Phytophthora gls1 protein, encoding gene and application thereof

Abstract

This invention discloses a glucosidase protein (GLS1) from *Phytophthora*, a plant pathogenic oomycete, its encoding gene, and its applications. The PsGLS1 protein provided by this invention is effective against *Phytophthora soybean* (…). Phytophthora sojae The protein in this invention is shown in SEQ ID No. 1; its encoding gene is shown in SEQ ID No. 2. Experiments have demonstrated that the protein provided by this invention plays an important role in the growth and development of *Phytophthora soybeani*. PsGLS1 Gene knockout significantly reduced the mycelial growth rate, sporangium number, zoospore yield, and resting spore germination rate of *Phytophthora soybeani*, and also significantly affected the pathogenicity of the fungus. The glucosidase inhibitor sericite also inhibited the mycelial growth of *Phytophthora soybeani*. In summary, this invention… PsGLS1 Genes have high application value in controlling the occurrence and spread of diseases caused by Phytophthora, and provide molecular targets for the development of new fungicides in the future.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to *Phytophthora indicum* (Soybean Phytophthora). Phytophthora sojae GLS1 protein and its encoding gene and applications. Background Technology

[0002] Oomycetes are widely distributed, with hosts spanning both the plant and animal kingdoms. Plant pathogenic oomycetes account for approximately 60% of all oomycetes and can be divided into the genus *Phytophthora* (…). Phytophthora ), Pythium ( Pythium ), genus *Peronospora* Peronospora Plant pathogenic oomycetes infect a wide variety of crops, causing huge economic losses to agricultural production. Among them, Phytophthora spp. plant pathogenic oomycetes (…) Phytophthora (spp.) poses a particularly serious threat to agricultural production.

[0003] Under natural conditions, the life cycle of *Phytophthora* consists of two stages: asexual and sexual. In the sexual reproduction stage, it forms oospores through homozygous mating, resisting adverse external environments and surviving in the soil for several years. When external conditions are suitable, the oospores germinate and infect the host, becoming the primary source of infection. In the asexual reproduction stage, *Phytophthora* sporangia produce and release zoospores in a room-temperature, liquid environment. After a short period of dormancy, these zoospores rapidly differentiate into resting spores, which further germinate and infect the host.

[0004] Phytophthora soybeani, a plant pathogenic oomycete that causes typical soil-borne diseases, is a common plant pathogen. Phytophthora sojae This can lead to soybean stem and root rot (PRR), which can occur throughout the entire growth period of soybeans. The typical symptoms of infected soybean plants are rotting that starts from the roots and gradually spreads upwards along the stem, forming visible brown lesions on the stem, especially at the base, causing serious economic losses to soybean yield.

[0005] Soybean Phytophthora exists in multiple physiological races, exhibits rapid mutation, and is highly pathogenic, severely limiting the development and utilization of Phytophthora resistance genes. Furthermore, biological control has a long effective time and requires significant human and material resources. Currently, chemical control remains one of the most effective methods for controlling oomycete diseases. With the deepening understanding of fungicide mechanisms of action, targeting key binding sites has become a core strategy for creating novel oomycete inhibitors; therefore, developing oomycete fungicides based on novel targets is particularly important and urgent.

[0006] During the infection of plant pathogens, defensive small molecules produced by the plant may interfere with the normal infection process. Pathogens' ability to resist this reverse "stress" during infection is crucial for their normal infection of the host. Glucosidase protein (GLS1), a key protein in endoplasmic reticulum quality control, can promote proper protein folding by transferring glucose molecules on the peptide chain; however, its function in oomycetes such as Phytophthora has not been reported.

[0007] In conclusion, the zoospores and the ability of Phytophthora to infect hosts are important factors affecting the occurrence and development of diseases. If the above processes of Phytophthora can be blocked by affecting the key proteins of Phytophthora, the damage caused by Phytophthora can be controlled. Summary of the Invention

[0008] This invention identifies a glucosidase GLS1 (mannosyl-oligosaccharide glucosidase) in *Phytophthora insecta*. This protein belongs to the GH63 family of glycosyl hydrolases and contains both an N-terminal domain of the GH63 family and a trehalase superfamily domain. It is named PsGLS1.

[0009] The inventors' research revealed that GLS1 in *Phytophthora sojae* is closely related to the mycelial growth rate, sporangium number, zoospore production, and resting spore germination rate of *Phytophthora sojae*, and also affects the pathogen's response to endoplasmic reticulum stress. Therefore, regulating the function of the GLS1 protein can weaken the ability of *Phytophthora sojae* to infect the host, thereby controlling the occurrence and development of *Phytophthora sojae* root rot.

