sequence, all operatively linked to the selected sequence, and may include enhancer sequences.

[0269] Genes “associated with a disease or condition” include a gene whose normal or abnormal expression or function affects or causes a disease or condition or at least one symptom of said disease or condition.

[0270] As used herein, the term "target gene" refers to a gene whose expression will be significantly suppressed or "silenced." This silencing can be achieved through RNA silencing, such as by cleaving the mRNA of the target gene or by translational repression of the target gene. The term "non-target gene" refers to a gene whose expression will not be significantly silenced. In one embodiment, the polynucleotide sequences of the target gene and non-target genes (e.g., the mRNA encoded by the target gene (sFLT1) and the non-target gene (flFLT1)) may differ by one or more nucleotides (e.g., in intron regions). In some embodiments, the target gene and non-target genes may differ by one or more polymorphisms (e.g., single nucleotide polymorphisms or SNPs). In some embodiments, the sequence identity of the target gene and non-target genes may be less than 100%. In some embodiments, the non-target gene may be a homolog of the target gene (e.g., an ortholog or paralog).

[0271] As used herein, the term "polymorphism" refers to a difference in a gene sequence (e.g., one or more deletions, insertions, or substitutions) that can be identified or detected when comparing identical gene sequences from different sources or subjects (but from the same organism). For example, polymorphism can be identified when comparing identical gene sequences from different subjects. Identification of such polymorphisms is standard practice in the art, and the methods are similar to those used to detect point mutations in breast cancer. For example, DNA extracted from a subject's lymphocytes can be used for identification, and then the polymorphic region can be amplified using primers specific to the polymorphic region. Alternatively, polymorphism can also be identified by comparing two alleles of the same gene. In a particular embodiment, the polymorphism is a single nucleotide polymorphism (SNP).

[0272] This document refers to the sequence difference between two alleles of the same gene in the same organism as "allele polymorphism". In some embodiments, allele polymorphism corresponds to SNP alleles. For example, allele polymorphism may involve a single nucleotide difference between the two alleles of an SNP. Polymorphism may occur at a nucleotide within a coding region, but due to the degeneracy of the genetic code, it does not encode a change in the amino acid sequence. Alternatively, the polymorphic sequence may encode a different amino acid at a specific position, but the change in amino acid does not affect the function of the protein. Polymorphic regions may also exist in the non-coding regions of a gene. In exemplary embodiments, polymorphism is present in the coding region or the untranslated region of a gene (e.g., 5' UTR or 3' UTR).

[0273] As used herein, the term "RNA silencer" refers to RNA capable of inhibiting or "silencing" the expression of a target gene. In some embodiments, RNA silencers are capable of preventing the complete processing (e.g., complete translation and / or expression) of mRNA molecules through post-transcriptional silencing mechanisms. RNA silencers include small (<50 bp) non-coding RNA molecules, such as RNA duplexes containing paired strands, and precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencers include siRNA, miRNA, siRNA-like duplexes, and bifunctional oligonucleotides and their precursors. In one embodiment, an RNA silencer is capable of inducing RNA interference. In some embodiments, an RNA silencer is capable of mediating translational repression.

[0274] As used herein, the term "rare nucleotide" refers to a naturally occurring, infrequently occurring nucleotide, including naturally occurring, infrequently occurring deoxyribonucleotides or ribonucleotides, such as naturally occurring ribonucleotides that are not guanosine, adenosine, cytosine, or uridine. Examples of rare nucleotides include, but are not limited to, inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, and ribothymidine. 2N-methylguanosine and 2,2 N,N-Dimethylguanosine.

[0275] As used herein, the term “microRNA” (“miRNA”), also known in the art as “small temporal RNA” (“stRNA”), refers to a small (10–50 nucleotides) RNA encoded by a gene (e.g., encoded by a viral, mammalian, or plant genome) that is capable of directing or mediating RNA silencing. “miRNA syndrome” refers to a disease or condition characterized by abnormal expression or activity of miRNAs.

[0276] As used herein, the term "bifunctional oligonucleotide" refers to an RNA silencing agent having the formula TLm, where T is the mRNA targeting moiety, L is the linker moiety, and m is the miRNA recruitment moiety. As used herein, the terms "mRNA targeting moiety," "targeting moiety," "mRNA targeting moiety," or "targeting moiety" refer to a domain, portion, or region of a bifunctional oligonucleotide that is of sufficient size and sufficiently complementary to the portion or region of the mRNA selected or targeted for silencing (i.e., the portion has a sequence sufficient to capture the target mRNA). As used herein, the term "linker moiety" or "linker region" refers to a domain, portion, or region of an RNA silencing agent that covalently binds to or links to mRNA.

[0277] As used herein, the term "antisense strand" for RNA silencing agents (e.g., siRNA or RNA silencing agents) refers to a strand substantially complementary to a segment of approximately 10–50 nucleotides (e.g., approximately 15–30, 16–25, 18–23, or 19–22 nucleotides) of the mRNA targeting the gene to be silenced. The antisense strand, or first strand, has a sequence sufficiently complementary to the desired target mRNA sequence to guide target-specific silencing; for example, the complementarity is sufficient to trigger disruption of the desired target RNA via an RNAi mechanism or process (RNAi interference), or the complementarity is sufficient to trigger translational repression of the desired target mRNA.

[0278] The term "sense strand" or "second strand" in RNA silencing agents (such as siRNA or RNA silencing agents) refers to the strand complementary to the antisense strand or the first strand. The antisense strand and sense strand can also be referred to as the first strand or second strand, where the first strand or second strand is complementary to the target sequence, and the corresponding second strand or first strand is complementary to the first strand or second strand. A miRNA double-stranded intermediate or siRNA-like double-stranded RNA consists of a miRNA strand (which is sufficiently complementary to a fragment of approximately 10-50 nucleotides in the mRNA targeting the gene used for silencing) and a miRNA* strand (which is sufficiently complementary to the miRNA strand to form a double strand).

[0279] As used herein, “5’ end” (e.g., the 5’ end of the antisense strand) refers to the nucleotide at the 5’ end, such as 1 to 5 nucleotides at the 5’ end of the antisense strand. As used herein, “3’ end” (e.g., the 3’ end of the sense strand) refers to the region (e.g., a region of 1 to 5 nucleotides) complementary to the 5’ end nucleotide of the complementary antisense strand.

[0280] As used herein, the term "base pair" refers to the interaction between pairs of nucleotides (or nucleotide analogs) on opposite strands of an oligonucleotide double helix (e.g., a double helix formed by an RNA silencing agent strand and a target mRNA sequence), an interaction primarily attributable to hydrogen bonds, van der Waals interactions, etc., between said nucleotides (or nucleotide analogs). As used herein, the term "bond strength" or "base pair strength" refers to the strength of a base pair.

