Establishment method and application of antitumor drug cell screening model based on TBR1 site-directed mutants

Abstract

The invention provides an anti-tumor drug cell screening model establishment method based on a TBR1 site-directed mutant and application, and belongs to the technical field of biological medicine. By analyzing data of patients with medullary blastoma (MB) in children hospital of Nanjing Medical University and clinical patients with MB in EGA database, it is found that the proportion of Group 4 subtype MB is the highest, and TBR1 mutation specifically exists in Group 4 subtype MB; a mutation spectrum of TBR1 in Group 4 subtype MB clinical patient data is analyzed, a result shows that mutation is missense mutation, mutation sites are all concentrated in a T-box structural domain of TBR1, and a TBR1-G275 site is high-frequency mutation; the method comprises the following steps: designing a site 275 of a pegRNA targeted TBR1 T-box region by using a CRISPR-Cas9-based PE (Polyethylene) technology, carrying out site-directed mutagenesis on TBR1 in a Group 4 subtype D283 cell line on a genome level, and successfully constructing the Group 4 subtype MB cell model with TBR1-G275C mutation by using a method of drug screening, monoclonal culture and final sequencing verification.

Description

Technical Field

[0001] This invention relates to a method for constructing a TBR1 gene site-directed mutation cell model and its drug application in medulloblastoma, belonging to the field of biomedical technology. Background Technology

[0002] Medulloblastoma (MB) is the most common malignant posterior fossa tumor in children, and its molecular subtyping is crucial for precision diagnosis and treatment. The 2012 international consensus classified MB into four core subtypes (WNT, SHH, Group 3, and Group 4), with Group 4 accounting for the highest proportion (35-40%). Clinically, it is predominantly male (male-to-female ratio 3:1), with a median age of diagnosis of 7-10 years and a 5-year overall survival rate of 75-80%, but approximately 40% of patients already have metastases at initial diagnosis. Molecular mechanism studies have revealed characteristic genomic abnormalities in Group 4, such as an isoarm 17q chromosome (i17q) incidence >80%, KDM6A inactivation mutations (~25%), and MYCN amplification (~15%). Single-cell sequencing further reveals that Group 4 originates from glutamatergic neuronal precursor cells in the rhombic lip of the hindbrain, and abnormal activation of its developmental and differentiation program is the core mechanism of tumorigenesis.

[0003] Transcription factors (TFs) are a class of proteins that specifically bind to DNA and regulate gene expression, playing crucial roles in cell proliferation, differentiation, and tumorigenesis. Among them, TBR1 (T-box braintranscription factor 1) is a key regulator of neural development, and its loss of function can lead to impaired neuronal migration. Research by the International Cancer Genome Consortium (ICGC) has found that approximately 5.2% of Group4-MB patients carry somatic missense mutations in TBR1 (such as p.R374C), with the mutations primarily enriched in the T-box DNA-binding domain. Clinical studies have shown that TBR1 mutations are an independent poor prognostic factor for Group4-MB, significantly reducing 5-year progression-free survival (52% vs 80%) and increasing the risk of brainstem invasion by 2.9 times. Furthermore, TBR1 mutations may affect drug response; for example, the ERBB4 inhibitor lapatinib and the CDK4 / 6 inhibitor palbociclib have shown potential efficacy in TBR1-mutant tumors.

[0004] However, the mechanisms by which TBR1 mutations promote malignant tumor phenotypes remain unclear. Domestic and international research primarily focuses on the clinical association of TBR1 mutations, lacking experimental validation of their functional mechanisms. For example, Chinese researchers did not include TBR1 mutation analysis in their Group4-MB molecular subtyping studies, while international studies, although reporting TBR1 mutation profiles, have not yet elucidated their specific roles in tumorigenesis and development. Current research on TBR1 mainly focuses on developmental aspects; whether it plays a role in the occurrence and development of MB, and its mechanism of action, remains unclear.

