Rice heading period gene OSH15 and application thereof in regulation and control of rice heading period

Abstract

The invention discloses a rice heading period gene OSH15 and application thereof in regulation and control of a rice heading period. According to the invention, the gene OSH15 is knocked out in wild type rice through research, so that transgenic rice is obtained. Compared with receptor rice, the OSH15 gene in the transgenic rice is knocked out, and the heading period of the transgenic rice is obviously delayed. Therefore, the invention lays a foundation for cultivating transgenic plants with changed heading stages.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of the rice gene OSH15 in regulating the heading stage of rice. Background Technology

[0002] Rice is one of the major food crops, with about 60% of the world's population relying on it as a staple food. Therefore, increasing rice yield is a crucial measure to ensure food security. The rice heading stage refers to the time when the panicle emerges from the leaf sheath. It marks the complete transition from vegetative to reproductive growth in rice and is closely related to the adaptability and yield of rice varieties. A heading stage that is too short is detrimental to early nutrient accumulation, leading to reduced yield. Conversely, a heading stage that is too long may result in yield losses due to adverse weather conditions such as low temperatures later in the growing season, and it is also unfavorable for subsequent crop planting. Therefore, identifying key genes regulating the rice heading stage and using bio-breeding techniques to genetically improve the heading stage of rice varieties has significant practical and social implications.

[0003] In practical production, in areas with abundant temperature and light resources, appropriately extending the heading period can enable rice to make fuller use of these resources, thereby increasing its biomass accumulation and ultimately improving rice yield. In recent years, the use of gene editing technology to modify crop functional genes and improve corresponding crop agronomic traits has become increasingly common. The OSH15 gene encodes a rice Homeobox transcription factor. Previous studies have mainly focused on its role in plant morphogenesis, but whether this gene can be used to regulate the heading period of rice has not been reported. In this invention, the OSH15 gene was knocked out using CRISPR / Cas9 gene editing technology, and it was found that this significantly delayed the heading period of rice plants. This indicates that the heading period of rice can be improved through gene editing, thereby enhancing the adaptability and yield of rice varieties. Summary of the Invention

[0004] The primary objective of this invention is to provide a gene regulating the heading period of rice, and its nucleotide sequence. The inventors discovered that knocking out the OSH15 gene in rice plants significantly delayed the heading period, thus successfully altering the heading period of the target plant.

[0005] This invention first provides the application of the OSH15 gene in regulating the heading period of rice, that is, knocking out the rice gene OSH15, thereby delaying the heading period of rice.

[0006] The OSH15 gene encodes a protein having the amino acid sequence shown in SEQ ID NO:2, or a protein having the same function after substitution and / or deletion and / or addition of one or more amino acid residues.

[0007] Specifically, the OSH15 gene has a nucleotide sequence as shown in SEQ ID No. 1; or a nucleotide sequence as shown in SEQ ID No. 3.

[0008] The present invention also provides a biological material comprising sgRNA capable of targeted knockout of the endogenous OSH15 gene in rice, comprising any one of (a) to (c): (a) an expression cassette; (b) a recombinant vector; and (c) a recombinant prokaryotic cell.

[0009] Specifically, the sgRNA sequence is shown in SEQ ID No. 4.

[0010] The recombinant vector is plasmid pCas9.

[0011] The recombinant prokaryotic cell is Agrobacterium; preferably, the Agrobacterium is EHA105.

[0012] This invention also provides a method for regulating the heading stage of rice, which involves transfecting rice with the aforementioned biological material and then screening to obtain rice with the OSH15 gene knockout mutant.

[0013] Specifically, the rice variety is japonica rice. More specifically, the rice variety is Nipponbare.

[0014] This invention demonstrates experimentally that knocking out the OSH15 gene in wild-type rice can yield transgenic rice with altered heading date. Compared to the recipient rice, the OSH15 gene knockout in transgenic rice significantly delays the heading date. Therefore, the OSH15 gene is associated with heading date, laying the foundation for breeding transgenic plants with altered heading date. This invention not only enables the breeding of related rice varieties but also has significant theoretical and practical implications for further elucidating the molecular mechanisms of plant heading date and for cultivating high-quality, high-yield crop varieties through genetic engineering. Attached Figure Description

[0015] Figure 1 The pCas9 vector map.

[0016] Figure 2 -A is a comparison of the coding sequences of the knockout sites in wild-type rice Nipponbare (WT) and OSH15 knockout rice (OSH15-cripsr-1, -2).

[0017] Figure 2 -B represents the plant morphology of wild-type rice Nipponbare (WT) and OSH15 gene knockout rice (OSH15-cripsr-1, -2).

[0018] Figure 2-C represents the heading date statistics for wild-type rice Nipponbare (WT) and OSH15 knockout rice (OSH15-cripsr-1, -2). Detailed Implementation

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0020] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0021] N6 culture medium was purchased from PhytoTechnology Laboratories, USA, catalog number C167.