[0010] The sequence of the GLS1 protein (PsGLS1) in Phytophthora soybeanis is shown in SEQ ID No. 1 of the sequence listing. SEQ ID No. 1 (PsGLS1) consists of 905 amino acid residues. The DNA sequence (encoding gene and cDNA) required to encode the PsGLS1 protein can be specifically shown in SEQ ID No. 2 of the sequence listing. SEQ ID No. 2 (PsGLS1) consists of 2718 nucleotides and encodes the protein PsGLS1 shown in SEQ ID No. 1 of the sequence listing.

[0011] Therefore, one of the objectives of this invention is to provide a protein, Phytophthora GLS1, which is a protein as follows (A1) or (A2)1:

[0012] A1) The amino acid sequence is that of the protein shown in SEQ ID No. 1 of the sequence listing;

[0013] A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a protein as shown in SEQ ID No. 1;

[0014] To facilitate the purification of proteins in A1, tags such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), and c-myc (EQKLISEEDL) can be attached to the amino or carboxyl terminus of proteins with amino acid sequences as shown in SEQ ID No.1 in the sequence listing.

[0015] In A1), SEQ ID No. 1 (GLS1) consists of 905 amino acid residues.

[0016] A second objective of this invention is to provide a nucleic acid molecule encoding the GLS1 protein. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; or it may be RNA, such as mRNA, hnRNA, or tRNA.

[0017] The gene encoding the above protein is a DNA molecule with the nucleotide sequence shown in SEQ ID No. 1 of the sequence listing;

[0018] In this invention, the DNA sequence (encoding gene and cDNA) required to encode the protein PsGLS1 of Phytophthora spp. can be specifically shown as SEQ ID No. 2 in the sequence listing. SEQ ID No. 2 (PsGLS1) in the sequence listing consists of 2718 nucleotides; nucleotides 214-612 and 1153-2709 from the 5' end of SEQ ID No. 2 are the coding sequence, which encodes the protein PsGLS1 shown in SEQ ID No. 1 in the sequence listing.

[0019] The third invention provides a raw RNA sequence transcribed from any of the above DNA sequences, or a codon-optimized RNA sequence, wherein the RNA molecule sequence is an RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 2.

[0020] The fourth objective of this invention is to provide the above-mentioned nucleic acid molecule-related biological materials, including recombinant vectors, expression cassettes, recombinant microorganisms, or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector or a recombinant cloning vector. In the above-mentioned biological materials, the vector can be a plasmid, granule, bacteriophage, or viral vector; the microorganism can be yeast, bacteria, algae, or fungi, such as Agrobacterium; the transgenic plant cell line does not include propagation material. Specifically, it can be any one of the following D1) to D10):

[0021] D1) An expression cassette containing the encoded gene;

[0022] D2) A recombinant vector containing the coding gene, or a recombinant vector containing the expression cassette described in D1);

[0023] D3) Recombinant microorganisms containing the coding gene, or recombinant microorganisms containing the expression cassette of D1), or recombinant microorganisms containing the recombinant vector of D2);

[0024] D4) A transgenic plant cell line containing the coding gene, or a transgenic plant cell line containing the expression cassette described in D1);

[0025] D5) Transgenic plant tissue containing the coding gene, or transgenic plant tissue containing the expression cassette described in D2);

[0026] D6) A transgenic plant organ containing the coding gene, or a transgenic plant organ containing the expression cassette described in D2);

[0027] D7) A nucleic acid molecule that inhibits the expression of the coding gene; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the coding gene or silences the coding gene, or it may be an sgRNA fragment that encodes the target gene to be knocked out, such as the sgRNA sequence (coding sequence) TTGTGTCGGCCGGACTATTG (SEQ ID No. 3) that targets the PsGLS1 coding gene.

[0028] D8) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in D7);

[0029] D9) Nucleic acid molecules that inhibit the translation of the above RNA molecules;

[0030] D10) produces expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines that generate the nucleic acid molecules described in D9).

[0031] The fifth objective of this invention is to provide the application of the GLS1 protein and the nucleic acid molecule encoding the GLS1 protein or the biomaterial encoding the nucleic acid molecule of the GLS1 protein.

[0032] The application is any one or more of the following 1)-3):

[0033] 1) Application in inhibiting Phytophthora sporangium production;

[0034] 2) Application in inhibiting the production of zoospores of Phytophthora;

[0035] 3) Application in reducing the pathogenicity of Phytophthora.

[0036] Preferably, the application includes the application described in 1)-3) by inhibiting the transcription of the encoding gene described in SEQ ID No. 2 or deactivating it, or inhibiting the translation of the RNA molecule, or inhibiting or deactivating the activity of the soybean Phytophthora GLS1 protein described in SEQ ID No. 1.

[0037] In the aforementioned applications, the production of sporangia and zoospores is affected by inhibiting the transcription of the coding genes described above, or inhibiting the translation of the RNA sequences described above, or inhibiting and / or inactivating the activity of the Phytophthora GLS1 protein described above, thereby inhibiting and / or killing the growth of Phytophthora.

[0038] The sixth objective of this invention is to provide the application of the Phytophthora GLS1 protein and the above-mentioned encoding gene as targets for screening antibacterial or fungicidal agents against Phytophthora soybean.