[0281] As used herein, the term “mismatched base pair” refers to a base pair that is not complementary or not a Watson-Crick base pair, such as a non-normal complementary G:C, A:T, or A:U base pair. As used herein, the term “fuzzy base pair” (also known as a non-discriminatory base pair) refers to a base pair formed from common nucleotides.

[0282] As used herein, the term "universal nucleotide" (also known as "neutral nucleotide") includes nucleotides (such as certain unstable nucleotides) that have a base ("universal base" or "neutral base") that does not significantly distinguish the bases on complementary polynucleotides when forming base pairs. Universal nucleotides are primarily hydrophobic molecules that can efficiently stack into antiparallel double-stranded nucleic acids (e.g., double-stranded DNA or RNA) due to stacking interactions. The base portion of a universal nucleotide typically contains a nitrogen-containing aromatic heterocyclic moiety.

[0283] As used herein, the term "solvent" refers to a solvation form containing a stoichiometric or non-stoichiometric solvent. Some compounds tend to capture a fixed molar ratio of solvent molecules in their crystalline solid state, thus forming a solvate. If the solvent is water, the solvate formed is a hydrate; if the solvent is an alcohol, the solvate formed is an alcohol. A hydrate is formed by the combination of one or more water molecules with a substance molecule, wherein the water retains its molecular state as H₂O.

[0284] It should be understood that this disclosure provides methods for preparing the formulations described herein. This disclosure also provides detailed methods for preparing various formulations of this disclosure according to the following examples.

[0285] It should be understood that, unless otherwise stated, any description of a treatment method includes the use of the said compound to provide the treatment as described herein, and the use of the said compound to prepare a medicament for treating such conditions. Treatment includes treatment of humans or non-human animals, including rodents and other disease models.

[0286] It should be understood that, unless otherwise stated, any description of preventive methods includes the use of the said compound to provide such prevention as described herein, and the use of the said compound to prepare a medicine for the prevention of such conditions. Treatment or prevention includes treating or preventing human or non-human animals, including rodents and other disease models.

[0287] As used herein, the term "subject" may be used interchangeably with the term "subject in need," both of which refer to a subject who has a disease or is at increased risk of developing a disease. "Subject" includes mammals. Mammals can be, for example, humans or suitable non-human mammals such as primates, mice, rats, dogs, cats, cattle, horses, goats, camels, sheep, or pigs. Subjects can also be birds or poultry. In one embodiment, the mammal is a human.

[0288] As used herein, the term "treating / treat" describes the management and care of a patient in order to combat a disease, ailment, or condition, and includes the administration of compounds of this disclosure or their pharmaceutically acceptable salts, polymorphs, or solvates to alleviate or eliminate symptoms or complications of the disease, ailment, or condition. The term "treating" may also include treatment in in vitro cell or animal models.

[0289] As used in this article, the terms “prevention,” “avoidance,” or “freedom from suffering” describe the reduction or elimination of the onset of symptoms or complications of such disease, condition, or ailment.

[0290] The dosing regimen for a compound is selected based on several factors, including the patient's type, species, age, weight, sex, and medical condition; the severity of the disease to be treated; the route of administration; the patient's renal and hepatic function; and the specific compound or its salt used. A general practitioner or veterinarian can easily determine and prescribe the effective amount of medication needed to prevent, combat, or halt the progression of a disease.

[0291] As used in this article, "viscosity" refers to the resistance to the flow of a substance (usually a liquid). Viscosity is related to the concept of shear force; it can be understood as the effect of shear forces exerted on each other or on other surfaces by different layers of a fluid as they move relative to each other. There are several ways to measure viscosity. The unit of viscosity is Ns / m, also known as pascal-second (Pa-s). Viscosity can be "kinematic viscosity" or "absolute viscosity." Kinematic viscosity is an indicator of the rate at which momentum is transferred in a fluid. Its unit of measurement is stokes (St). Kinematic viscosity is an indicator of the resistance to the flow of a fluid under the influence of gravity. When two fluids of equal volume but different viscosities are placed in the same capillary viscometer and allowed to flow under gravity, the fluid with higher viscosity takes longer to flow through the capillary than the fluid with lower viscosity. For example, if one fluid takes 200 seconds (s) to complete flow and another fluid takes 400 seconds, then on the kinematic viscosity scale, the second fluid is twice as viscous as the first. The dimension of kinematic viscosity is length / time. Typically, kinematic viscosity is expressed in centistokes (cSt). The SI unit for kinematic viscosity is mm / s, equal to 1 cSt. "Absolute viscosity," sometimes called "dynamic viscosity" or "simple viscosity," is the product of kinematic viscosity and fluid density. Absolute viscosity is expressed in centipoises (cP). The SI unit for absolute viscosity is millipascal-seconds (mPa⁻²s), where 1 Cp = 1 mPa⁻²s. For example, viscosity can be measured using a viscometer at a given shear rate or multiple shear rates. "Extrapolated zero-shear" viscosity can be determined by creating a best-fit line at four points of maximum shear on a graph of absolute viscosity versus shear rate and linearly extrapolating the viscosity back to zero shear. Alternatively, for Newtonian fluids, viscosity can be determined by averaging the viscosity values ​​at multiple shear rates. Viscosity can also be measured using a microfluidic viscometer at a single or multiple shear rates (also called flow rates), where absolute viscosity is derived from the pressure change as the liquid flows through a channel. Viscosity equals shear stress divided by the shear rate. In some implementations, the fluid viscosity measured with a microfluidic viscometer can be directly compared with an extrapolated zero-shear viscosity, for example, with an extrapolated viscosity measured using a cone-plate viscometer at multiple shear rates.

[0292] As is commonly used herein, the terms “concentrated” or “high concentration” describe a liquid formulation with a final nucleic acid concentration greater than about 100 mg / mL, preferably greater than about 150 mg / mL, more preferably greater than about 200 mg / mL, or most preferably greater than about 250 mg / mL.

[0293] As is generally used herein, the term "injectability" or "injectability" refers to the injectability of a pharmaceutical formulation using a syringe equipped with an 18-32 gauge needle (optionally thin-walled). Injectability depends on factors such as the pressure or force required for injection, flow uniformity, aspiration performance, and clogging. The injectability of a liquid pharmaceutical formulation can be assessed by comparing the injection force of a formulation with reduced viscosity to a standard formulation without added cyclodextrin. A reduced injection force in a formulation containing cyclodextrin reflects an improvement in the injectability of that formulation. Compared to a standard formulation with the same concentration of polysaccharide or nucleic acid, under otherwise identical conditions, the injectability of a formulation with reduced viscosity is improved when the injection force is reduced by at least 10%, preferably at least 30%, more preferably at least 50%, and most preferably at least 75%, the only difference being the substitution of cyclodextrin with an appropriate buffer solution of approximately the same concentration. Alternatively, the injectability of a liquid pharmaceutical formulation can be assessed by comparing the time required to inject the same volume (such as 0.5 mL, or more preferably about 1 mL) of different liquid polysaccharide or nucleic acid formulations, provided that the same force is applied by the syringe.