[0005] We constructed the TBR1-G275C mutant in D283 cells (Group4-MB model) using CRISPR-Cas9 technology and found that the mutant cells exhibited accelerated proliferation and enhanced stemness, indicating that specific TBR1 mutations may promote malignant tumor progression. This discovery provides a novel basis for developing therapeutic strategies targeting TBR1 mutations. Summary of the Invention

[0006] The purpose of this invention is to provide a method for establishing an anti-tumor drug screening model based on site-directed mutations of Group4 subtype MB TBR1, so as to solve the problems mentioned in the background art.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: A method for establishing an anti-tumor drug screening model based on site-directed mutations in Group 4 subtype MB TBR1 includes the following steps: Step 1: Integrate data from 39 medulloblastoma (MB) clinical patients from Nanjing Medical University Affiliated Children's Hospital and 491 clinical patients from the EGA database EGAS00001001953 to analyze the number and proportion of MB patients in each subtype. The results show that Group 4 subtype MB patients are the most numerous and have the highest proportion. Taking the intersection of genes with high-frequency mutations in both datasets, it was found that 21 genes have mutations in both datasets. Among them, TBR1 mutation occurs in 100% of Group 4 medulloblastoma, showing the highest specificity. Step 2: Analyze the spectrum of TBR1 mutations in clinical patients with Group 4 subtype MB and find that the TBR1-G275C mutation is the most frequent. Step 3: pegRNA was designed targeting the 275 site of the TBR1 T-box region. The Group 4 subtype tumor cell line D283 TBR1-G275C mutant cells were successfully obtained through transfection, drug screening, single-clone culture, and final sequencing verification. Step 4: Experimental methods such as CCK8, EdU, plate cloning, and tumor spheroidization were used to investigate the effect of TBR1-G275C mutation on the functional characteristics of Group 4 subtype MB D283 cells; Step 5: Perform CUT & Tag experiments to identify key downstream target genes that may regulate medulloblastoma progression by differentially binding between wild-type TBR1 and TBR1-G275C mutants.

[0008] In step 1, 39 clinical patients with myocardial infarction (MB) were from the Department of Neurosurgery, Children's Hospital Affiliated to Nanjing Medical University.

[0009] In step 3, the three pegRNA primer sequences are: sgRNATBR1-275-1F: accgAGGTTTCAAGGAGGCAAATgttttagagctagaaatagcaa; sgRNATBR1-275-1R: taacttgctatttctagctctaaaacATTTGCCTCCTTGAAACCT; sgRNATBR1-275-2F: gttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgag; s gRNATBR1-275-2R: ccgactcggtgccactttttcaagttgataacggactagccttattt; sgRNATBR1-275-3F: tcggtgcTGTCCGCTTTGCAGCAAGGA ACCCATTTGCCTCCTTGAAACtttttttttg;sgRNATBR1-275-3R:aattcaaaaaaaaaGTTTCAAGGAGGCAAATGGGTTCCTTGCTGCAAAGCGGACAgca.

[0010] The construction of the TBR1-G275C site-directed mutant cell line in step 3 specifically includes the following steps: Step 3.1: Design three pegRNA primers with sticky ends targeting the 275 site of the TBR1 T-box region, anneal the primers to double strands, and then add phosphorylation to the ends; Step 3.2. Ligate the annealed product and the CRISPR-Cas9 ACCG plasmid vector digested with EcoR1 and Bsa1 using T4 ligase. Step 3.3. Transform the ligation product into competent cells, plate them overnight, pick single clones and shake them before sequencing. Step 3.4. After plasmid extraction, the CRISPR Cas9 ACCG plasmid and PE7 plasmid were co-transformed into D283 cells. After drug screening, single-clone culture and final sequencing, the TBR1-G275C mutant D283 cell line was obtained.

[0011] The map of the CRISPR ACCG gene plasmid is attached. Figure 1 See the sequence list for the sequence.

[0012] An application for screening drugs against Group 4 subtype medulloblastoma, using the cell model to screen drugs and identify compounds that specifically act on the mutant cells.

[0013] This invention successfully constructed a TBR1-G275C mutant cell model. The outstanding effect of this invention is: (1) TBR1-G275C mutant cells were obtained using CRISPR-Cas9-based PE technology.