[0039] The seventh objective of this invention is to provide a method for screening or assisting in the screening of Phytophthora infestans antibacterial and / or fungicidal agents. The method includes applying a test substance to the Phytophthora infestans. When the test substance can inhibit the transcription of the DNA sequence as shown above, or inhibit the translation of the RNA sequence as shown above, or inhibit or deactivate the activity of the Phytophthora GLS1 protein as shown above, the test substance is a candidate Phytophthora infestans antibacterial and / or fungicidal agent.

[0040] The eighth objective of this invention is to provide a method for reducing the activity of Phytophthora infestans, comprising the following steps: inhibiting or deleting the transcription of the coding gene as described above, or inhibiting the translation of the RNA molecule described above, or inhibiting or deactivating the activity of the Phytophthora GLS1 protein as described above.

[0041] The reduction of Phytophthora activity refers to the reduction of sporangium and zoospore production.

[0042] In the above method, the activity of the protein is inhibited or rendered inactive by suppressing or reducing the expression of the gene encoding the Phytophthora GLS1 protein. Specifically, this can be achieved through gene knockout or gene silencing.

[0043] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is achieved by altering the DNA sequence to render a specific target gene inactive.

[0044] Preferably, the above-mentioned Phytophthora is Phytophthora soybeani.

[0045] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing can occur at two levels: one is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects; the other is post-transcriptional gene silencing, which is the loss of gene activity at the post-transcriptional level through specific inhibition of target RNA, including antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0046] Preferably, the protein represented by the protein shown in SEQ ID No. 2 in the sequence listing is deactivated by gene knockout.

[0047] In one embodiment of the present invention, the method for knocking out the above-mentioned gene is based on the CRISPR / Cas9 gene knockout method.

[0048] Specifically, the CRISPR / Cas9-based gene knockout method involves transfecting the Donor vector and sgRNA expression vector of the target gene, along with the Cas9 expression plasmid, into Phytophthora soybean and screening to obtain recombinant bacteria that have lost the activity of the target knockout protein.

[0049] The Donor vector (e.g., pBS-PsGLS1-NPTII) is a recombinant vector containing a sequence of 800-1500 bp upstream of the gene to be knocked out, a Donor DNA sequence (which can be an NPTII, GFP, or RFP gene sequence, etc.), and a sequence of 800-1500 bp downstream of the gene to be knocked out, linked sequentially. The sgRNA and Cas9 protein co-expression plasmid is a vector (e.g., PYF515-PsGLS1) encoding an sgRNA fragment targeting the gene to be knocked out and a DNA sequence expressing the Cas9 protein. The gene to be knocked out is sequence 4 from the sequence listing, targeting... PsGLS1 The sgRNA sequence of the gene is sgPsGLS1:TTGTGTCGGCCGGACTATTG (SEQ ID No. 3). Preferably, the sgRNA expression plasmid uses the PYF515 vector as the starting vector, and respectively... PsGLS1 The double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the gene is inserted between the NheI and BsaI enzyme recognition sites of the PYF515 vector to obtain the sgRNA expression plasmid.

[0050] In the above applications, the substance that inhibits PsGLS1 protein expression and / or activity is a substance that inhibits PsGLS1 protein expression and / or inhibits the transcription of the gene encoding PsGLS1 protein and / or inhibits the translation of RNA molecules obtained from the transcription of the gene encoding PsGLS1 protein.

[0051] Experiments have demonstrated that the PsGLS1 protein provided by this invention plays an important role in the growth and development of *Phytophthora soybeani*. It was obtained using CRISPR / Cas9 gene editing technology. PsGLS1 Gene knockout mutant. Compared with wild-type and empty vector strains: PsGLS1 The gene knockout mutant exhibited decreased mycelial growth rate, sporangium production, zoospore production, and significantly reduced resting spore germination rate. PsGLS1 The gene-replaced strain showed no significant difference from the wild type in the aforementioned aspects. Therefore, this indicates that the PsGLS1 protein of *Phytophthora sacchariformis* plays an important role in mycelial growth, sporangium formation, zoospore production, and resting spore germination.

[0052] at the same time, PsGLS1 Gene knockout affected the response to endoplasmic reticulum stress inducers / scavengers, and significantly reduced the pathogenicity of *Phytophthora sojae*. Furthermore, the knockout transformants showed altered sensitivity to glucosidase inhibitors and decreased levels of endoplasmic reticulum stress-related marker proteins, indicating its influence on the endoplasmic reticulum stress process. This invention provides technical support for elucidating the molecular mechanisms by which PsGLS1 regulates the growth, development, pathogenicity, and endoplasmic reticulum stress of *Phytophthora sojae*, and provides a potential molecular target for the future development of novel fungicides against *Phytophthora sojae*. Attached Figure Description

[0053] Figure 1 Cluster analysis and homology comparison of PsGLS1 protein in plant pathogens;