[0294] As is commonly used in this article, the term "osmotic pressure" refers to the total number of dissolved components per liter. Osmotic pressure is similar to molar concentration, but it includes the total number of moles of dissolved substance in the solution. An osmotic pressure of 1 Osm / L means that there is 1 mole of dissolved component per liter of solution. Some solutes, such as ionic solutes that dissociate in solution, release more than 1 mole of dissolved component per mole of solute in solution. For example, NaCl dissociates into Na+ in solution. + and Cl - Therefore, every 1 mole of dissolved NaCl provides 2 moles of dissolved component in the solution. Physiological osmotic pressure is typically in the range of approximately 280 mOsm / L to approximately 310 mOsm / L.

[0295] As is commonly used in this article, the term "tension" refers to the osmotic pressure gradient created by a semipermeable membrane separating two solutions. Specifically, tension describes the osmotic pressure across a cell membrane when a cell is exposed to an external solution. Solutes that can cross the cell membrane do not affect the final osmotic pressure gradient. Only dissolved substances that do not cross the cell membrane affect the osmotic pressure difference, thus influencing tension.

[0296] As used herein, the term “administration” means administration to a subject subcutaneously (i.e., “SC”, “subQ”, or “SQ”), orally, as a suppository, through local contact or application, intravenously, parenterally, intraperitoneally, intramuscularly, intraosseously, intralesionally, intrathecally, intracranially, intranasally, epidurally, or via implantation of a sustained-release device, such as a miniature osmotic pump. Administration can be made via any route, including parenterally and transmucosally (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or percutaneous). Parenterally administration includes, for example, intravenous, intramuscular, intraarterial, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial administration. Other delivery methods include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc. “Co-administration” means administration of the compositions described herein simultaneously, immediately before, or immediately after administration of one or more other therapies (e.g., anticancer agents, chemotherapy agents, or treatment for neurodegenerative diseases). The compounds disclosed herein can be administered to a patient alone or co-administered. Co-administration is intended to include the simultaneous or sequential administration of compounds, individually or in combination (more than one compound or agent). Therefore, formulations may also be combined with other active substances when needed (e.g., to reduce metabolic degradation). The compositions of this disclosure can be delivered transdermally, via a local route, and formulated as applicators, solutions, suspensions, emulsions, gels, creams, ointments, pastes, gels, paints, powders, and aerosols. Oral formulations include tablets, pills, powders, lozenges, capsules, liquids, tablets, capsules, gels, syrups, slurries, suspensions, etc., suitable for patient ingestion. Solid form formulations include powders, tablets, pills, capsules, capsules, suppositories, and dispersible granules. Liquid form formulations include solutions, suspensions, and emulsions, such as water or water / propylene glycol solutions. The compositions of this disclosure may additionally include components to provide sustained release and / or comfort. These components include high molecular weight anionic highly permeable polymers, gel polysaccharides, and finely dispersed drug carrier matrices. These components are discussed in more detail in U.S. Patents 4,911,920, 5,403,841, 5,212,162, and 4,861,760. The entire contents of these patents are incorporated herein by reference for all purposes. The compositions disclosed herein can also be delivered as microspheres for slow release in vivo. For example, the microspheres can be administered via intradermal injection as microspheres containing a drug that releases slowly under the skin (see Rao, J. Biomater Sci. Polym. Ed. 7:623-645, 1995); as biodegradable and injectable gel formulations (see, for example, Gao Pharm. Res. 12:857-863, 1995); or as microspheres for oral administration (see, for example, Eyles, J. Pharm. Pharmacol. 49:669-674, 1997).In some embodiments, formulations of the disclosed compositions can be delivered using liposomes fused to or endocytosed by the cell membrane, for example, by using receptor ligands attached to the liposomes, which bind to cell surface membrane protein receptors, thereby causing endocytosis. By using liposomes, particularly those carrying target cell-specific receptor ligands on their surface or otherwise preferentially targeting a specific organ, delivery of the disclosed compositions can be concentrated in target cells in vivo. (See, for example, Al-Muhammed, J. Microencapsul. 13:293-306, 1996; Chonn, Curr. Opin. Biotechnol. 6:698-708, 1995; Ostro, Am. J. Hosp. Pharm. 46:1576-1587, 1989). The disclosed compositions can also be delivered as nanoparticles.

[0297] Unless otherwise stated, all percentages and ratios used herein are by weight. Other features and advantages of this disclosure will be apparent from various examples. The examples provided illustrate different components and methods useful in practicing this disclosure. These examples do not limit the scope of the claimed disclosure. Based on this disclosure, those skilled in the art can identify and employ other components and methods that can be used in practicing this disclosure.

[0298] As used herein, the term "HELLP syndrome" is well-known in the field. HELLP syndrome is a life-threatening obstetric complication, often considered a complication of preeclampsia. "HELLP" is an acronym for the three main characteristics of the syndrome: hemolysis, elevated liver enzymes, and low platelet count.

[0299] As used herein, a “reference formulation” refers to a formulation containing an active ingredient similar to that of a comparison formulation but without one or more components of the comparison formulation. In some embodiments, the reference formulation contains a first dsRNA molecule and a second dsRNA molecule of the comparison formulation, but does not contain a cyclodextrin agent (e.g., HPBCD). In some embodiments, the reference formulation contains a cyclodextrin agent (e.g., HPBCD) and another component (e.g., a buffer (e.g., PBS buffer)). Formulation comparison includes determining relative changes in the pharmacological or biological activity (e.g., the biological activity of the agent), pharmacokinetics (e.g., absorption rate, maximum concentration, bioavailability, etc.), pharmacodynamics, etc., of a first formulation (containing one or more biological agents (e.g., one or more siRNAs)) containing cyclodextrin, and comparing it with a second reference formulation containing one or more biological agents (e.g., one or more siRNAs) that does not contain cyclodextrin. Alternatively, other characteristics, such as physicochemical properties, may be compared between the first and second reference formulations. The comparison may be a quantitative or qualitative relative change in biological activity, pharmacokinetics, pharmacodynamics, and / or physicochemical properties between the first and second reference formulations. The comparison results can be measured, characterized, or determined by comparing the relative fold changes of the first formulation and the second reference formulation in terms of specific indicators or characteristics.

[0300] All publications and patent documents cited herein are incorporated herein by reference as if each such publication or document were specifically and individually indicated to be incorporated herein by reference. The citation of publications and patent documents does not imply an admission of any related prior art, nor does it constitute any admission of their content or dates. The invention has now been described in writing, and those skilled in the art will recognize that the invention can be practiced in various embodiments, and that the foregoing description and the following examples are for illustrative purposes and not for limiting the scope of the appended claims.

[0301] Example It should be understood that the values ​​given in the examples are approximate and are subject to various experimental and instrument variations.

[0302] Example 1. Evaluation of comparative formulation and exemplary formulation For comparison, we prepared and evaluated formulations using a variety of excipients, including water, hydrophobic acid salts, carboxylic acids, sugar alcohols, and amino acids. Table 2 summarizes the characteristic results of these formulations.

