Rubber tree DELLA3 gene and application thereof

Abstract

The invention provides a hevea brasiliensis DELLA3 gene. A nucleotide sequence of a coding region of the hevea brasiliensis DELLA3 gene is as shown in SEQ ID NO: 1. The hevea brasiliensis HbDELLA3 gene is cloned from a hevea brasiliensis for the first time, and researches show that HbDELLA3 is subjected to induced expression after being treated by plant hormones such as methyl jasmonate, gibberellin and salicylic acid. In addition, expression is up-regulated, in particular, by treatment with hydrogen peroxide. Researches find that the HbDELLA3 and the HbbHLH48 have interaction, so that yeast normally grows in an SD / -Trp / -Leu / -His / -Ade + X-alpha-Gal plate, and the HbDELLA3 can enhance the resistance of the HbDELLA3 to osmotic stress and oxidative stress, that is, the specific gene HbDELLA3 in a rubber tree lineage can be used as the resistance of a rubber tree transcription factor HbbHLH48.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a rubber tree DELLA3 gene and its application. Background Technology

[0002] Natural rubber, derived from latex produced by rubber trees and other latex-producing plants, is primarily composed of cis-1,4-polyisoprene. It is an irreplaceable high-molecular-weight biopolymer and a crucial raw material for industries such as transportation, medicine, and defense. Latex is a secondary metabolite for rubber trees and other latex-producing plants, mainly used for defense against various types of attacks from herbivores, fungi, parasites, and viruses. The biosynthesis of natural rubber (NR) is a typical secondary metabolic process, synthesized in latex ducts via the mevalonic acid pathway. Gibberellins (GA) are a large family of tetracyclic diterpenoids derived from gibberellinic acid. Gibberellins are widely present in higher plants as endogenous growth regulators, playing a regulatory role in physiological processes such as plant growth and flower development. Both gibberellin and natural rubber biosynthesis originate from the mevalonic acid (MVA) pathway in the cytoplasm and the methylerythritol phosphate (MEP) pathway in the plastids. Studies have shown that GA3 and choline chloride (CCC), an inhibitor of gibberellin biosynthesis, both inhibit flowering in rubber trees and reduce nutrient accumulation in inflorescences and leaves.

[0003] The DELLA protein, a core negative regulator of the gibberellin signaling pathway, plays a crucial role in plant hormone signal transduction and growth and development regulation. Belonging to the GAI-RGA-and-SCR (GRAS) family, the DELLA protein exhibits highly conserved structural features. The N-terminal DELLA and TVHYNP domains are key regions for recognition and binding to the GA receptor GIBBERELLIN-INSENSITIVE DWARF1 (GID1). Mutations in these two domains affect the protein's binding energy to the gibberellin receptor GID1. The GRAS domain, located at the C-terminus, consists of two leucine repeat sequences (LHRⅠ and LHRⅡ) and three conserved sequences: VHIID, PFYRE, and SAW. The DELLA protein is a core element of the gibberellin signaling pathway, participating in the regulation of flowering and secondary metabolism. In the presence of gibberellin, its receptor GID1 binds to the DELLA protein, triggering polyubiquitination degradation mediated by the SCFSLY1 / GID2 ubiquitin E3 ligase, thus relieving growth inhibition. DELLAs interact with FLOWERING LOCUS C (FLC) and enhance the transcriptional repression capacity of FLC. DELLA proteins are plant-specific transcriptional centers that integrate environmental and endogenous signals and are negative regulators of the gibberellin response pathway in angiosperms. Therefore, research on DELLA genes in rubber trees can identify a "regulator" for transcription factor genes involved in the regulation of secondary metabolism in rubber trees. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a rubber tree HbDELLA3 gene and its application.

[0005] The first aspect of the present invention is to provide a rubber tree DELLA3 gene, the coding region of which has a nucleotide sequence as shown in SEQ ID NO:1.

[0006] A second aspect of the invention is to provide a gene-encoded protein as described in the first aspect of the invention.

[0007] A third aspect of the invention is to provide a recombinant vector, host bacterium, or expression cassette containing the gene described in the first aspect of the invention.

[0008] A fourth aspect of the invention is to provide the use of a gene as described in the first aspect of the invention, or a protein as described in the second aspect of the invention, in response to methyl jasmonate, and / or gibberellin, and / or salicylic acid, and / or hydrogen peroxide.