[0054] Figure 2 Plant pathogens PsGLS1 Schematic diagram of gene knockout principle and its acquisition PsGLS1 PCR validation gel image of homozygous knockout transformants;

[0055] Figure 3 The wild-type soybean Phytophthora P6497 (WT), empty vector control (EV), and the strain obtained in Example 3 PsGLS1 Gene knockout mutant ( Δ GLS1_331 Δ GLS1_402 Δ GLS1_475) and PsGLS1 Mycelial growth rate of the reintroduced strain (PsGLS1-C);

[0056] Figure 4The wild-type soybean Phytophthora P6497 (WT), empty vector control (EV), and the strain obtained in Example 3 PsGLS1 Gene knockout mutant ( Δ GLS1_331 Δ GLS1_402 Δ GLS1_475) and PsGLS1 Statistical analysis of sporangium morphology and quantity of the supplemented strain (PsGLS1-C);

[0057] Figure 5 The wild-type soybean Phytophthora P6497 (WT), empty vector control (EV), and the strain obtained in Example 3 PsGLS1 Gene knockout mutant ( Δ GLS1_331 Δ GLS1_402 Δ GLS1_475) and PsGLS1 Zoospore morphology and yield statistics of the supplemented strain (PsGLS1-C);

[0058] Figure 6 The wild-type soybean Phytophthora P6497 (WT), empty vector control (EV), and the strain obtained in Example 3 PsGLS1 Gene knockout mutant ( Δ GLS1_331 Δ GLS1_402 Δ GLS1_475) and PsGLS1 The germination rate of dormant spores in the supplemented strain (PsGLS1-C);

[0059] Figure 7 The wild-type soybean Phytophthora P6497 (WT), empty vector control (EV), and the strain obtained in Example 3 PsGLS1 Gene knockout mutant ( Δ GLS1_331 Δ GLS1_402 Δ GLS1_475) and PsGLS1 Statistical analysis of the pathogenicity of the supplementary strain (PsGLS1-C);

[0060] Figure 8 The inhibitory effect of pterostilbene, a glucosidase inhibitor, on the mycelial growth of Phytophthora soybeanis;

[0061] Figure 9 This is a diagram showing the para-molecular docking of PsGLS1, a soybean Phytophthora, with the glucosidase inhibitor sericite. Detailed Implementation

[0062] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0063] Phytophthora indicum strain P6497: a standard strain donated by Professor Brett M. Tyler of Oregon State University (Tyler BM, Tripathy S, Zhang X, Dehal P, Jiang RH, Aerts A, Arredondo FD, Baxter L, Bensasson D, Beynon JL, et al. 2006). Phytophthora (Genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 313:1261-1266), deposited at the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University, and available to the public from China Agricultural University.

[0064] pYF515 vector (Cas9 protein and sgRNA co-expression vector, selection marker NPTII) was donated by Professor Brett M. Tyler's laboratory at Oregon State University.

[0065] The method for constructing gene point mutation vectors based on CRISPR / Cas9 in this embodiment, and the sequences of related vectors, are described in the literature "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139." and "Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in theoomycete Phytophthora sojae It was disclosed in “using CRISPR / Cas9. Curr. Protoc. Microbiol. 44,21A.1.1-21A.1.26.”

[0066] The pBluescript II SK+ homologous arm vector plasmid (Donor vector), sgRNA and Cas9 co-expression plasmid PYF515 used in this embodiment were donated by Professor Brett M. Tyler of Oregon State University and are stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University. They are available to the public from China Agricultural University.

[0067] Antibiotic: Geneticin (G418), 5×10 4 μg / mL, Ampicillin (Amp), 1×10 5 μg / mL, oxathiapiprolin (ox), 100 μg / mL, were both dissolved in deionized water and then filtered through a 0.22 μm filter membrane.

[0068] Culture medium or reagent formulation:

[0069] 10% V8 solid medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir well, dilute 10 times with deionized water, i.e., add 900 mL deionized water, add 15 g agar, autoclave at 121 ℃ for 20 min.

[0070] 10% V8 liquid culture medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir well, centrifuge at 12000 rpm for 5 min, take the supernatant, dilute 10 times with deionized water, and autoclave at 121 ℃ for 20 min.

[0071] Example 1 PsGLS1 Gene sequence analysis, cluster analysis, and homology comparison

[0072] In this embodiment, DNA and cDNA of Phytophthora soybean strain P6497 were used as templates to amplify... PsGLS1 The gene was then amplified and the amplified product was sent to Qingke Biotechnology Co., Ltd. for sequencing (the sequencing primers were the same as the amplification primers). Sequencing showed that the amplified product yielded... PsGLS1 The gene, with its sequence shown in SEQ ID No. 2 of the sequence listing, consists of 2718 nucleotides. The coding sequence is located at positions 214-612 and 1153-2709 from the 5' end of SEQ ID No. 2, encoding the protein PsGLS1 shown in SEQ ID No. 1 of the sequence listing. SEQ ID No. 1 (PsGLS1) consists of 905 amino acid residues.