[0303] Exemplary formulations containing HPBCD were compared with formulations using other excipients. Table 3 summarizes the comparison results.

[0304] Exemplary formulations containing different concentrations of HPBCD and dsRNA molecules were further evaluated. Tables 4-5 summarize the evaluation results.

[0305] Figure 2A and Figure 2B The data presented show that adding 6.5% w / v HPBCD to a formulation containing a 1:1 ratio of first and second dsRNA molecules at a total concentration of 150 mg / mL significantly reduces viscosity and lowers its temperature dependence (i.e., viscosity is less sensitive to temperature changes). This provides an advantage in the manufacturing process and facilitates various manufacturing operations such as mixing, pumping, and achieving uniform dispersion of the formulation.

[0306] Exemplary formulations containing HPBCDs with varying degrees of HP substitution were further evaluated. Table 6 summarizes the evaluation results.

[0307] Several formulations containing high concentrations of HPBCD (>10% w / v) combined with dsRNA molecules were evaluated. Table 7 compares the effects of high HPBCD concentrations (>10% w / v) and low HPBCD concentrations (≤10% w / v) on viscosity. The data in Table 7 indicate that the viscosity-reducing effect begins to decline when the molar ratio of HPBCD to dsRNA exceeds 5. The optimal range of HPBCD to dsRNA molar ratios (for viscosity reduction) is between 2.5 and 5. For dsRNA concentrations exceeding 150 mg / mL, this range corresponds to HPBCD concentrations of 5–10%.

[0308] Figure 3The effect of HPBCD concentration on the viscosity of dsRNA formulations was further explained. The viscosity-reducing effect of HPBCD was concentration-dependent, with a maximum viscosity reduction of 9-fold when the HPBCD concentration reached 6.5% w / v. However, when the HPBCD concentration exceeded 10% w / v, the viscosity increased. Without being bound by theory, the increase in viscosity at HPBCD concentrations above 10% w / v may be attributed to a shift in the molecular interaction between HPBCD and dsRNA. Furthermore, it was observed that the viscosity-reducing effect decreased when the molar ratio of HPBCD to dsRNA exceeded 5. The optimal range for the HPBCD to dsRNA molar ratio was between 2.5 and 5, where the viscosity-reducing effect was optimal. For dsRNA concentrations greater than 150 mg / mL, this range corresponds to an HPBCD concentration of 5-10% w / v. Moreover, for formulations containing a total concentration of 225 mg / mL of first and second dsRNA molecules (in a 1:1 ratio), the optimal viscosity-reducing effect was observed with the addition of HPBCD at a concentration of 6.5% w / v.

[0309] For further evaluation, exemplary formulations were prepared according to Table 8. Observations revealed that the pH value of the formulations was close to 7, indicating that their pH environment was neutral.

[0310] Example 2. Comparative analysis of UV absorbance of HPBCD and water in siRNA formulations. The purpose of this study comparing the UV absorbance of HPBCD and water in formulations containing a first siRNA, a second siRNA, and a combination of both was to investigate whether there were any differences in the UV absorbance patterns between the two media. UV absorbance is an important indicator of concentration-dependent responses and can provide information about the solubility and stability of molecules in the formulation.

[0311] UV absorbance analysis was performed by measuring the absorption spectra of formulations containing a first siRNA, a second siRNA, and combinations of both siRNAs in HPBCD and water. Measurements were conducted within a suitable wavelength range, allowing for a comprehensive assessment of UV absorption patterns.

[0312] The results indicate that HPBCD and water exhibit the same absorption pattern, and this pattern is concentration-dependent. Figures 4A-4C The results showed that UV absorption increased with increasing siRNA concentration. The UV absorption spectra of the three formulations in both media exhibited similar trends.

[0313] The observed similarity in UV absorption patterns between water and HPBCD suggests that HPBCD solution can serve as a medium for these siRNA formulations without affecting analytical quantification.

[0314] Example 3. Exemplary preparation of the formulation.

[0315] Figure 5 An exemplary preparation process for dsRNA formulations is described.

[0316] The formulation preparation process begins with the combination of hydroxypropyl β-cyclodextrin (HPBCD) and water for injection to form an HPBCD solution. This step ensures that HPBCD has appropriate solubility and usability in subsequent stages. Simultaneously, a first dsRNA molecule at a concentration of 190 mg / mL and a second dsRNA molecule at the same concentration are mixed in a 1:1 ratio.

[0317] After combining the first and second dsRNA molecules, a PreQS solution with a concentration of 190 mg / mL was prepared. This solution contained an active agent and could be used as a precursor for subsequent steps. The HPBCD solution was then added to the container containing the active agent to form the bulk solution. The concentration of the bulk solution reached 175 mg / mL.

[0318] To ensure appropriate quality and stability, the bulk solution undergoes pH adjustment and bioburden reduction. pH adjustment is performed according to established procedures, while bioburden reduction techniques are implemented to minimize the risk of microbial contamination. These measures contribute to improving the overall safety and efficacy of the formulation.

[0319] After pH adjustment and bioload reduction, the surfactant solution is transferred to a sterile storage container. The sterile storage container helps maintain the integrity and sterility of the solution during subsequent processing steps.

[0320] The next stage involves aseptic filtration, where the surfactant solution within the aseptic storage container is filtered using a suitable aseptic filtration system. This filtration process effectively removes any potential contaminants, ensuring the purity and sterility of the final product.

[0321] After filtration, the filtered bulk solution with a concentration of 175 mg / mL is ready for filling and capping. The filtered solution is dispensed into sterile vials. After filling, the vials are securely sealed with sterile stoppers to ensure the integrity of the formulation.

[0322] To ensure the quality of the final product, the filled and capped vials undergo visual inspection. This inspection aims to identify any visible defects, such as particles, discoloration, or anomalies, which may impair product quality or appearance.

[0323] Finally, the inspected and approved vials are stored under aseptic conditions, adhering to specific temperature and environmental requirements to maintain stability and sterility until further use or distribution.

[0324] Example 4. Pharmacokinetics of the formulation after single intravenous or subcutaneous administration.

[0325] Following a single intravenous (IV) dose, the pharmacokinetics and tissue distribution characteristics of the formulation containing the first and second dsRNAs in a 1:1 ratio in HPBCD and PBS buffer were evaluated in non-pregnant female Sprague-Dawley rats. Additionally, following a single subcutaneous (SC) dose, the pharmacokinetics and tissue distribution characteristics of the first and second dsRNAs in HPBCD and PBS buffer were evaluated in non-pregnant female Sprague-Dawley rats.