[0022] The rice variety Nipponbare (Oryza sativa) has been publicly disclosed in the literature "Li Z, Wan J, Xia J, et al. Mapping of quantitative trait loci controlling physico-chemical properties of rice grains (Oryza sativa L.). Breeding science, 2003, 53(3): 209-215", and can be obtained by the public from relevant institutions and Jiangxi Agricultural University.

[0023] Agrobacterium tumefaciens EHA105 has been published in the literature “Hood, Elizabeth E; Gelvin, Stanton B; Melchers, Leo S; Hoekema, Andre. 1993. New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Research, 2(4): p. 208-218-218” and is available to the public from relevant institutions and Jiangxi Agricultural University.

[0024] The pCas9 carrier is a commercial carrier, which can be obtained by the public through commercial channels or relevant institutions, or from Jiangxi Agricultural University.

[0025] This invention knocked out the coding genes of 156 transcription factors in Nipponbare using the pCas9 vector and found that the heading date of the offspring plants was delayed after the OSH15 gene was knocked out. The phenotype of this family was caused by the knockout of the OSH15 gene, indicating that the OSH15 gene plays an important role in regulating the heading date of rice.

[0026] Below are examples of the application of the OSH15 gene in the cultivation of transgenic plants with altered heading time.

[0027] I. Construction of the gene knockout vector pCas9-OSH15

[0028] 1. Cloning the OSH15 gene nucleotide sequence

[0029] Total RNA was extracted from wild-type Nipponbare cells and reverse transcribed into cDNA. Using the cDNA as a template, PCR amplification was performed using OSH15-cds-F and OSH15-cds-R primers. The PCR reaction mixture consisted of 25 μl of 2×KOD buffer, 4 μl of dNTPs, 1 μl each of 10 μM forward and reverse primers, 1 μl of KOD enzyme, 1 μl of template (cDNA), and ultrapure water to a final volume of 50 μl. The reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 10 s, 58℃ annealing for 30 s, 68℃ extension at 1 kb / min, 35 cycles, and a final extension at 68℃ for 5 min. A 1068 bp (including the stop codon) full-length OSH15 cDNA sequence was obtained (as shown in SEQ ID No. 1). Its genomic DNA sequence is shown in SEQ ID No. 3, encoding 355 amino acids (as shown in SEQ ID No. 2).

[0030] The primers are as follows:

[0031] OSH15-cds-F: 5'- ATGGATCAGAGCTTTGGGAATCT -3'

[0032] OSH15-cds-R: 5'-TCACGAACCGAGGCGGTAC-3'.

[0033] 2. Obtaining the OSH15 gene mutant

[0034] Using CRISPR / Cas9 technology, an OSH15 mutant gene was constructed through knockout vector construction, transgenesis, and confirmation of the knockout site.

[0035] 2.1 Construction of the OSH15 knockout vector pCas9-OSH15

[0036] The OSH15 coding sequence (CDS) from bases 389 to 407 (GCTGGACGCCCGCCCTCC) was selected as the OSH15 sgRNA sequence. The pCas9 vector adapter sequences AGATGATCCGTGGCA and GTTTAGAGCTATGC were added to the left and right sides of the sgRNA sequence, respectively, to obtain the forward primer pCas9-OSH15-F (AGATGATCCGTGGCA). GCTGGACGCCCGCCCTC C GTTTTAGAGCTATGC (underlined is the forward sequence of sgRNA), and the reverse primer pCas9-OSH15-R (GCATAGCTCTAAAAC) was obtained through reverse complementation. GGAGGGCGGGCGTCCAGC TGCCACGGATCATCT (underlined is the sgRNA reverse complementary sequence). The forward primer pCas9-OSH15-F and the reverse primer pCas9-OSH15-R were annealed on a PCR instrument. The annealing system consisted of 1 μl of each of the 10 μM forward and reverse primers, with water added to make up to 10 μl. The annealing process was carried out at 95℃ for 10 min, then cooled to 15℃ at 0.1℃ / s and held for 10 min to complete the annealing, yielding the sgRNA-OSH15 fragment, ready for use.

[0037] The pCas9 vector was digested with the restriction endonuclease AarI, and the linear plasmid was recovered to obtain the large fragment of the vector. The pCas9 vector circular vector map is shown below. Figure 1 As shown. The linear plasmid and the sgRNA-OSH15 fragment were in-fusion ligated using Clontech's in-fusion enzyme (www.clontech.com, catalog number: ST0344) to obtain the recombinant plasmid, named pCas9-OSH15.

[0038] II. Obtaining pCas9-OSH15 rice

[0039] 1. Construction of recombinant bacteria

[0040] The recombinant plasmid pCas9-OSH15 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium EHA105 / pCas9-OSH15.

[0041] 2. Obtaining the OSH15 gene knockout mutant in rice

[0042] The EHA105 / pCas9-OSH15 was transferred into the callus tissue of mature embryos of rice Nipponbare (Oryza sativa) (hereinafter referred to as recipient rice). The specific steps are as follows:

[0043] (a) Recombinant Agrobacterium EHA105 / pCas9-OSH15 was cultured in suspension on liquid LB medium containing 50 μmol / L kanamycin to obtain OD. 600nm ≈ 0.5% bacterial suspension.