[0009] The fifth aspect of the present invention is to provide the use of the gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention in interacting with HbbHLH48 to enable yeast to grow normally in SD / -Trp / -Leu / -His / -Ade+X-α-Gal plates.

[0010] A sixth aspect of the invention is to provide the use of the gene as described in the first aspect of the invention, or the protein as described in the second aspect of the invention, or the recombinant vector as described in the third aspect of the invention in enhancing the resistance of HbbHLH48 to osmotic and / or oxidative stress.

[0011] A seventh aspect of the present invention is to provide a protein complex formed by the interaction of protein DELLA3 and protein HbbHLH48, wherein the nucleotide sequence encoding protein DELLA3 is shown in SEQ ID NO:1.

[0012] An eighth aspect of the present invention is to provide a gene combination related to the protein complex described in the seventh aspect of the present invention, comprising a DELLA3 gene encoding the protein DELLA3 and an HbbHLH48 gene encoding the protein HbbHLH48, wherein the nucleotide sequence of the DELLA3 gene is shown in SEQ ID NO:1.

[0013] A ninth aspect of the present invention is to provide a recombinant vector combination associated with the protein complex described in the seventh aspect of the present invention, the recombinant vector combination comprising a recombinant vector encoding a DELLA3 gene encoding the protein DELLA3 and a recombinant vector encoding a HbbHLH48 gene encoding the protein HbbHLH48, the nucleotide sequence of the DELLA3 gene being shown in SEQ ID NO:1.

[0014] The tenth aspect of the present invention is to provide a host bacterium or expression cassette containing the gene combination described in the eighth aspect of the present invention.

[0015] The eleventh aspect of the present invention is to provide the use of a protein complex as described in the seventh aspect of the present invention, or a gene combination as described in the eighth aspect of the present invention, or a recombinant vector combination as described in the ninth aspect of the present invention, or a host bacterium or expression cassette as described in the tenth aspect of the present invention in enabling yeast to grow normally in SD / -Trp / -Leu / -His / -Ade+X-α-Gal plates.

[0016] The twelfth aspect of the present invention is to provide the use of a protein complex as described in the seventh aspect of the present invention, or a gene combination as described in the eighth aspect of the present invention, or a recombinant vector combination as described in the ninth aspect of the present invention, or a host bacterium or expression cassette as described in the tenth aspect of the present invention in enhancing the yeast’s resistance to osmotic stress and / or oxidative stress.

[0017] This invention marks the first cloning of the HbDELLA3 gene from the rubber tree. Studies show that HbDELLA3 expression is induced by treatment with the plant hormones methyl jasmonate, gibberellin, and salicylic acid. Furthermore, its expression is particularly upregulated by hydrogen peroxide treatment. Research reveals an interaction between HbDELLA3 and HbbHLH48, enabling normal yeast growth in SD / -Trp / -Leu / -His / -Ade+X-α-Gal plates. HbDELLA3 enhances the resistance of HbbHLH48 to osmotic and oxidative stresses. In other words, the lineage-specific gene HbDELLA3 can act as a resistance factor to the rubber tree transcription factor HbbHLH48. Furthermore, HbDELLA3 can regulate the transcriptional activity of rubber tree transcription factors, thereby participating in the life activities of the rubber tree. Attached Figure Description

[0018] Figure 1 HbDELLA3 was induced to express after treatment with the plant hormones methyl jasmonate, gibberellin, salicylic acid, and hydrogen peroxide.

[0019] Figure 2 The results are from a yeast two-hybrid experiment. DDO represents SD / -Trp / -Leu plate medium, and DDO+X-α-Gal represents SD / -Trp / -Leu / -His / -Ade+X-α-Gal plate medium.

[0020] Figure 3 To validate the functional results of HbDELLA3 and HbbHLH48 in simulated drought and oxidative stress in yeast expression experiments. Detailed Implementation

[0021] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0022] Example 1: Cloning of the HbDELLA3 gene

[0023] 1. Total RNA was extracted from rubber tree leaves using a polysaccharide and polyphenol plant total RNA extraction kit (Beijing Tiangen Biotech Co., Ltd.) according to the instructions. cDNA was obtained by reverse transcription using a reverse transcription kit (Thermo Fisher Scientific Co., Ltd.) according to the instructions.