[0326] Intravenous pharmacokinetics (female non-pregnant rats) As shown in Tables 9 and 10, after IV administration of 5 mg / kg of the first and second dsRNAs (concentration ratio 1:1) to a female non-pregnant rat, the plasma exposure (C) of the HPBCD formulation and the PBS formulation was compared. max and AUC inf The concentrations (ngsiRNA / g tissue) and recovery rates (%) in the liver and kidneys were comparable. These results indicate that HPBCD had no effect on the overall pharmacokinetics of the two siRNAs (i.e., the first dsRNA and the second dsRNA) compared to the PBS control group.

[0327] a The dosage of each siRNA is 5 mg / kg. The total dosage of the combination of the first and second dsRNAs is 10 mg / kg.

[0328] a The dosage of each siRNA is 5 mg / kg. The total dosage of the combination of the first and second dsRNAs is 10 mg / kg. Subcutaneous pharmacokinetics in female nonpregnant rats Figure 6 Plasma concentration profiles are shown after subcutaneous (SC) administration of each siRNA (i.e., first and second dsRNA in a 1:1 ratio) at 50 mg / kg in HPBCD and PBS formulations. The HPBCD formulation exhibited lower Tg values ​​for both first and second dsRNAs compared to the formulations of first and second dsRNAs in PBS buffer. max and more than twice the C max These results are consistent with the fact that the HPBCD formulation has a higher absorption rate than the PBS buffer formulation.

[0329] As shown in Table 11, after administration of each of the first and second dsRNAs at 50 mg / kg SC in 6.5% (w / v) and 8% (w / v) HPBCD and PBS formulations, plasma (AUC) values ​​were [data missing]. last The exposure levels were comparable. As shown in Table 12, at 72 hours, the concentrations (ng siRNA / g tissue) and recovery rates (%) of the two siRNAs in the liver and kidneys were similar for both 6.5% (w / v) and 8% (w / v) HPBCD and PBS formulations. Therefore, the HPBCD formulation is rapidly absorbed from the injection site without affecting the overall exposure or final tissue distribution.

[0330] a The dosage for each siRNA is 50 mg / kg. The total dosage of the combination of the first and second dsRNAs is 100 mg / kg. kg

[0331] a The dosage for each siRNA is 50 mg / kg. The total dosage of the combination of the first and second dsRNAs is 100 mg / kg. kg Subcutaneous pharmacokinetics in pregnant rats Table 13 shows the pharmacokinetic parameters of the first and second dsRNAs in the HPBCD and PBS formulations after administration of 35 mg / kg and 100 mg / kg SC, respectively. Compared with the formulation using PBS buffer alone, the HPBCD formulation showed a lower Tg for both siRNAs. max and higher C max These results are consistent with the higher absorption rate of the HPBCD formulation compared to the PBS buffer formulation. As shown in Table 13, after administration of each of the first and second dsRNAs at 35 mg / kg or 100 mg / kg SC in both HPBCD and PBS formulations, the plasma (AUC) values ​​were... last The exposure levels are comparable.

[0332] a The dosage for each siRNA is 35 mg / kg or 100 mg / kg. The total dose of the combination of the first and second dsRNAs... The dosage is 70 mg / kg or 200 mg / kg.

[0333] As shown in Table 14, at 72 hours, the concentrations (ngsiRNA / g tissue) and recovery rates (%) of the two formulations in the liver, kidneys, and placenta were similar for both. Therefore, the HPBCD formulation is rapidly absorbed from the injection site without affecting overall exposure or final tissue distribution.

[0334] a The dosage for each siRNA is 35 mg / kg or 100 mg / kg. The total dose of the combination of the first and second dsRNAs... The dosage is 70 mg / kg or 200 mg / kg.

[0335] Assessment of subcutaneous injection site response in pregnant rats After subcutaneous injection of two formulations, local tolerance and inflammatory response at the injection site were assessed: one formulation contained a 1:1 mixture of the first and second dsRNAs and HPBCD (i.e., formulation 2 in Table 15), and the other formulation contained a 1:1 mixture of the first and second dsRNAs in PBS (i.e., formulation 1 in Table 15).

[0336] Histopathological results at the injection sites were initially graded from 1 to 5 according to severity (1 being the least severe and 5 being the most severe), with 6 animals in each dose group. The results primarily indicated minimal to mild mononuclear cell infiltration in the dermis and / or subcutaneous tissue of animals in groups 2, 3, 4, and 5, and mild to moderate mononuclear cell inflammation in the dermis and / or subcutaneous tissue of animals in groups 2, 4, and 5.

[0337] Furthermore, the most significant difference between the animal dosage groups was that, when using 6.5% w / v HPBCD (formulation 2), inflammatory responses were either absent or reduced at doses of 70 mg / kg and even higher doses of 200 mg / kg, which may be due to faster absorption at the injection site.

[0338] SC: Subcutaneous a Formulation 1 is a 1:1 mixture of the first and second dsRNAs in 0.4% PBS at a concentration of 100 mg / mL; Formulation 2 is a 1:1 mixture of the first and second dsRNAs in 6.5% HPBCD at a concentration of 175 mg / mL.

[0339] The composition of formulation 2 tested in Table 15 is shown in Table 16.

[0340] a It is added in the form of sodium salt. 1.06 mg of anhydrous sodium salt is equivalent to 1 mg of free acid. (Based on the pharmaceutical manufacturing process...) The potency of each batch of active pharmaceutical ingredient used will be adjusted as needed. b Based on a labeled volume of 0.9 mL. According to USP <1151> Overfilling is performed to ensure that the contents shown on the label are fully filled. to transport c Based on anhydrous materials. Moisture content has been corrected. d Sufficient to achieve a concentration of 87.5 mg / mL for each drug component and a total concentration of 175 mg / mL. USP = United States Pharmacopeia equivalent It should be understood that the invention may be embodied in other specific forms without departing from its spirit or essential characteristics. Therefore, the above embodiments should be considered illustrative in all respects and not limiting of the invention described herein. Consequently, the scope of the invention is indicated by the appended claims, not by the foregoing description, and this document is intended to cover all changes falling within the meaning and scope equivalent to the claims.

Claims

1. A formulation comprising: (i) dsRNA molecules; and (ii) Cyclodextrin agents.

2. The formulation of claim 1, wherein the dsRNA molecule is present at a concentration of at least about 100 mg / mL.

3. The formulation of claim 1, wherein the dsRNA molecule is present at a concentration of at least about 150 mg / mL.

4. The formulation of claim 1, wherein the dsRNA molecule is present at a concentration in the range of about 150 mg / mL to 250 mg / mL.

5. A formulation comprising: (i) the first dsRNA molecule and the second dsRNA molecule; and (ii) Cyclodextrin agents.

6. The formulation of claim 5, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of at least about 100 mg / mL.

7. The formulation of claim 5, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of at least about 150 mg / mL.

8. The formulation of claim 5, wherein the first dsRNA molecule and the second dsRNA molecule are present at a concentration in the range of about 150 mg / mL to about 250 mg / mL.

9. The formulation of any one of claims 1-8, wherein the cyclodextrin agent is present at a concentration ranging from about 5% w / v to about 35% w / v.