[0073] Table 1 PsGLS1Gene amplification primer information

[0074]

[0075] The domains of the PsGLS1 protein were predicted online using NCBI (https: / / www.ncbi.nlm.nih.gov / ), and the domains were plotted using functional domain mapping software version 1.0.3 (IBS 1.0.3). The results showed that amino acids 72-204 of the PsGLS1 protein contain a Glyco-hydro-63N domain, and amino acids 385-903 contain a Trehalase domain. Phylogenetic analysis of GLS1 proteins in mammals, plants, fungi, and oomycetes revealed that *Phytophthora soybeani* is more closely related to other *Phytophthora* species in oomycetes, and clusters with *Phytophthora camphorata* GLS1 in a specific lineage. Figure 1 ).

[0076] Sequence analysis of GLS1 protein in plant pathogenic oomycetes and GLS1 protein in humans, mice, Arabidopsis thaliana and yeast revealed that Phytophthora soybeani has a high homology of over 80% with GLS1 protein in other oomycetes, and about 30% homology with yeast, humans, mice and Arabidopsis thaliana. Among them, proteins MGGS, CWH41 and GCS1 are homologous proteins of GLS1 in different species (Table 2).

[0077] Table 2 Homology of PsGLS1 with GLS1 protein in other species

[0078] GLS1 in different species homology 100% 91.24% 83.05% 81.54% 29.30% 32.18% 33.56% 32.66% 31.46% 32.34% 31.46% 33.29% 33.51% 33.29% 34.64% 32.65% 30.99% 33.11% 31.52% 31.23% 32.21% 35.76 % 24.34%

[0079] Example 2, Soybean Phytophthora PsGLS1 Construction of gene knockout and complementation vectors

[0080] The method for constructing gene knockout vectors based on CRISPR / Cas9 and the sequences of related vectors in this embodiment are described in the literature "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojaeusing CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139." and "Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in theoomycete Phytophthora sojae The pBluescript II SK+ homologous arm vector plasmid (Donor vector) and the expression vector PYF515 fusion of sgRNA and Cas9 used in this embodiment were donated by Professor Brett M. Tyler of Oregon State University.

[0081] The pBluescript II SK+ vector carries the Donnor and homologous arm fragments. The PYF515 vector is used for transcription to generate sgRNA targeting the target sequence and to express the Cas9 protein for enzyme digestion of the target fragment. The pTOR vector is used for complementary expression of Phytophthora protein. Using the CRISPR / Cas9 system based on non-homologous end joining (NHEJ), the target gene sequence can be edited by designing sgRNA sequences specifically targeting the target protein encoding gene and homologous arm sequences 1000 bp upstream and downstream of the target sequence.

[0082] The carrier Donor and the homologous arm fragment carrier pBS- used in this embodiment are... PsGLS1 NPTII, transcription of sgRNA and expression of Cas9 protein particle PYF515- PsGLS1 Replacement carrier PYF515- ΔPsGLS1 The specific construction method is as follows:

[0083] sgRNA primer design: Targeting primers were designed using the sgRNA website (EuPaGDT (http: / / grna.ctegd.uga.edu / )). PsGLS1 and NPTII The sgRNA was input into the gene CDS sequence, and the sgRNA with the higher score was selected from the given sgRNA table (as shown in Table 3, SgPsGLS1 targets sgRNA). PsGLS1The target DNA sequence is located at positions 267-287 of SEQ ID No. 2 of the gene. On-Target efficiency refers to the efficiency of sgRNA in recognizing and cleaving the DNA template after targeting the target site; a higher score indicates higher accuracy. Off-Target efficiency refers to the off-target effect; a higher score indicates a lower off-target rate. Secondary structure analysis of the target sgRNA sequence was performed using RNA structure (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predict1 / Predict1.html). Finally, the selected 20 nt sgRNA sequence was designed onto the vector backbone to form complete sgRNA primers, which were then synthesized by Qingke Technology Co., Ltd.

[0084] Table 3 Targets PsGls1 and NPTII sgRNA sequence of the gene

[0085] sgRNA sequence Sequence (5′-3′) Purpose SgPsGLS1 TTGTGTCGGCCGGACTATTG (SEQ ID No.3) Guider RNA for gene knockout sgNPTII CCATCATGGCTGATGCAATG (SEQ ID No.6) Gene knockout guider RNA, used for gene complementation

[0086] Construction of sgRNA expression vector:

[0087] (1) Dilute the synthesized sgRNA fragment to 100 μM / mL and prepare the following reaction system to synthesize double-stranded sgRNA: 3 μL of forward sgRNA fragment, 3 μL of reverse sgRNA fragment, 4 μL of 0.5M NaCl, and 24 μL of ddH2O.