[0024] 2. Using cDNA as a template, primers HbDELLA3-BD-F and HbDELLA3-BD-R, which contain homologous arms and restriction enzyme sites of the pGBKT7 vector, were used as primers to obtain the CDS sequence of rubber tree HbDELLA3 by PCR amplification.

[0025] The primer sequences are as follows:

[0026] HbDELLA3-F: 5′- atggccatggaggccgaattcATGAAAAGGGAACACCCGAAT-3′

[0027] HbDELLA3-R: 5′-ccgctgcaggtcgacggatccCTGCTTGTTGGCCAGCCG-3′

[0028] Gene cloning was performed using Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novizan Biotechnology Co., Ltd.). The reaction system consisted of: 2 μL cDNA template, 2 μL primers F and R (10 μmol / L), 25 μL 2× Phanta Max Buffer, 1 μL dNTP Mix (10 mM each), 1 μL Phanta Max Super-Fidelity DNA Polymerase, and ddH2O to a final volume of 50 μL.

[0029] The PCR amplification program was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 55 °C annealing for 50 s, 72 °C extension for 2 min, for a total of 30 cycles; and a final extension at 72 °C for 10 min.

[0030] 3. After amplification of the product by 1% agarose gel electrophoresis, the target fragment was excised and purified using the FastPure Gel DNA Extraction Mini Kit (Nanjing Novizan Biotechnology Co., Ltd.). The cloned target fragment was ligated into the pGBKT7 linearized vector, which had been double-digested with EcoRI and BamHI restriction endonucleases (New England Biolabs (NEB)). The ligation was performed using the homologous recombinase ClonExpress II One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.), and the ligation was carried out in E. coli competent DH5α cells (Shanghai Tulugang Biotechnology Co., Ltd.). Colony PCR identification was performed using Taq Master Mix enzyme (Nanjing Novizan Biotechnology Co., Ltd.). Positive clones were sent to Qingke Biotechnology Co., Ltd. for sequencing. The coding region sequence of the HbDELLA3 gene was obtained as shown in SEQ ID No:1, and its cDNA sequence is 1899 bp, encoding a protein composed of 632 amino acids (SEQ ID No:2). The correctly sequenced positive clones were stored at -80℃ for later use using the cryopreservation method. The plasmid that was correctly sequenced was named HbDELLA3-BD.

[0031] Example 2: Expression analysis of HbDELLA3 in rubber tree tissue culture seedlings after treatment with different hormones and hydrogen peroxide

[0032] Spraying the leaves of rubber trees or seedlings with uniform growth with 2mM gibberellin solution, 100 μM methyl jasmonate solution, 2mM salicylic acid (SA) solution, and 2% (VV) H2O2, respectively, collected materials at 0, 0.5, 2, 6, 12, and 24 h after spraying, and used real-time quantitative PCR to detect the expression of HbDELLA3 in rubber trees or seedlings after different hormone treatments.

[0033] The following primers for quantitative real-time PCR detection were designed based on the HbDELLA3 gene sequence:

[0034] HbDELLA3-QF: 5′-TTCGCTCACTTCACTGCTAATC-3′

[0035] HbDELLA3-QR:5′-ATGGATAGTCTCTGCCAACTGA-3′

[0036] HbACTIN-F: 5′-GATGTGGATATCAGGAAGGA-3′

[0037] HbACTIN-R: 5′-CATACTGCTTGGAGCAAGA-3′

[0038] HbACTIN (GenBank accession number: HO004792) was used as an internal reference gene. Quantitative PCR was performed using a BioRad CFX-96 real-time PCR instrument. The reaction mixture consisted of 10 μL ChamQ Universal SYBR qPCR Master Mix (Vazyme), 0.4 μL HbDELLA3-QF, 0.4 μL HbDELLA3-QR, 1 μL cDNA, and 8.2 μL ddH2O. The reaction program was: 95 ℃ pre-denaturation for 30 s; 94 ℃ for 5 s, 60 ℃ for 20 s, and 72 ℃ for 20 s, for 45 cycles. After amplification, melting curves were plotted, with the temperature gradually increased from 50 ℃ to 95 ℃ at a rate of 0.2 ℃ / s. Fluorescence signals were detected throughout the process. The expression level of the HbDELLA3 gene was calculated using the formula Qt=2. -Ct（HbACTIN）-Ct（HbDELLA3） The calculation is performed, where Ct represents the number of cycles required for the fluorescence signal in each reaction tube to reach the set threshold.

