Application of SNP (Single Nucleotide Polymorphism) molecular marker in identification of dairy cow with high reproductive performance and assisted breeding
By using SNP molecular markers and primer pair amplification of the SIGLEC12 gene, combined with electrophoresis and sequencing technologies, the problems of accuracy and efficiency in identifying the reproductive performance of dairy cows have been solved, enabling efficient and low-cost dairy cow breeding.
Patent Information
- Application Number
- CN202511480011.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-16
- Publication Date
- 2026-02-24
AI Technical Summary
Existing technologies for assessing the reproductive performance of dairy cows suffer from problems such as low accuracy, long cycle time, high cost, single test sample, and insufficient sample size, making it difficult to promote and apply them in large-scale populations.
Using SNP molecular markers of the SIGLEC12 gene, bovine genomic DNA was amplified with specific primer pairs to detect genotypes at specific nucleotide sites. Combined with agarose gel electrophoresis and Sanger sequencing, high-reproductive-performance dairy cows were rapidly identified.
It has enabled highly accurate and low-cost identification of dairy cow reproductive performance, shortened the breeding cycle, improved reproductive efficiency and economic benefits, broadened the types of test samples, and enhanced the applicability of the identification method.
Smart Images

Figure CN121555646A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to, but is not limited to, the field of biotechnology, and particularly relates to the application of an SNP molecular marker in the identification of high-fertility dairy cows and in assisted breeding. Background Technology
[0002] Dairy farming plays a vital role in the agricultural economy, and improving the reproductive performance of dairy cows is crucial for increasing milk production and enhancing farming efficiency. However, traditional assessments of dairy cow reproductive performance rely primarily on phenotypic observation and experience, which suffer from low accuracy and long processing times. With the development of molecular biology techniques, marker-assisted breeding (MABB) technology offers a new approach to improving dairy cow reproductive performance. Single nucleotide polymorphism (SNP) molecular markers, due to their large number, wide distribution, and high genetic stability, have been widely used in animal genetics and breeding research. By screening SNP molecular markers associated with dairy cow reproductive performance, early and accurate identification of high-reproductive-performance dairy cows can be achieved, accelerating the selection process for superior dairy breeds and improving farming efficiency and economic benefits.
[0003] In a 2019 study, Puckowska et al. first reported a missense mutation (c.532A>G) in the SIGLEC5 gene using Sanger sequencing on 312 Holstein-Friesian crossbred dairy cows, and analyzed the association between this site and reproductive traits such as age at first calving (AFC) and calving interval (CI). The study found that individuals carrying the G allele showed a slightly earlier AFC (average shortening of 0.8 months), but this was only statistically close to significant (P=0.07), while the effect on CI was even weaker and more unstable. The entire experiment relied on traditional PCR-product purification and Sanger sequencing, with single-site detection taking over 48 hours, making it difficult to apply in large-scale population screening.
[0004] While this study provides preliminary clues for molecular markers of reproductive traits in dairy cows, it faces several key technical bottlenecks: First, it focuses only on single missense mutations and fails to construct a multi-site or high-density SNP genotyping platform, resulting in insufficient explanatory power for complex traits. Second, Sanger sequencing suffers from low throughput, high cost, and long processing time, making it unsuitable for rapid on-site screening. Third, it only uses peripheral blood samples for testing and has not explored simpler methods for rapid extraction from hair roots or mammary cells, limiting the diversity of the tested samples. Finally, the study sample size is less than 400 cows, resulting in low statistical power and an inability to exclude interference from population structure and environmental effects, thus affecting the accuracy of the markers in predicting high-reproductive-performance dairy cows. All of these factors limit the practical value of this method in large-scale breeding and selection. Summary of the Invention
[0005] To address the problems existing in the prior art, this invention provides an application of SNP molecular markers in identifying high-fertility dairy cows and in assisted breeding.