[0088] (2) The above system was reacted at 100℃ for 2 min, placed at room temperature for 3-4 h, and then diluted 500 times with ddH2O for subsequent ligation and transformation experiments to construct the sgRNA vector.

[0089] (3) The backbone vector used for the sgRNA vector was the PYF515 expression plasmid vector. The PYF515 vector plasmid was double-digested with Nhe I and Bsa I. The digested vector was then gel-extracted using the Easy Pure® Quick Gel Extraction Kit (Beijing Kangwei Biotechnology Co., Ltd.).

[0090] (4) The diluted sgRNA fragment was ligated into the digested and recovered vector plasmid. The specific reaction system was as follows: 4 μL sgRNA fragment, 50 ng PYF515 vector plasmid, 5×T4 DNA Ligase Buffer, 0.5 μL T4 DNA Ligase, and up to 10 μL ddH2O. The mixture was gently mixed and incubated at 25°C for 30 min. Then, E. coli heat shock transformation was performed, followed by colony PCR using universal primers M13F and RPL41 (Table 5). The colonies were sent to Qingke Company for sequencing verification. The recombinant vector expressing the sgRNA fragment correctly was named PYF515-PsGLS1 (targeting PsGLS1). NPTII （ Targeted NPTII).

[0091] (5) After successful sequencing, the sgRNA vector plasmid was extracted using the Kangwei endotoxin-free plasmid large-scale plasmid extraction kit.

[0092] Primer design for knockout and restoration of homologous arms: Use the website (https: / / www.takarabio.com / learning-centers / cloning / primer-design-and-other-tools) and enter the pBluescript II KS+ vector sequence in the corresponding location. PsGLS1 1000 bp upstream of the gene (amplification primers: pBS-NPTII-PsGLS1-F1 / R1), NPTII gene (amplification primers: pBS-NPTII-PsGLS1-F2 / R2) or PsGLS1 Genes and PsGLS1 Primers were designed for the 1000 bp downstream sequence of the gene (amplification primers: pBS-NPTII-PsGLS1-F3 / R3). The specific primer sequences are shown in Table 4. The primers were then sent to Qingke Company for synthesis.

[0093] Table 4 PsGLS1 Constructing primer sequences for gene knockout homologous arm vectors and complement vectors

[0094]

[0095] Construction of the homologous arm knockout and addition vector pBS-NPTII-PsGLS1: pBluescript IIKS+ vector was digested with EcoRV enzyme, incubated at 37°C for 3 h, and amplified using PFU high-fidelity enzyme. PsGLS1 1000 bp upstream of the gene NPTII Genes and PsGLS1Downstream of 1000 bp (amplification primer sequences are shown in Table 4), the digested vector and gene product were gel-extracted using the Easy Pure® Quick Gel Extraction Kit (Beijing Kangwei Biotechnology Co., Ltd.). After extraction, homologous recombination ligation and E. coli DH5α transformation were performed, following the same steps as in Example 2, “Construction of sgRNA expression vector (4)”. Once single colonies of E. coli had grown, colony PCR was performed using universal primers M13F and M13R. The specific primer sequences are shown in Table 5. The samples were then sent to Qingke Company for sequencing verification. The verification showed that the sample contained the following sequence ligation. PsGLS1 1000 bp upstream of the gene NPTII Genes and PsGLS1 The downstream 1000 bp recombinant vector was named pBS-NPTII-PsGLS1.

[0096] Construction of the pBS-C-PsGLS1 vector: The steps are the same as for "construction of the pBS-NPTII-PsGLS1 vector". PsGLS1 1000 bp upstream of the gene (amplification primers: pBS-C-PsGLS1-F1 / R1) PsGLS1 Gene sequence (amplification primers: pBS-C-PsGLS1-F2 / R2) and PsGLS1 A 1000 bp fragment downstream of the gene (amplification primers: pBS-C-PsGLS1-F3 / R3) was ligated into the vector pBluescript II SK+ (EcoR V digestion). Specific primer sequences are shown in Tables 4 and 5. The sample was sent to Qingke Company for sequencing verification. Verification showed that the sample contained the following sequence... PsGLS1 1000 bp upstream of the gene PsGLS1 Gene sequence and PsGLS1 The recombinant vector containing the 1000 bp downstream fragment of the gene was named pBS-C-PsGLS1.

[0097] Table 5 Validation universal primers

[0098]

[0099] Example 3: Soybean Phytophthora PsGLS1 Obtaining gene sequence knockout and complement mutants

[0100] Prepared using CaCl2-PEG mediated protoplast transformation method PsGLS1The method of gene knockout transformants and oomycete genetic transformation was disclosed in the literature "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139."