[0039] Quantitative real-time PCR results showed that HbDELLA3 responded to treatment with methyl jasmonate, gibberellin, and salicylic acid. Furthermore, HbDELLA3 expression was upregulated in response to hydrogen peroxide treatment; results are shown below. Figure 1 .

[0040] Example 3: Yeast two-hybrid experiment to verify the interaction between HbDELLA3 and HbbHLH48 (GenBank ID: PQ303617)

[0041] Construction of the pGADT7-HbDELLA3 vector: Using the HbDELLA3 plasmid prepared in Example 1 as a template, and primers HbDELLA3-EcoRI-AD-F: 5′-gccatggaggccagt gaattc ATGAAAAGGGAACACCCGAAT -3′ (underlined is the EcoRI restriction site) and HbDELLA3-BamHI-AD-R: 5′- cagctcgagctcgat ggatccCTGCTTGTTGGCCAGCCG -3′ (underlined indicates BamHI restriction site) was amplified by PCR using Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novizan Biotechnology Co., Ltd.). The 50 μL reaction mixture consisted of 1 μL Phanta Max Super-Fidelity DNA Polymerase, 25 μL 2×Phanta Max Buffer, 1 μL dNTP Mix, 2 μL HbDELLA3-EcoRI-BD-F, 2 μL HbDELLA3-BamHI-BD-R, 2 μL cDNA, and 17 μL ddH2O. The reaction program was 94 ℃ for 3 min; 94 ℃ for 30 s, 58 ℃ for 50 s, 72 ℃ for 2 min, for 35 cycles; 72 ℃ for 10 min. The amplified product was obtained. pGADT7 was then digested with EcoRI and BamHI restriction endonucleases to obtain a linearized vector. The amplified product was constructed into the pGADT7 linearized vector using homologous recombination to obtain the pGADT7-HbDELLA3 vector.

[0042] Construction of the pGBKT7-HbbHLH48 vector: Using the gene plasmid with GenBank accession number PQ303617 as a template, and primers HbbHLH48-EcoRI-BD-F: 5′- atggccatggaggcc gaattc ATGGAGTCACCCGCTGGAC -3′ (underlined is the EcoRI restriction site) and HbbHLH48-BamHI-BD-R: 5′-ccgctgcaggtcgac ggatccTCATAGCTCCATTTTCAAGTGATTCG -3′ (underlined is the BamHI restriction site), PCR amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novizan Biotechnology Co., Ltd.). The 50 μL reaction mixture consisted of 1 μL Phanta Max Super-Fidelity DNA Polymerase, 25 μL 2×Phanta Max Buffer, 1 μL dNTPMix, 2 μL HbbHLH48-BamHI-BD-R, 2 μL HbbHLH48-EcoRI-BD-F, 2 μL cDNA, and 17 μL ddH2O. The reaction program was 94 ℃ for 3 min; 94 ℃ for 30 s, 58 ℃ for 50 s, 72 ℃ for 2 min, for 35 cycles; 72 ℃ for 10 min. The amplified product was obtained. pGBKT7 was double-digested with EcoRI and BamHI restriction endonucleases to obtain a linearized vector. The amplification product was then incorporated into the pGBKT7 linearized vector using homologous recombination to obtain the pGBKT7-HbbHLH48 vector.

[0043] Experimental group: pGBKT7-HbbHLH48 and pGADT7-HbDELLA3 were co-transformed into yeast strain Y2H;

[0044] Negative control group: pGADT7-T and pGBKT7-Lam were co-transformed into yeast strain Y2H;

[0045] Blank control group 1: yeast strain Y2H was co-transformed with pGBKT7 and pGADT7-HbDELLA3;

[0046] Blank control group 2: yeast strain Y2H was co-transformed with pGBKT7-HbbHLH48 and pGADT7;

[0047] Positive control group: pGADT7-T and pGBKT7-53 were co-transformed into yeast strain Y2H.