10. The formulation of any one of claims 1-8, wherein the cyclodextrin agent is present at a concentration ranging from about 5% w / v to about 25% w / v.

11. The formulation of any one of claims 1-8, wherein the cyclodextrin agent is present at a concentration in the range of about 5% w / v to about 10% w / v.

12. The formulation of any one of claims 1-8, wherein the cyclodextrin agent is present at a concentration of about 6.5% w / v.

13. The formulation according to any one of claims 1-8, wherein the cyclodextrin agent is present in the formulation at a cyclodextrin:dsRNA molar ratio of not more than 5.

14. The formulation according to any one of claims 1-8, wherein the cyclodextrin agent is present in the formulation at a cyclodextrin:dsRNA molar ratio between 2.5 and 5.

15. The formulation of claim 1, wherein the dsRNA molecule is present at a concentration of at least about 150 mg / mL, and the cyclodextrin agent is present at a concentration in the range of about 5% w / v to about 35% w / v.

16. The formulation of claim 1, wherein the dsRNA molecule is present at a concentration in the range of about 150 mg / mL and 250 mg / mL, and the cyclodextrin agent is present at a concentration in the range of about 5% w / v to about 10% w / v.

17. The formulation of claim 1, wherein the dsRNA molecule is present at a concentration of at least about 150 mg / mL and 250 mg / mL, and the cyclodextrin agent is present at a concentration of about 6.5% w / v.

18. The formulation of claim 1, wherein the dsRNA molecule is present at a concentration in the range of about 150 mg / mL to about 250 mg / mL, and the cyclodextrin agent is present in the formulation at a cyclodextrin:dsRNA molar ratio of not more than 5.

19. The formulation of claim 1, wherein the dsRNA molecule is present at a total concentration in the range of about 150 mg / mL to about 250 mg / mL, and the cyclodextrin agent is present in the formulation at a cyclodextrin:dsRNA molar ratio between 2.5 and 5.

20. The formulation of claim 5, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration of at least about 150 mg / mL, and the cyclodextrin agent is present at a concentration in the range of about 5% w / v to about 35% w / v.

21. The formulation of claim 5, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration ranging from about 150 mg / mL to about 250 mg / mL, and the cyclodextrin agent is present at a concentration ranging from about 5% w / v to about 10% w / v.

22. The formulation of claim 5, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration in the range of about 150 mg / mL to about 250 mg / mL, and the cyclodextrin agent is present at a concentration of about 6.5% w / v.

23. The formulation of claim 5, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration in the range of about 150 mg / mL to about 250 mg / mL, and the cyclodextrin agent is present in the formulation at a cyclodextrin:dsRNA molar ratio of not more than 5.

24. The formulation of claim 5, wherein the first dsRNA molecule and the second dsRNA molecule are present at a total concentration in the range of about 150 mg / mL to about 250 mg / mL, and the cyclodextrin agent is present in the formulation at a cyclodextrin:dsRNA molar ratio between 2.5 and 5.

25. The formulation according to any one of claims 1-24, wherein the cyclodextrin agent is hydroxypropyl β-cyclodextrin (HPBCD).

26. The formulation according to any one of claims 1-25, comprising a buffer.

27. The formulation of claim 26, wherein the buffer is selected from disodium hydrogen phosphate, potassium dihydrogen phosphate, or combinations thereof.

28. The formulation according to any one of claims 1-27, comprising a tension modifier.

29. The formulation of claim 28, wherein the tension modifier is selected from sodium chloride, potassium chloride, or combinations thereof.

30. The formulation of any one of claims 1-29, wherein the formulation has a physiologically suitable pH value.

31. The formulation of claim 30, wherein the pH range of the formulation is from about 6.0 to about 8.0, from about 6.5 to about 7.5, or from about 7 to about 7.

5.

32. The formulation according to any one of claims 1-31, wherein the physiological osmolarity of the formulation is greater than about 250 mOsm / L, greater than about 300 mOsm / L, greater than about 350 mOsm / L, greater than about 400 mOsm / L, or greater than about 500 mOsm / L.

33. The formulation of any one of claims 1-4, wherein the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) The antisense strand contains a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) The length of the antisense strand is at least 20 nucleotides; (3) The antisense chain contains at least 50% 2'-O-methyl modification; (4) The nucleotides at any one or more of the positions 2, 4, 5, 6, 8, 10, 12, 14, 16 and 20 from the 5' end of the antisense strand are not 2'-methoxyribonucleotides; (5) The nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense chain is complementary to a portion of the justice chain; (7) The length of the positive chain is at least 15 nucleotides; (8) The positive chain contains at least 65% 2'-O-methyl modification; (9) The nucleotides at positions 4, 6, 8, 10, and 14, starting from the 5' end of the positive strand, are not 2'-methoxyribonucleotides; and (10) The nucleotides at positions 1-2 from the 5' end of the positive strand are linked together by phosphate thionucleotide bonds.

34. The formulation of any one of claims 1-4, wherein the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) The antisense strand contains a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) The antisense strand comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (3) The nucleotides at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (4) The nucleotides at positions 1-2 to 1-7 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (5) A portion of the antisense chain is complementary to a portion of the justice chain; (6) The positive strand comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; and (7) The nucleotides at positions 1-2 from the 5' end of the positive strand are linked together by phosphate thionucleotide bonds.

35. The formulation of any one of claims 1-4, wherein the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) The antisense strand contains a sequence substantially complementary to the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2); (2) The length of the antisense strand is at least 20 nucleotides; (3) The antisense chain contains at least 50% 2'-O-methyl modification; (4) The nucleotides at any one or more of the positions 2, 4, 5, 6, 8, 10, 12, 14, 16 and 18 from the 5' end of the antisense strand are not 2'-methoxyribonucleotides; (5) The nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense chain is complementary to a portion of the justice chain; (7) The length of the positive chain is at least 15 nucleotides; (8) The positive chain contains at least 80% 2'-O-methyl modification; (9) The nucleotides at positions 7, 9, and 11, starting from the 5' end of the positive strand, are not 2'-methoxyribonucleotides; and (10) The nucleotides at positions 1-2 from the 5' end of the positive strand are linked together by phosphate thionucleotide bonds.

36. The formulation of any one of claims 1-4, wherein the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) The antisense strand contains the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2) is a fundamentally complementary sequence; (2) The length of the antisense strand is at least 20 nucleotides; (3) The antisense chain contains at least 70% 2'-O-methyl modification; (4) The nucleotides at positions 2, 4, 5, 6, 8 and 14 from the 5' end of the antisense strand are not 2'-methoxyribonucleotides; (5) The nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense chain is complementary to a portion of the justice chain; (7) The length of the positive chain is at least 15 nucleotides; (8) The positive chain contains at least 100% 2'-O-methyl modification; and (9) The nucleotides at positions 1-2 from the 5' end of the positive strand are linked together by phosphate thionucleotide bonds.