[0101] Specifically, knockout transformants were obtained by using the PYF515-PsGLS1 vector and the pBS-PsGLS1-NPTII homologous arm vector from Example 2 together, and transforming them into *Phytophthora sojae* P6497 via PEG-mediated protoplast transformation. After the transformed protoplasts were revived into mycelia, they were covered with V8 solid medium containing 50 μg / mL G418 and incubated in the dark at 25°C. After 2-3 days, mycelia with resistance markers were selected, and DNA was extracted for PCR verification using the primers listed in Table 6. Transformants that could only amplify the homologous arm band (primers: PsGLS1-F2 / R2, PsGLS1-F3 / R3) but not the PsGLS1 band (primers: PsGLS1-F1 / R1) were considered homozygous knockout transformants.

[0102] After obtaining the homozygous knockout mutant, a complement strain was obtained by protoplast transformation. The homologous arm vector pBS-C-PsGLS1 and the sgRNA expression vector PYF515-PsGLS1-C were simultaneously transformed into the protoplasts of the PsGLS1 gene homozygous knockout transformants for complementation. PsGLS1 The gene will be verified by PCR using the primers listed in Table 6. The final result will be... PsGLS1 homozygous knockout mutant ( Δ GLS1_331 Δ GLS1_402 Δ GLS1_475) and PsGLS1 Replacement strain (PsGLS1-C) Figure 2 Among them, those that can amplify the homologous arm band (amplification primers: PsNPTII-F2 / R2, PsNPTII-F2 / R2) but cannot amplify the PsNPTII band (amplification primer: PsNPTII-F1) are complement transformants.

[0103] Table 6 Soybean Phytophthora PsGLS1 Gene knockout and complement transformant validation primer list

[0104]

[0105] Example 4: Soybean Phytophthora PsGLS1 Detection of mycelial growth rate, sporangium and zoospore count in gene knockout mutants and complement strains

[0106] I. Detection of mycelial growth rate

[0107] Wild-type Phytophthora soybean P6497 (WT), empty vector control (EV), and the strain obtained in Example 3 were compared. PsGLS1 Gene knockout mutant ( Δ GLS1_331 Δ GLS1_402 Δ GLS1_475) and PsGLS1 The reintroduced strain (PsGLS1-C) was inoculated in the center of a 90 mm V8 solid plate and cultured at 25°C in the dark for 5 days. The mycelial diameter was then measured using the cross-sectional method. Results are as follows: Figure 3 As shown, compared to WT, ΔPsGLS1 Knockout transformant ( Δ GLS1_331 Δ GLS1_402 Δ The colony diameter of GLS1_475 decreased, but there was no significant difference.

[0108] II. Detection of sporangium and zoospore counts

[0109] Wild-type soybean Phytophthora P6497 (WT), empty vector control (EV), and the strain obtained in Example 3 were selected. PsGLS1 Gene knockout mutant ( Δ GLS1_331 Δ GLS1_402 Δ GLS1_475) and PsGLS1The supplementary strain (PsGLS1-C) was inoculated in the center of a 90 mm V8 solid plate and then cultured in the dark at 25°C for 3 days. The mycelial cake of the tested strain was cultured in V8 medium by liquid centrifugation for 3 days. Afterwards, the medium was discarded, 20-30 mL of sterile water was added, gently mixed, and allowed to stand for 20-30 min. This washing was repeated 5 times. After the last wash, 10 mL of sterile water was added quantitatively, and the mixture was cultured in the dark at 25°C for 3 h to allow sporangia formation. Sporangia yield was calculated under a microscope (10×). After inducing a large number of sporangia, the mixture was cultured in the dark at 25°C for another 5 h, and zoospore formation was observed under a microscope. 1 mL of zoospore suspension was transferred to a 1.5 mL centrifuge tube, shaken for 1-2 min, and after zoospore resting, 10 μL of zoospore suspension was added to a hemocytometer, and the number of zoospores was observed under a microscope. Three technical replicates and three biological replicates were recorded for each strain.

[0110] The results are as follows Figures 4-6 As shown, ΔPsGLS1 Knockout transformants ( Δ GLS1_331 Δ GLS1_402 Δ The number of sporangia, zoospore production, and resting spore germination rate of GLS1_475 were significantly lower than those of the wild type, EV, and complement strains, but there was no significant difference in sporangia morphology. Sporangia production was reduced by 53.3%. Figure 4 Zoospore production decreased by 35.7% ( Figure 5 The germination rate of dormant spores decreased by 39.2%. Figure 6 The results showed that... PsGLS1 Genes play a role in the asexual spore development of Phytophthora soybeanis.

[0111] Example 5: Soybean Phytophthora PsGLS1 Statistical analysis and observation of pathogenicity results of gene knockout mutants and complement strains

[0112] Wild-type Phytophthora soybean P6497 (WT), empty vector control (EV), and the strain obtained in Example 3 were compared. PsGLS1 Gene knockout mutant ( Δ GLS1_331 Δ GLS1_402 Δ GLS1_475) and PsGLS1 The reintroduced strain (PsGLS1-C) was inoculated in the center of a 90 mm V8 solid plate and cultured in the dark at 25°C for 3 days. Then, 5 mm mycelial cakes were punched out and inoculated onto the hypocotyl of soybean yellow-flowered seedlings. After 3 days of moist, dark culture, the diameter of the lesions was measured. For the etiolated seedling variety Williams, seeds were sown in vermiculite and cultured in the dark at 25°C for 5-7 days before use.