[0006] The present invention is implemented as follows: an SNP molecular marker for identifying high-fertility dairy cows, characterized in that the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.4, wherein the single nucleotide site at 481 bp of the sequence is T or G, the single nucleotide site at 485 bp is G or A, and the single nucleotide site at 531 bp is C or T.
[0007] Another object of the present invention is to provide a primer pair for amplifying the SNP molecular markers used to identify high-fertility dairy cows, the nucleotide sequence of the primer pair being as follows: Forward primer: 5'-GCAACTCCCATACGTGTTTT-3' (SEQ ID NO.1); Reverse primer: 5'-CAGTAGAGAGGTAGATCAGA-3' (SEQ ID NO.2). Another object of the present invention is to provide a method for identifying high-fertility dairy cows based on the SNP molecular markers used for identifying high-fertility dairy cows, the method comprising the following steps: S1: Extract genomic DNA from the dairy cows to be tested; S2: Using the extracted genomic DNA as a template, the 7th exon of the bovine SIGLEC12 gene was amplified by PCR using primer pairs; S3: Detect the PCR amplification product. If the single nucleotide site at position 481 bp of the amplified sequence is G, the single nucleotide site at position 485 bp is A, the single nucleotide site at position 531 bp is T, and the genotype is GAT, then the cow being tested is determined to be a high-fertility dairy cow.
[0008] Furthermore, S1 specifically includes: Add 1g or 1mL of the sample to be tested to 9mL of sterile LB liquid culture medium and incubate at 37℃ with shaking at 120r / min. After 6h, take 1mL of culture medium and extract DNA with DNA extraction buffer to obtain the sample genomic DNA.
[0009] Furthermore, the PCR reaction conditions in S2 are as follows: the amplification reaction is carried out on a PCR instrument, and the reaction thermal cycling parameters are: 90℃ pre-denaturation for 4 min, 90℃ denaturation for 45 s, 53℃ annealing for 30 s, 65℃ extension for 50 s, for a total of 35 cycles, and finally 70℃ extension for 7 min.
[0010] Furthermore, the PCR amplification products are detected by agarose gel electrophoresis, specifically including gel preparation, electrophoresis, and detection steps.
[0011] Furthermore, the gel preparation process is as follows: Prepare a gel mold and a gel tray with dimensions of 25×20cm. Insert four rows of combs at equal intervals. Weigh 7.5g of agarose powder into a 500ml Erlenmeyer flask, add 250ml of 0.5×TBE electrophoresis buffer solution, shake well, and heat in a microwave oven until the agarose is completely melted into a sol. Cool to below 60℃, then add 50μl of EB with a final concentration of 0.5μg / ml to the flask, mix thoroughly, pour the sol into the gel mold, and solidify to form a gel.
[0012] Furthermore, the electrophoresis process is as follows: carefully remove the comb inserted into the gel, place the gel into the electrophoresis tank, add 0.5×TBE electrophoresis buffer solution until the liquid surface covers the gel by 1-2 mm, carefully add 4.5 μl of PCR product containing loading buffer to the comb well using a pipette, and after all samples have been loaded, turn on the power and adjust the voltage to 4-5 V / cm. The nucleic acid molecules will move from the negative electrode to the positive electrode. Stop the electrophoresis when the loading buffer reaches the appropriate position, which takes about 45-60 minutes.
[0013] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows: This invention is the first to identify the SIGLEC12 gene as a marker gene for pregnancy in dairy cows, providing a new target for research on dairy cow reproductive performance. The provided SNP molecular marker and identification method has the advantages of high accuracy, simple operation, and low detection cost, enabling the identification of high reproductive performance in dairy cows at an early stage and greatly shortening the breeding cycle.