[0048] 1 μg of pGBKT7-HbbHLH48 and pGADT7-HbDELLA3 were transformed into competent yeast cells. The negative control combination pGADT7-T / pGBKT7-Lam, the blank control combinations pGBKT7 / pGADT7-HbDELLA3 and pGBKT7-HbbHLH48 / pGADT7, and the positive control combination pGADT7-T / pGBKT7-53 were also transformed into competent yeast cells. 10 μL of the transformed recombinant strain was diluted 1:10, 1:100, and 1:1000, and then spotted onto SD / -Trp / -Leu and SD / -Trp / -Leu / -His / -Ade+X-α-Gal agar plates, respectively. The plates were inverted and incubated at 30°C for 2-4 days.

[0049] See results Figure 2 The results showed that all combinations grew normally on SD / -Trp / -Leu plates; the co-transformed group pGBKT7-HbbHLH48 / pGADT7-HbDELLA3 and the positive control group pGADT7-T / pGBKT7-Lam yeast cells could all grow on SD / -Trp / -Leu / -His / -Ade+X-α-Gal plates, while the blank control group pGBKT7 / pGADT7-HbDELLA3, pGBKT7-HbbHLH48 / pGADT7, and the negative control pGADT7-T / pGBKT7-53 could not grow normally in SD / -Trp / -Leu / -His / -Ade+X-α-Gal plates, proving that HbbHLH48 and HbDELLA3 proteins directly interact and combine to form a complete complex. This complex catalyzes the conversion of x-α-gal, and therefore grows normally in SD / -Trp / -Leu / -His / -Ade+X-α-Gal plate medium.

[0050] Example 4: Yeast expression to verify the function of HbDELLA3 and HbbHLH48 in simulated drought and oxidative stress

[0051] Construction of the HbDELLA3-pYES2 vector: Using the HbDELLA3 plasmid prepared in Example 1 as a template, and primers HbDELLA3-HindIII-pYES2-F: 5′-actatagggaatatt aagctt ATGAAAAGGGAACACCCGAAT -3′ (underlined is the HindIII restriction site) and HbDELLA3-XhoI-pYES2-R: 5′-ccctctagatgcatg ctcgagCTGCTTGTTGGCCAGCCG -3′ (underlined is the XhoI restriction site) was amplified by PCR using Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novizan Biotechnology Co., Ltd.). The 50 μL reaction mixture consisted of 1 μL Phanta Max Super-Fidelity DNA Polymerase, 25 μL 2×Phanta Max Buffer, 1 μL dNTP Mix, 2 μL HbDELLA3-EcoRI-BD-F, 2 μL HbDELLA3-BamHI-BD-R, 2 μL cDNA, and 17 μL ddH2O. The reaction program was 94 ℃ for 3 min; 94 ℃ for 30 s, 58 ℃ for 50 s, 72 ℃ for 2 min, for 35 cycles; 72 ℃ for 10 min. The amplified product was obtained. The yeast expression vector pYES2 was linearized by double digestion with HindIII and XhoI restriction endonucleases. The amplification product was then incorporated into the linearized pYES2 vector using homologous recombination to obtain the HbDELLA3-pYES2 vector.

[0052] Construction of the HbbHLH48-pYES2 vector: Using the gene plasmid with GenBank accession number PQ303617 as a template, and primers HbbHLH48-HindIII-pYES2-F: 5′-actatagggaatatt aagctt ATGGAGTCACCCGCTGGAC -3′ (underlined is the HindIII restriction site) and HbbHLH48-XhoI-pYES2-R: 5′-ccctctagatgcatg ctcgagTCATAGCTCCATTTTCAAGTGATTCG -3′ (underlined is the XhoI restriction site), PCR amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novizan Biotechnology Co., Ltd.). The 50 μL reaction mixture consisted of 1 μL Phanta Max Super-Fidelity DNA Polymerase, 25 μL 2×Phanta Max Buffer, 1 μL dNTP Mix, 2 μL HbbHLH48-HindIII-pYES2-F, 2 μL HbbHLH48-XhoI-pYES2-R, 2 μL cDNA, and 17 μL ddH2O. The reaction program was 94 ℃ for 3 min; 94 ℃ for 30 s, 58 ℃ for 50 s, 72 ℃ for 2 min, 35 cycles; 72 ℃ for 10 min. The amplified product was obtained. The yeast expression vector pYES2 was linearized by double digestion with HindIII and XhoI restriction endonucleases. The amplification product was then incorporated into the linearized pYES2 vector using homologous recombination to obtain the HbbHLH48-pYES2 vector.