[0014] (2) Using the TBR1-G275C mutant cell model constructed by the method of the present invention, the functional changes of Group 4 subtype medulloblastoma cells after TBR1 mutation were studied in detail through experiments such as EdU, CCK8, plate cloning, and tumor spheroidization experiment.

[0015] (3) The TBR1-G275C mutant cell line constructed using the method of the present invention is an ideal cell model for further study of the progression of Group 4 subtype medulloblastoma. The TBR1 mutation enhances cell proliferation and stemness. This result suggests that specific mutations in the TBR1 gene (such as p.275G>C) or differentially regulated target proteins caused by such mutations can serve as targets for developing anti-Group 4 subtype medulloblastoma tumor drugs, and reveals a new use of TBR1-G275C as a prognostic indicator for Group 4 subtype medulloblastoma.

[0016] (4) Using this cell model, it was found that the TBR1-G275C mutation can significantly promote the proliferation and stemness of D283 cells. The TBR1-G275C mutant may regulate the progression of medulloblastoma by differentially binding with downstream CSF2RB, SOX2 and ABLIM3. This indicates that the TBR1-G275C mutant cell line described in this invention has the potential to become a screening model for anti-tumor drugs in Group 4 subtype MB, and suggests that this site can be applied to patient treatment diagnosis and prognostic indicators, showing good development and application prospects. Attached Figure Description

[0017] Figure 1 Illustration of the construction of CRISPR-cas9 ACCG plasmid vector.

[0018] Figure 2 The illustration shows the presence of TBR1 mutations specifically in Group 4 subtype MB, based on clinical patients and big data analysis. Figure 2 A is a graph showing the proportion of MB patients of different subtypes at Nanjing Medical University Children's Hospital; Figure 2B is a graph showing the number and percentage of MB patients in each subtype of the EGA database; Figure 2 C is a diagram illustrating the intersection of mutated genes in patients from hospitals and big data analysis. Figure 2 D is a diagram showing the number of mutations in the common mutated gene; Figure 2 E represents the percentage of mutant genes in each subtype of MB. Figure 3 This is a diagram of the TBR1 protein domains, showing the mutation sites of TBR1 in the Group 4 subtype MB.

[0019] Figure 4 A flowchart of the construction process for the TBR1-G275C mutant D283 cell model and an illustration of the sequencing verification results. Figure 4 A shows the location of the TBR1 mutation site C275G and the diagram of the mutated bases; Figure 4 B is a schematic diagram of PE technology; Figure 4 C is a diagram showing the sequencing results after the TBR1-G275C mutation.

[0020] Figure 5 The diagram illustrates the effect of TBR1-G275C mutation on the proliferation and stemness of Group 4 subtype MBD283 cells as detected by CCK8, EdU, plate cloning, and tumor spheroidization assays. Figure 5 A shows the results of the CCK8 proliferation assay, which detected changes in cell proliferation capacity. Figure 5 B shows the results of the EdU cell proliferation experiment; Figure 5 C is a graph showing the statistical results of the EdU cell proliferation experiment; Figure 5 D is a diagram showing the results of plate cloning; Figure 5 E is a graph showing the statistical results of the plate cloning experiment; Figure 5 F is a diagram showing the results of the tumor spheroidization experiment; Figure 5 G is a graph representing the statistical results of the tumor spheroidization experiment.

[0021] Figure 6 The figure shows the effect of TBR1-G275C mutation on TBR1 expression and nuclear localization in Group 4 subtype MB D283 cells, as determined by Western blotting, Real-Time PCR, and nucleocytoplasmic separation experiments. Figure 6 A shows the results of Western blotting; Figure 6 B shows the results of TBR1-WT and TBR1-G275C mRNA assays. Figure 6 C shows the results of nucleocytoplasmic separation.