37. The formulation of any one of claims 1-4, wherein the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) The antisense strand contains the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2) is a fundamentally complementary sequence; (2) The length of the antisense strand is at least 20 nucleotides; (3) The antisense chain contains at least 75% 2'-O-methyl modification; (4) The nucleotides at any one or more of the positions 2, 4, 5, 6 and 14 from the 5' end of the antisense strand are not 2'-methoxyribonucleotides; (5) The nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense chain is complementary to a portion of the justice chain; (7) The length of the positive chain is at least 15 nucleotides; (8) The positive chain contains at least 100% 2'-O-methyl modification; and (9) The nucleotides at positions 1-2 from the 5' end of the positive strand are linked together by phosphate thionucleotide bonds.

38. The formulation of any one of claims 1-4, wherein the dsRNA molecule comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) The antisense strand contains the nucleic acid sequence 5' CTCTCGGATCTCCAAATTTA 3' (SEQ ID NO:1) or 5' CATCATAGCTACCATTTATT 3' (SEQ ID NO:2) is a fundamentally complementary sequence; (2) The length of the antisense strand is at least 20 nucleotides; (3) The antisense chain contains at least 85% 2'-O-methyl modification; (4) The nucleotide at any one or more of the positions 2 and 14 starting from the 5' end of the antisense strand is not a 2'-methoxyribonucleotide; (5) The nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense chain is complementary to a portion of the justice chain; (7) The length of the positive chain is at least 15 nucleotides; (8) The positive chain contains at least 100% 2'-O-methyl modification; and (9) The nucleotides at positions 1-2 from the 5' end of the positive strand are linked together by phosphate thionucleotide bonds.

39. The formulation of any one of claims 33-38, wherein the antisense strand is 20 nucleotides in length.

40. The formulation of any one of claims 33-38, wherein the antisense strand is 21 nucleotides in length.

41. The formulation of any one of claims 33-38, wherein the antisense strand is 22 nucleotides in length.

42. The formulation of any one of claims 33-38, wherein the length of the positive strand is 15 nucleotides.

43. The formulation of any one of claims 33-38, wherein the antisense strand is 16 nucleotides in length.

44. The formulation of any one of claims 33-38, wherein the antisense strand is 18 nucleotides in length.

45. The formulation of any one of 33-38, wherein the length of the positive strand is 20 nucleotides.

46. ​​The formulation of any one of claims 33-38, wherein the dsRNA molecule comprises a double-stranded region of 15 to 20 base pairs.

47. The formulation of any one of claims 33-38, wherein the dsRNA molecule comprises a double-stranded region of 15 base pairs.

48. The formulation of any one of claims 33-38, wherein the dsRNA molecule comprises a double-stranded region of 16 base pairs.

49. The formulation of any one of claims 33-38, wherein the dsRNA molecule comprises a double-stranded region of 18 base pairs.

50. The formulation of any one of claims 33-38, wherein the dsRNA molecule comprises a double-stranded region of 20 base pairs.

51. The formulation of any one of claims 33-38, wherein the dsRNA molecule comprises a blunt end.

52. The formulation of any one of claims 33-51, wherein the dsRNA molecule comprises at least one single-stranded nucleotide overhang.

53. The formulation of claim 52, wherein the dsRNA molecule comprises a single-stranded nucleotide overhang of about 2 to 5 nucleotides.

54. The formulation according to any one of claims 33-53, wherein the dsRNA molecule comprises 4-16 phosphate thionucleotide internucleotide bonds.

55. The formulation of any one of claims 33-53, wherein the dsRNA molecule comprises 8-13 phosphate thionucleotide internucleotide bonds.

56. The formulation of any one of claims 33-55, wherein the sense strand comprises one or more nucleotide mismatches between the antisense strand and the sense strand.

57. The formulation of any one of claims 33-56, wherein the antisense chain comprises 5'-phosphate, 5'-alkylphosphonate, 5'-alkylenephosphonate or 5'-olefinphosphonate.

58. The formulation of any one of claims 33-57, wherein the antisense chain comprises 5' vinylphosphonate.

59. The formulation of any one of claims 33-58, wherein the functional portion is connected to the 3' end of the positive chain.

60. The formulation of claim 59, wherein the functional portion comprises a hydrophobic portion.

61. The formulation of claim 60, wherein the hydrophobic portion is selected from the group consisting of: fatty acids, steroids, open-ring steroids, lipids, gangliosides, nucleotide analogs, endocannabinoids, vitamins, and mixtures thereof.

62. The formulation of claim 61, wherein the steroid is selected from the group consisting of cholesterol and lithocholic acid (LCA).

63. The formulation of claim 61, wherein the fatty acid is selected from the group consisting of: eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and docosahexaenoic acid (DCA).

64. The formulation of claim 61, wherein the vitamin is selected from the group consisting of choline, vitamin A, vitamin E, and their derivatives or metabolites.

65. The formulation of claim 61, wherein the functional portion is connected to the justice chain via a connector.

66. The formulation of claim 65, wherein the connector is a pyrolytic connector.

67. The formulation of claim 66, wherein the cleavable linker comprises a phosphate diester bond, a disulfide bond, an acid-labile bond, or a photocleavable bond.

68. The formulation of claim 66 or 67, wherein the cleavable linker comprises a dTdT dinucleotide having a phosphodiester nucleotide internucleotide bond.

69. The formulation of claim 67, wherein the acid-unstable bond comprises a β-thiopropionate bond or a carboxydimethylmaleic anhydride (CDM) bond.

70. The formulation of any one of claims 65-69, wherein the connector comprises a divalent or trivalent connector.

71. The formulation of claim 70, wherein the divalent or trivalent adapter is selected from the group consisting of: ; ; ; and , Where n is 1, 2, 3, 4 or 5.

72. The formulation of any one of claims 65-70, wherein the linker comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a thiophosphate, a phosphoramide, an amide, a carbamate, or a combination thereof.

73. The formulation of any one of claims 65-72, wherein when the connector is a trivalent connector, the connector is further connected to a phosphate diester or a phosphate diester derivative.

74. The formulation of claim 73, wherein the phosphate diester or phosphate diester derivative is selected from the group consisting of: ； (Zc1); ； (Zc2); and (Zc3) ； (Zc4) Where X is O, S or BH3.

75. The formulation of claims 33-74, wherein the nucleotides at positions 1 and 2 starting from the 3' end of the sense strand and the nucleotides at positions 1 and 2 starting from the 5' end of the antisense strand are linked to adjacent ribonucleotides via phosphate thioester bonds.

76. The formulation of claims 33-75, wherein the first chain or the second chain comprises a complementary region, wherein the complementary region is complementary to at least 15, 16, 17 or 18 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO:

2.

77. The formulation of claim 76, wherein the complementary region contains no more than three mismatches with SEQ ID NO: 1 or SEQ ID NO:

2.

78. The formulation of claim 77, wherein the complementary region is completely complementary to SEQ ID NO: 1 or SEQ ID NO:

2.