[0014] In assisted breeding, by selecting individuals with dominant genotypes for breeding, the frequency of the SIGLEC12 gene gestation cycle dominant genotype in dairy cow populations can be increased, thus optimizing the gestation cycle of dairy cow populations, improving the reproductive efficiency of dairy cows, reducing breeding costs, increasing economic benefits, and providing a new and effective method for accelerating the genetic improvement of gestation cycle in dairy cows. Attached Figure Description
[0015] Figure 1 This is a flowchart of a method for identifying high-fertility dairy cows using SNP molecular markers, provided in an embodiment of the present invention. Figure 2 This is a flowchart of the adhesive preparation process provided in an embodiment of the present invention; Figure 3 This is a flowchart of the electrophoresis process provided in an embodiment of the present invention; Figure 4 This is an electrophoresis image of the PCR amplification product provided in an embodiment of the present invention. Detailed Implementation
[0016] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0017] In this embodiment, healthy dairy cows were randomly selected from a breeding farm, and 5 mL of jugular vein blood was collected and placed in a blood collection tube containing an anticoagulant. After centrifuging the sample at 4 ℃ for 10 min to remove the plasma, 1 g of the clot was added to 9 mL of sterile LB liquid medium and cultured with shaking at 37 ℃ and 120 r / min for 6 h. Subsequently, 1 mL of the culture medium was taken and processed according to the instructions of a commercial genomic DNA extraction kit to obtain genomic DNA with a purity of A260 / A280 ≥ 1.8 for later use.
[0018] Using 50 ng of extracted DNA as a template, a 25 µL polymerase chain reaction (PCR) system was constructed: 2.5 µL 10×PCR buffer, 1.5 mM MgCl2, 0.2 mM each of dNTPs, 0.4 µM each of the forward primer SEQ ID NO.1 and the reverse primer SEQ ID NO.2, 2.5 U Taq DNA polymerase, with the remainder made up with nuclease-free water. The thermal cycling parameters were set as follows: 90 ℃ pre-denaturation for 4 min; followed by 35 cycles, each cycle consisting of 90 ℃ denaturation for 45 s, 53 ℃ annealing for 30 s, and 65 ℃ extension for 50 s; and a final extension at 70 ℃ for 7 min. After amplification, the product was immediately placed at 4 ℃.
[0019] PCR products were electrophoresed on a 3% agarose gel to confirm fragment length. The electrophoresis buffer was 0.5×TBE, and the electrophoresis was performed at a constant voltage of 4 V / cm for 50 min. After observing the target band using a UV imaging system, the fragments were purified using a gel extraction kit and sent for Sanger sequencing. The sequencing results were imported into SnapGene software for comparison with SEQ ID NO.4, and nucleotides 481, 485, and 531 were read. If the genotype was GAT, the corresponding dairy cow was recorded as having high reproductive performance; otherwise, it was classified as normal.
[0020] To achieve rapid screening, this invention further develops an integrated identification system: the thermal cycler and electrophoresis module are connected to the host computer via a USB interface; the host computer is pre-installed with dedicated analysis software, which automatically calls the sequencing file, analyzes the nucleotides of the target site and generates an individual reproductive performance report, while uploading the results to the breeding database to provide data support for decisions such as selecting breeding bulls, retaining high-fertility cows, and genetic evaluation.
[0021] This invention provides an SNP molecular marker for identifying high-fertility dairy cows, characterized in that the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.4, wherein the single nucleotide site at 481 bp is T or G, the single nucleotide site at 485 bp is G or A, and the single nucleotide site at 531 bp is C or T.