[0044] (ii) Take mature embryo callus from recipient rice and mix it with the bacterial suspension obtained in step (i). Infect for 30 min, blot dry the bacterial suspension with filter paper, and place the callus on co-culture medium (solid N6 medium containing 0.03924 mg / L acetylsuccinone) and culture at 24℃ for 3 days.

[0045] (iii) The callus obtained in step (ii) was inoculated onto solid N6 medium containing 150 mg / L G418 and cultured at 24°C for 16 days.

[0046] (iv) Take the healthy callus obtained in step (iii) and inoculate it onto solid N6 medium containing 200 mg / L G418. Culture at 24°C and subculture every 15 days.

[0047] (v) Take the healthy callus tissue obtained in step (iv) and inoculate it onto differentiation medium (solid N6 medium containing 150 mg / L G418, 2 mg / L kinetin and 0.05 mg / L naphthaleneacetic acid). Culture at 24°C for 45 days (at this time, the height of the above-ground part of the plant is about 15 cm). Open the bottle mouth to harden the seedlings for 3 days, and then transfer them to the greenhouse for cultivation. This is the T0 generation plant.

[0048] 3. Identification of OSH15 knockout mutants

[0049] Genomic DNA was extracted from T0 generation pCas9-OSH15 transgenic rice plants as templates, and PCR amplification was performed using OSH15-cas9-F and OSH15-cas9-R primers. The reaction system and amplification procedure were the same as those in step one, “cloning the OSH15 gene nucleotide sequence”.

[0050] The primers are as follows:

[0051] OSH15-cas9-F: 5'-GGCCGAGTCCATCAAGGCC-3';

[0052] OSH15-cas9-R: 5'-GGTGTCGAGCTGCGACTCCA-3'.

[0053] The OSH15-cas9-F and OSH15-cas9-R primer sequences correspond to positions 450-469 bp and 980-1000 bp (reverse complementary sequences) in SEQ ID NO:1, respectively. The PCR amplification product is a 551 bp DNA fragment. The amplified DNA fragment sequence is compared with the reference sequence (positions 450-1000 bp in SEQ ID NO:1). If an insertion or deletion of a base occurs in the sgRNA sequence (positions 689-706 bp in SEQ ID NO:1), and the number of inserted or deleted bases is not a multiple of 3, it indicates that a frameshift mutation has occurred in the OSH15 coding sequence of the plant genome, that is, the OSH15 gene has been successfully knocked out, proving that the plant is an OSH15 knockout mutant.

[0054] III. Heading Date Survey of OSH15 Rice Knockout Mutants

[0055] The OSH15 knockout mutant of rice (generation T0) was propagated to obtain the T1 generation plants. The T1 generation OSH15 knockout mutants were planted in Nanchang, Jiangxi Province. The heading period was investigated and photographed. The heading period refers to the number of days from sowing to when the first panicle emerges 3 cm from the leaf sheath. The results are as follows: Figure 2 As shown, WT represents wild-type rice Nipponbare, and OSH15-crispr-1 and OSH15-crispr-2 represent two OSH15 gene knockout mutant rice lines. Figure 2 -B represents the plant type of rice. Figure 2 -C represents the heading date statistics of rice materials in Nanchang. Compared with wild-type rice, the heading date of the OSH15 gene knockout mutants OSH15-crispr-1 and OSH15-crispr-2 was delayed by about 7 days. A t-test showed a significant difference in heading date between the mutants and the wild type. Figure 2 This means that the heading period of rice was successfully delayed.

Claims

1. The application of the OSH15 gene in regulating the heading stage of rice, characterized by, The application involves knocking out the rice gene OSH15, thereby delaying the heading stage of rice.

2. The application according to claim 1, characterized in that, The OSH15 gene encodes a protein having the amino acid sequence shown in SEQ ID NO:2, or a protein having the same function with substitution and / or deletion and / or addition of one or more amino acid residues.

3. The application according to claim 2, characterized in that, The OSH15 gene has a nucleotide sequence as shown in SEQ ID No. 1; or a nucleotide sequence as shown in SEQ ID No.

3.

4. A biomaterial comprising sgRNA capable of targeted knockout of the endogenous OSH15 gene in rice, characterized in that, The biomaterials include any one of (a) to (c): (a) an expression cassette; (b) a recombinant vector; (c) a recombinant prokaryotic cell.

5. The biomaterial as described in claim 4, characterized in that, The sgRNA sequence is shown in SEQ ID No.

4.

6. The biomaterial according to claim 4, characterized in that, The recombinant vector is plasmid pCas9.

7. The biomaterial according to claim 4, characterized in that, The recombinant prokaryotic cell is Agrobacterium; preferably, the Agrobacterium is EHA105.

8. A method for regulating the heading stage of rice, characterized in that, Rice was transfected with the biological material described in any one of claims 4 to 7, and rice with the OSH15 gene knockout mutant was obtained by screening.

9. The method according to claim 8, characterized in that, The rice variety mentioned is japonica rice.

10. The method according to claim 9, characterized in that, The rice variety mentioned is Nipponbare.

Images