79. The formulation of any one of claims 33-78, wherein the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 3, and the sense strand comprises the nucleic acid sequence of SEQ ID NO:

4.

80. The formulation of any one of claims 33-78, wherein the antisense strand comprises the nucleic acid sequence of SEQ ID NO: 5, and the sense strand comprises the nucleic acid sequence of SEQ ID NO:

6.

81. The formulation of any one of claims 33-78, wherein the expression level of sFLT1 protein in cells or organisms is reduced by at least about 20%.

82. The formulation of claim 5, wherein... The first dsRNA molecule comprises a first sense strand and a first antisense strand, wherein the first antisense strand comprises a complementary region substantially complementary to SEQ ID NO: 1, and wherein the first dsRNA comprises the dsRNA of any one of claims 16-64; and The second dsRNA molecule comprises a second sense strand and a second antisense strand, wherein the second antisense strand comprises a complementary region substantially complementary to SEQ ID NO: 2, and wherein the second dsRNA comprises the dsRNA of any one of claims 16-64.

83. The formulation of claim 5, wherein... The first dsRNA molecule comprises a first sense strand and a first antisense strand (each strand having a 5' end and a 3' end), wherein the first antisense strand contains a complementary region substantially complementary to SEQ ID NO: 1; and The second dsRNA molecule comprises a second sense strand and a second antisense strand (each strand having a 5' end and a 3' end), wherein the second antisense strand contains a complementary region substantially complementary to SEQ ID NO: 2; and For each of the first dsRNA molecule and the second dsRNA molecule: (1) The length of the antisense strand is at least 20 nucleotides; (3) The antisense chain contains at least 50% 2'-O-methyl modification; (4) The nucleotides at any one or more of the positions 2, 4, 5, 6, 8, 10, 12, 14, 16 and 20 from the 5' end of the antisense strand are not 2'-methoxyribonucleotides; (5) The nucleotides at positions 1-2 to 1-8 from the 3' end of the antisense strand are linked together by phosphate thionucleotide bonds; (6) A portion of the antisense chain is complementary to a portion of the justice chain; (7) The length of the positive chain is at least 15 nucleotides; (8) The positive chain contains at least 65% 2'-O-methyl modification; (9) The nucleotides at positions 4, 6, 8, 10, and 14, starting from the 5' end of the positive strand, are not 2'-methoxyribonucleotides; and (10) The nucleotides at positions 1-2 from the 5' end of the positive strand are linked together by phosphate thionucleotide bonds.

84. The formulation of claim 5, wherein (a) The first dsRNA molecule comprises a first antisense strand and a first sense strand (each strand having a 5' end and a 3' end), wherein: (a-1) The first antisense chain contains and (a-2) The first chain of justice includes (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA) (SEQID NO: 8), (b) The second dsRNA molecule comprises a second antisense strand and a second sense strand (each strand having a 5' end and a 3' end), wherein: (b-1) The second antisense chain contains and (b-2) The second chain of justice includes (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA) (SEQID NO: 10), Where "m" corresponds to 2'-O-methyl modification, "f" corresponds to 2'-fluorine modification, and "#" corresponds to the internucleotide bond of thiophosphate ester.

85. The formulation of claim 5, wherein (a) The first dsRNA molecule comprises a first antisense strand and a first sense strand (each strand having a 5' end and a 3' end), wherein: (a-1) The first antisense chain contains and (a-2) The first chain of justice includes (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA)(T)(T)-PCDCA (SEQ ID NO: 12), (b) The second dsRNA molecule comprises a second antisense strand and a second sense strand (each strand having a 5' end and a 3' end), wherein: (b-1) The second antisense chain contains and (b-2) The second chain of justice includes (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA)(T)(T)-PCDCA (SEQ ID NO: 14), Where "m" corresponds to 2'-O-methyl modification, "f" corresponds to 2'-fluorine modification, "T" corresponds to thymidine DNA nucleotide, "#" corresponds to the internucleotide bond of thiophosphate ester, "V" corresponds to 5'-vinylphosphonate, and "PCDCA" corresponds to the 3'-C7-phosphocholine-docosahexaenoic acid conjugate via a phosphate linker.

86. The formulation of claim 5, wherein (a) The first dsRNA comprising a first antisense strand and a first sense strand (each strand having a 5' end and a 3' end), wherein: (a-1) The first antisense chain contains formula I or a salt thereof; and (a-2) The justice chain includes formula II or a salt thereof; and (b) The second dsRNA comprising a second antisense strand and a second sense strand (each strand having a 5' end and a 3' end), wherein: (b-1) The second antisense chain includes formula III or its salt; and (b-2) The second justice chain contains formula IV or its salt.

87. A method of treating or preventing a disease, comprising administering to a subject in need the formulation of any of the preceding claims.

88. The formulation as described in any of the preceding claims, for treating or preventing a disease in a subject in need.

89. A method for inhibiting the secretion of soluble fms-like tyrosine kinase-1 (sFLT1) by a subject, comprising administering to the subject the formulation of any one of the preceding claims.

90. The formulation as described in any of the preceding claims, used to inhibit sFLT1 in a subject.

91. The formulation as described in any of the preceding claims, wherein the maximum concentration (T0) of the administered formulation is achieved in the subject compared to a reference formulation. max The time required is shortened, wherein the reference formulation contains a first dsRNA molecule and a second dsRNA molecule, but does not include a cyclodextrin agent.

92. The formulation as claimed in any of the preceding claims, wherein the maximum concentration (C0) of the administered formulation in the subject is compared with that of the reference formulation. max The reference formulation is added, wherein the reference formulation comprises a first dsRNA molecule and a second dsRNA molecule, but does not include a cyclodextrin agent.

93. The formulation as described in any one of the preceding claims, wherein: (a) The maximum concentration (T0) of the administered formulation achieved in the subject compared to the reference formulation. max The required time is reduced by at least one of the following: at least 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 4.5 times, at least about 5 times, at least about 5.5 times, at least about 6 times, at least about 6.5 times, at least about 7 times, at least about 7.5 times, at least about 8 times, at least about 8.5 times, at least about 9 times, at least about 9.5 times, or at least about 10 times, wherein the reference formulation comprises a first dsRNA molecule and a second dsRNA molecule, but does not include a cyclodextrin agent; and / or (b) The maximum concentration (C0) of the administered formulation in the subject compared to the reference formulation. max The reference formulation shall be increased by at least one of the following: at least 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 4.5 times, at least about 5 times, at least about 5.5 times, at least about 6 times, at least about 6.5 times, at least about 7 times, at least about 7.5 times, at least about 8 times, at least about 8.5 times, at least about 9 times, at least about 9.5 times, or at least about 10 times, wherein the reference formulation comprises a first dsRNA molecule and a second dsRNA molecule, but does not include a cyclodextrin agent.

94. The formulation of any one of claims 91-93, wherein the formulation is administered subcutaneously.

Images