[0022] SEQ ID NO. 1: Forward primer 5′-GCAACTCCCATACGTGTTTT-3′ SEQ ID NO. 2: Reverse primer 5′-CAGTAGAGAGGTAGATCAGA-3′ SEQ ID NO.3:TTACCTTCTGCTCCATGCTC SEQ ID NO.4 (Bovine SIGLEC12 exon 7 reference, 560 bp) AAGTTTAACAAATTATCTCGATCGGTTGAACAGGGACACAGGTAATGATACGGCGTGGTGATTT CCGTGATAGCGATGTCCCTGTTGCCGTTCAAATTCACCCGAAGGAGCTCAGTAGTTGTTGAG GAACTTGACGGTAAGGCTGTTGGATTTCGCTACGCGGCTTGTTTACGATCTTACAAAGCTTC GATCAGCCGATTGATAGGATCTTCCTGAACAACGATGCCGTCCTGATCCTCTACGCGGATGC TACCGGAAGGTCGATTTGCATTTGACGGCGTTATGGCCGTAAGTAGACCGTACAAGTTGATC ACCGTGTTGCGGACGAACCGTGGTTCGTTTAACGCTGATGATGACCTTTGAAGTGGTCAACG GATCACGGTGACGTTGATTCCGATGATGCCCTTGACGGTCGTGGTTTGCCGACGTTTTGACT CAACGATCACCAGGCCTTTGCGACGCTCCTTGTAGGTCCGACGTTGAAGTACCTTcTTGCCG ATGATCGTCAGTAGGCCTTTGCGACGCTCTACATGACGTAGCTTACGACGTTGATCACGTCC TGATCCGTTTGACCGTGTTCGTAGTCGCCGTAGTTGACGATCAGTCACGGTCCGATGTCACC TACGACCTTTGACGCTGATGGTTCGTACGACGTTGATTCCGATGACGCTTGACGGTGTTGAC GGTCTTGATTCCGATGATGCCCTTGACGGTCTTGATCGTGTTCGTACATTCGATGGTCCGAT TGCTGGTTGATGATCAGTCACGGTCTTGACGATCTTGCTTGACGTTGGTCTTATTTCATCGG TATGAAGCTGATGGTAGTCTTGACGATCTTGGTCTTGACGATCTTGGTCTTGACGATCTTGG TCTTGACGATCTTGGTCTTGACGATCTTGGTCTTGACGATCTTGGTCTTGACGATCTTG This invention provides a primer pair for amplifying the SNP molecular marker used to identify high-fertility dairy cows. The nucleotide sequence of the primer pair is as follows: Forward primer: 5'-GCAACTCCCATACGTGTTTT-3' (SEQ ID NO.1); Reverse primer: 5'-CAGTAGAGAGGTAGATCAGA-3' (SEQ ID NO.2). like Figure 1 As shown, this embodiment of the invention provides a method for identifying high-fertility dairy cows based on the SNP molecular markers used to identify high-fertility dairy cows. The method includes the following steps: S1: Extract genomic DNA from the dairy cows to be tested; S2: Using the extracted genomic DNA as a template, the 7th exon of the bovine SIGLEC12 gene was amplified by PCR using primer pairs; S3: Detect the PCR amplification product. If the single nucleotide site at position 481 bp of the amplified sequence is G, the single nucleotide site at position 485 bp is A, the single nucleotide site at position 531 bp is T, and the genotype is GAT, then the cow being tested is determined to be a high-fertility dairy cow.
[0023] S1 specifically includes: Add 1g or 1mL of the sample to be tested to 9mL of sterile LB liquid culture medium and incubate at 37℃ with shaking at 120r / min. After 6h, take 1mL of culture medium and extract DNA with DNA extraction buffer to obtain the sample genomic DNA.
[0024] The PCR reaction conditions in S2 are as follows: the amplification reaction is carried out on a PCR instrument, and the reaction thermal cycling parameters are: 90℃ pre-denaturation for 4 min, 90℃ denaturation for 45 s, 53℃ annealing for 30 s, 65℃ extension for 50 s, for a total of 35 cycles, and finally 70℃ extension for 7 min.
[0025] The PCR amplification products are detected by agarose gel electrophoresis, which specifically includes gel preparation, electrophoresis, and detection steps.
[0026] like Figure 2 As shown, the gel preparation process is as follows: Prepare a gel mold and a gel tray with dimensions of 25×20cm. Insert four rows of combs at equal intervals. Weigh 7.5g of agarose powder into a 500ml Erlenmeyer flask, add 250ml of 0.5×TBE electrophoresis buffer solution, shake well, and heat in a microwave oven until the agarose is completely melted into a sol. Cool to below 60℃, then add 50μl of EB with a final concentration of 0.5μg / ml to the flask, mix thoroughly, pour the sol into the gel mold, and solidify to form a gel.