[0053] Experimental group 1: HbbHLH48-pYES2 transformed yeast strain INVSC1;

[0054] Experimental group 2: HbDELLA3-pYES2 transformed yeast strain INVSC1;

[0055] Experimental group 3: HbbHLH48-pYES2 and HbDELLA3-pYES2 were co-transformed into yeast strain INVSC1.

[0056] Experimental groups 1, 2, and 3 were transformed into competent yeast cells, and positive clones were selected and inoculated into liquid selective medium. Cells were collected by centrifugation and induced to express expression using liquid induction medium (SC-Ura-2% galactose). After induction, cells were collected by centrifugation and treated with 15% PEG-6000 and 3 mM H2O2 solutions for 24 h, respectively. Cells were collected by centrifugation after treatment, resuspended in sterile water, and the OD600 of the bacterial solution was precisely adjusted to 0.2 for a 10-fold serial dilution. 8 μL of each serial dilution was spotted onto SC-Ura-2% glucose agar plates. Each treatment was repeated three times. Cells were observed after incubation at 30°C for 2-3 days.

[0057] See results Figure 3The results showed that after treatment with 15% PEG and 3mM H2O2, the survival rate of yeast expressing HbDELLA4 and HbbHLH48 (experimental group 2) was higher than that of HbbHLH48 (experimental group 1) and HbDELLA3 (experimental group 2), indicating that the interaction between HbDELLA4 and HbbHLH48 significantly enhanced the yeast's resistance to osmotic stress (15% PEG6000) and oxidative stress (3mM H2O2). This suggests that HbDELLA3 can enhance the resistance of HbbHLH48 to osmotic and oxidative stress.

[0058] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A DELLA3 gene for rubber trees, characterized in that, Its coding region nucleotide sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the gene to which claim 1 pertains.

3. A recombinant vector, host bacterium, or expression cassette containing the gene of claim 1.

4. The use of the gene as described in claim 1, or the protein as described in claim 2, in response to methyl jasmonate, and / or gibberellin, and / or salicylic acid, and / or hydrogen peroxide.

5. The application of the gene as described in claim 1, or the protein as described in claim 2, or the recombinant vector as described in claim 3 in interacting with HbbHLH48 to enable normal growth of yeast in SD / -Trp / -Leu / -His / -Ade+X-α-Gal plates; or The application of the gene as described in claim 1, or the protein as described in claim 2, or the recombinant vector as described in claim 3 in enhancing the resistance of HbbHLH48 to osmotic and / or oxidative stress.

6. A protein complex, characterized in that, The protein complex is formed by the interaction of protein DELLA3 and protein HbbHLH48, and the nucleotide sequence encoding protein DELLA3 is shown in SEQ ID NO:

1.

7. A gene combination associated with the protein complex of claim 6, characterized in that, The invention comprises the DELLA3 gene encoding the protein DELLA3 and the HbbHLH48 gene encoding the protein HbbHLH48, the nucleotide sequence of which is shown in SEQ ID NO:

1.

8. A recombinant vector combination associated with the protein complex of claim 6, characterized in that, The recombinant vector combination comprises a recombinant vector encoding the DELLA3 gene of the protein DELLA3 and a recombinant vector encoding the HbbHLH48 gene of the protein HbbHLH48, the nucleotide sequence of the DELLA3 gene being shown in SEQ ID NO:

1.

9. A host bacterium or expression cassette containing the gene combination of claim 7.

10. The use of the protein complex of claim 6, or the gene combination of claim 7, or the recombinant vector combination of claim 8, or the host bacteria or expression cassette of claim 9 in enabling yeast to grow normally in SD / -Trp / -Leu / -His / -Ade+X-α-Gal plates; or The use of the protein complex of claim 6, or the gene combination of claim 7, or the recombinant vector combination of claim 8, or the host bacteria or expression cassette of claim 9 in enhancing the yeast’s resistance to osmotic stress and / or oxidative stress.

Images