[0113] The results are as follows Figure 7 As shown, PsGLS1 The lesion diameter of the knockout mutant was significantly smaller than that of the wild-type, EV, and complement strains. Compared with the wild-type, EV, and complement strains, the pathogenicity decreased by 55.8% after gene knockout. These results indicate... PsGLS1 Genes are involved in regulating the pathogenicity of soybean Phytophthora.

[0114] Example 6: Inhibitory effect of glucosidase inhibitor sericite on the growth of Phytophthora soybean mycelium.

[0115] Iminosugarcastanospermine is a 6-O-butyryl derivative of natural iminosugarcastanospermine. It is a transition state mimic of glycosidase GLS1 protein inhibitors. By mimicking the transition state of glycoside hydrolysis, it competitively and reversibly binds to the active site of α-glucosidase GLS1, forming multiple hydrogen bonds and hydrophobic interactions, which significantly reduces the enzyme's affinity for the substrate and thus inhibits enzyme activity.

[0116] Wild-type Phytophthora soybean P6497 (WT) was inoculated onto V8 plates and incubated in the dark at 25°C for 3 days. Mycelial discs with a diameter of 5 mm were punched along the outer edge of the colony and inoculated onto V8 plates with corresponding concentrations of the glucosidase inhibitor sericite (0, 0.25 mg / mL, 0.5 mg / mL, and 1 mg / mL). After incubation in the dark at 25°C for 5 days, the mycelial diameter was measured using the cross-crossing method. The above experiments were performed in triplicate.

[0117] The results are as follows Figure 8 As shown, the glucosidase inhibitor sericite has an inhibitory effect on mycelial growth rate. Sericite showed an inhibition rate of 25.5% against *Phytophthora sojae* at a concentration of 0.25 mg / mL, 56.4% at 0.5 mg / mL, and 72.3% at 1 mg / mL.

[0118] Example 7: The docking and binding mechanism between PsGLS1 of Phytophthora indica and the glucosidase inhibitor pterostilmine

[0119] The protein structures of candidate target proteins from the 3D structural model of *Phytophthora sojae* PsGLS1, predicted by Alphafold, were obtained from the Uniprot online website. The spermine SDF file was downloaded from PubChem and converted to PDB format using OpenBabel. AutoDock Vina 4.0 was used to preprocess *Phytophthora sojae* PsGLS1, including dehydration, hydrogenation, and Gasteiger charge calculation. Spermine was also hydrogenated, and the docking box and parameters were set. The binding strength between *Phytophthora sojae* PsGLS1 and spermine was calculated, and the docking results were visualized in PyMol.

[0120] The affinity between *Phytophthora sojae* PsGLS1 and spermine was determined using molecular docking technology. After obtaining the three-dimensional structural model of *Phytophthora sojae* PsGLS1 from the Uniprot website, molecular docking simulations were performed using AutoDock Vina. The calculation results are as follows: Figure 9 The binding free energy (ΔG) between *Phytophthora sojae* PsGLS1 and spermine was -6.5 kcal / mol, indicating a strong binding affinity. Visualization of the molecular docking revealed that the compound penetrates deep into the protein's active pocket, forming hydrophobic interactions and hydrogen bonds with amino acid residues TYR426, ARG82, ARG74, and LEU504 within the pocket.

Claims

1. The application of biomaterials related to the gene encoding the GLS1 protein shown in SEQ ID No. 1, characterized in that: The application is any one or more of the following 1)-3): 1) Application in inhibiting the production of soybean Phytophthora sporangia; 2) Application in inhibiting the production of zoospores of Phytophthora soybean; 3) Application in reducing the pathogenicity of Phytophthora in soybean; Wherein, the biological material associated with the encoded gene is any one of the following (D1-D2): D1) Nucleic acid molecules that inhibit the expression of the gene encoding the GLS1 protein; D2) Expression cassettes and recombinant vectors containing the nucleic acid molecules described in D1).

2. The application according to claim 1, characterized in that, The encoding gene is a DNA molecule with the nucleotide sequence shown in SEQ ID No. 2 of the sequence listing.

3. The application according to claim 1 or 2, wherein, This includes achieving the applications described in 1)-3) by knocking out sequences in the coding genes.

4. A method for reducing the activity of Phytophthora soybeanis, comprising the following steps: knocking out the coding gene shown in SEQ ID No. 2 of Phytophthora soybeanis, or inhibiting the activity of the GLS1 protein shown in SEQ ID No. 1; in, The reduction of the activity of Phytophthora in soybean refers to reducing the sporangium production and / or zoospore production of the Phytophthora fungus and / or its pathogenicity to the host.

Images