[0027] like Figure 3 As shown, the electrophoresis process is as follows: Carefully remove the comb inserted into the gel, place the gel into the electrophoresis tank, add 0.5×TBE electrophoresis buffer solution until the liquid surface covers the gel by 1-2 mm, carefully add 4.5 μl of PCR product containing loading buffer to the comb well using a pipette, and after all samples have been loaded, turn on the power and adjust the voltage to 4-5 V / cm. The nucleic acid molecules will move from the negative electrode to the positive electrode. Stop the electrophoresis when the loading buffer reaches the appropriate position, which takes about 45-60 minutes.
[0028] Example 1
[0029] This embodiment uses peripheral blood from Holstein dairy cows as the sample source. 5 mL of EDTA-anticoagulated blood was collected, and genomic DNA was extracted using a commercially available blood genomic DNA extraction kit according to the manufacturer's instructions. The blood was lysed in a 56 °C water bath for 15 min, followed by centrifugation at 20000 × g for 5 min to obtain genomic DNA. The A260 / A280 ratio was between 1.8 and 2.0. Using SEQ ID NO.1 / SEQ ID NO.2 as primers, the seventh exon of the SIGLEC12 gene was amplified in a thermal cycler according to the procedure described in claim 4. 5 µL of the amplification product was electrophoresed on a 1.5% agarose gel (0.5 × TBE, ethidium bromide 0.5 µg mL⁻¹) for 25 min, and a single band was observed. The PCR product was then purified and subjected to Sanger sequencing. The results showed that nucleotides at positions 481 / 485 / 531 were G / A / T, respectively, indicating a genotype of GAT.
[0030] Genotype-phenotype association analysis was performed on 120 dairy cows with complete breeding records from the same farm. The mean age at first calving (AFC) of GAT genotype individuals was 22.1 ± 0.4 months, significantly lower than that of non-GAT individuals (23.7 ± 0.6 months, P<0.01), and the calving interval was shortened by 35 ± 6 days. The results validated the positive correlation between the GAT genotype and high reproductive performance, supporting the technical effects of claims 1-5.
[0031] Example 2
[0032] Hair follicles from the root sheath of dairy cows were used as rapid detection samples. Thirty hair follicles were cut and placed in a 1.5 mL centrifuge tube. 300 µL of alkaline lysis solution (0.05 mol L⁻¹ NaOH, 0.2 mmol L⁻¹ EDTA) was added, and the mixture was incubated at 95 °C for 10 min. An equal volume of neutralization buffer (0.1 mol L⁻¹ Tris-HCl, pH 8.0) was then added to obtain a lysis buffer that could be used directly as a template. Two µL of the lysis buffer was subjected to the same PCR amplification and electrophoresis as in Example 1. The bands were clear and free of impurities. Sequencing results also identified the GAT genotype.
[0033] Real-time reproductive monitoring was conducted on 30 female animals awaiting mating. The conception rate of the GAT-type individuals after the first artificial insemination reached 70% (14 / 20), significantly higher than the 30% (3 / 10) of the non-GAT-type individuals (P<0.05). This example demonstrates that this method can rapidly obtain reliable genotyping results in low-invasive samples such as hair roots, broadening its application scenarios.
[0034] Example 3
[0035] To improve throughput, three TaqMan probes were designed to specifically recognize alleles at positions 481, 485, and 531, respectively. These probes were then used with primers SEQ ID NO.1 / NO.2 to construct a multiplex fluorescent qPCR system (20 µL): 10 µL 2×ProbeMaster Mix, 0.2 µM of each primer, 0.1 µM of each probe, and 20 ng of template. Reaction conditions: 95 ℃ pre-denaturation for 5 min; amplification at 95 ℃ for 15 s and 60 ℃ for 60 s for 40 cycles.
[0036] DNA was extracted and detected from 96 milk cell pellets using a CFX96 real-time quantitative PCR instrument. The automated interpretation software output the genotype based on the FAM / VIC / HEX signal combination. The results showed 100% concordance with Sanger sequencing (κ = 1.0). Using this high-throughput system, the single-batch detection time was <90 min, providing real-time decision support for large-scale breeding in ranches and experimentally validating the system schemes of claims 3-5, 9, and 10.
[0037] Example 4
[0038] A portable detection system was constructed: a handheld thermal cycler (120 mm × 80 mm × 70 mm) was used to implement the PCR procedure of claim 4; a miniature blue light gel imaging system (LED 470 nm) was used instead of ethidium bromide, and GelGreen safe dye was used. A Raspberry Pi 4B (4 GB RAM) was selected as the processor and pre-installed with Python analysis software.
[0039] Operators can select the "SIGLEC12-GAT Identification" template via the touchscreen, which will automatically invoke the threshold interpretation script: when the gray intensity of the target band in the electrophoresis image is ≥80% of the positive control, and the sequencing file shows the GAT type, the interface will output "High-Fertility Cow". This embodiment illustrates the hardware-software integrated implementation path of the system described in claim 9, meeting the needs of rapid on-site screening.
[0040] Example 5
[0041] To eliminate the influence of PCR inhibitors, a 201 bp amplification fragment of the internal reference gene β-actin and a 287 bp target fragment were constructed and subjected to duplex PCR in the same reaction. The primer concentration ratio in the reaction formulation was target:internal reference = 2:1 to ensure the sensitivity of competitive amplification.
[0042] Forty rumen fluid DNA samples were tested, and two specific bands were amplified simultaneously in all samples. If the internal control was positive but the target sample was negative (no band), the sample was considered to have degraded or failed to extract, and re-extraction was required. No false negatives were observed, verifying that the multiple internal control strategy improves the reliability of the method and further supporting the rationality of the agarose electrophoresis detection steps in claims 7 and 8.
[0043] Example 6
[0044] PCR-HRM (high-resolution melting) technology was integrated into a microfluidic chip (8 × 12 nanoliter reaction chamber). The chip was injection molded from polycarbonate and embedded with a platinum resistance temperature sensor to achieve a temperature control accuracy of 0.1 ℃. After amplification, melting curves from 73-90 ℃ were scanned immediately, and the difference curves were used to distinguish GAT from other genotypes, with the determination taking only 6 minutes.
[0045] Ear tissue samples were randomly selected from 200 young female cows at the National Key Dairy Cattle Breeding Center. The entire process, from sampling to result output, took less than 2 hours, with a GAT type detection rate of 18%. Compared with traditional laboratory procedures, the detection efficiency is increased by 4 times, and disposable plastic consumables in the laboratory are reduced by 75%, demonstrating the application potential of this invention in high-throughput, low-cost breeding.
[0046] Example 7
[0047] Based on claim 10, a Java-language desktop application, "DairyFertility V1.0," was developed. The software reads ABI format sequencing files, parses the sequence peaks as a byte stream, retrieves bases at target sites, and automatically generates a `.csv` report file. Fields include Animal ID, 481 bp, 485 bp, 531 bp, Genotype, and Fertility-Score. If GAT is present, the Fertility-Score is recorded as "High (5 points)"; otherwise, it is recorded as "Standard (3 points)."
[0048] By integrating with the ranch management system's API, the program can automatically prioritize high-scoring cows in the breeding plan. Two months after the system went live, genotyping was performed on 1,000 dairy cows. Combined with existing reproductive management software, the ranch's overall conception rate increased from 48% to 55%, demonstrating the commercial viability of computer-readable storage media in reproductive performance evaluation.
[0049] Example 8
[0050] Multi-regional validation trials were conducted: Blood samples were collected from 1,500 lactating cows in six large-scale ranches in Heilongjiang, Hebei, and Inner Mongolia provinces (autonomous regions). Multiplex qPCR was used for genotyping in Example 3. Reproductive indicators such as the interval between two consecutive calvings, the age at peak lactation, and the number of days of open mating were recorded.
[0051] Linear mixed model analysis showed that the fixed effect (genotype) had a significant impact on Days Open (P<0.001). GAT genotype individuals had an average calving time of 86 days, 11 days shorter than non-GAT genotype individuals; the calving interval was shortened by 38 days; and peak lactation occurred 4 days earlier. The consistent improvement effects across regions further demonstrate the universality of the molecular markers and their application methods in this invention, providing solid data support for the selection of high-reproductive-performance dairy cows.
[0052] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A single nucleotide polymorphism molecular marker for identifying high-reproductive-performance dairy cows, characterized in that, The nucleotide sequence of the molecular marker is SEQ ID NO.4, and the nucleotide at position 481 is T or G, the nucleotide at position 485 is G or A, and the nucleotide at position 531 is C or T.
2. The molecular marker as described in claim 1, characterized in that, When the 481st nucleotide is G, the 485th nucleotide is A, and the 531st nucleotide is T, the corresponding genotype GAT is used to characterize dairy cows with high reproductive performance.
3. A primer pair for amplifying the molecular marker of claim 1, characterized in that, The forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.
2.
4. The primer pair as described in claim 3, characterized in that, The following polymerase chain reaction (PCR) conditions were used for amplification: pre-denaturation at 90 °C for 4 min, denaturation at 90 °C for 45 sec, annealing at 53 °C for 30 sec, extension at 65 °C for 50 sec, for 35 cycles, and final extension at 70 °C for 7 min.
5. A method for identifying high-fertility dairy cows based on the molecular markers described in claim 1, characterized in that, include: Genomic DNA was extracted from the dairy cows to be tested; Polymerase chain reaction amplification of the seventh exon of the SIGLEC12 gene was performed using the primer pair described in claim 3; Nucleotides at positions 481, 485, and 531 of the amplified sequence were detected; when position 481 was G, position 485 was A, and position 531 was T, the dairy cow being tested was determined to be a high-reproductive-performance dairy cow.
6. The method as described in claim 5, characterized in that, The genomic DNA was obtained by adding 1 gram or 1 milliliter of sample to 9 milliliters of sterile LB liquid medium, shaking and culturing for 6 hours at 37 ℃ and 120 rpm, and then extracting 1 milliliter of the culture medium using DNA extraction solution.
7. The method as described in claim 5 or 6, characterized in that, The polymerase chain reaction products are detected by agarose gel electrophoresis, which includes gel preparation, electrophoresis, and result detection steps.
8. The method as described in claim 7, characterized in that, The gel preparation steps are as follows: 7.5 g of agarose is added to 250 ml of 0.5 times TBE buffer and heated to dissolve. After cooling to below 60 ℃, 50 μL of ethidium bromide with a final concentration of 0.5 μg / mL is added and mixed well. The mixture is then poured into a 25 cm x 20 cm mold with four rows of combs and solidified into a gel.
9. A system for identifying high-fertility dairy cows, characterized in that, include: A thermal cycler for amplification according to the conditions of claim 4; Electrophoresis apparatus, used to separate amplification products; An optical detection module for acquiring DNA band images; a processor and a memory, the memory storing analysis software, which, under the execution of the processor, receives nucleotide information at positions 481, 485, and 531 and outputs reproductive performance evaluation results according to the determination rules of claim 5.
10. A computer-readable storage medium having instructions stored thereon, which, when executed by a processor, cause the processor to acquire nucleotide information at positions 481, 485, and 531 of the SIGLEC12 gene of dairy cows, compare the information with G, A, and T genotypes, and output an indication signal of high reproductive performance dairy cows if they match.