[0022] Figure 7 The image shows the results of the CUT&Tag experiment, illustrating the key downstream target genes of TBR1 differential binding between TBR1-G275C mutant cells and wild-type cells. Figure 7A shows the difference in signal density in the gene transcription regions of the TBR1-WT and TBR1-G275C cell lines; Figure 7 B shows the KEGG analysis of the TBR1-WT and TBR1-G275C cell lines; Figure 7 C shows the signal distribution of C5F2AB, SOX2, and ABLIM3, downstream target genes of TBR1 in the TBR1-WT and TBR1-G275C cell lines. Detailed Implementation

[0023] The technical solution of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the protection scope of the present invention. Example 1

[0024] TBR1 mutations are specifically present in Group 4 subtype medulloblastoma. 1. Experimental Methods: This study integrates data from MB patients at Nanjing Medical University Affiliated Children's Hospital and clinical MB patients in the EGA database (EGAS00001001953) to analyze the proportion of each MB subtype. It also analyzes the high-frequency mutations in genes found in the solid tumor 825 gene testing reports of MB clinical patients at Nanjing Medical University Affiliated Children's Hospital (Beijing Genecast Technology Co., Ltd.) and the Group 4 subtype MB in the EGA database (EGAS00001001953) from next-generation sequencing (NGS) data.

[0025] 2. Experimental Results: The joint analysis of the two datasets showed that Group 4 subtype MB had the largest number of patients, with 20 out of 39 pediatric hospital MB patients ( Figure 2 A), accounting for 39.31% of 491 MB patients (EGA database) Figure 2 B). Twenty-one genes were found to have mutations in both datasets. Figure 2 C), perform mutation frequency statistics on this part of the genes ( Figure 2 D), and further analysis of the mutation rate in each subtype revealed that TBR1 mutations occurred in 100% of GROUP4 medulloblastomas, with the highest percentage ( Figure 2 E), suggesting that mutations in the transcription factor TBR1 may be involved in the development and progression of the G4 subtype of MB. Example 2

[0026] The TBR1-G275 site is frequently mutated in Group 4 subtype medulloblastoma. Experimental methods: To investigate TBR1 mutants in MB, this invention further analyzed the TBR1 mutation sites found in 209 clinical patients with Group 4 subtype MB.

[0027] Experimental results: The results showed that all TBR1 mutations found in the six Group 4 subtype MB clinical patients were missense mutations, and all mutation sites were concentrated in the T-box domain of TBR1. Figure 3 Among them, five patients had a missense mutation at position 275 of TBR1 (G275) to cysteine, and one patient had a missense mutation at position 331 of TBR1 (H331) to arginine. Figure 3 ). Example 3

[0028] A TBR1-G275C mutant cell line was constructed in the Group 4 subtype cell line D283 using CRISPR-Cas9 technology. Experimental materials: (1) Group 4 subtype medulloblastoma D283 cells (ATCC, USA); (2) EMEM complete culture medium (Vicente, China); (3) GlutaMax™ glutamine additive, sodium pyruvate solution (Gibco, USA) (4) 0.25% EDTA-trypsin (NewCysmin, China); (5) Fetal bovine serum FBS (Vicente, China); (6) Penicillin-Streptomycin-Amphotericin B (New Sami, China); (7) Conventional agarose gel DNA recovery kit (TIANGEN, China): (8) Plasmid extraction kit (Novizan, China); (9) JetPRIME (Poluplus, France); D283 cells were cultured in EMEM medium supplemented with 10% FBS, 1% penicillin-streptomycin-amphotericidal B, and 1% sodium pyruvate. The cells were incubated at 37°C in a 5% CO2 incubator. Cells in the logarithmic growth phase were used for subsequent experiments.

[0029] 2. Experimental Methods: 2.1 The PAM (NGG) sequence was located 500 bp before and after the 275 mutation site in the T-box region of the TBR1 gene sequence. The first 20 bp of the PAM sequence was inserted into the sticky end of the ACCG sequence before the gRNA scaffold of the CRISPR-cas9 ACCG plasmid vector. Then, the 5'-3' end of the bottom strand of the PAM sequence from the first 14 bp to the last 10 bp of the mutation sequence was inserted into the gRNA scaffold of the CRISPR-cas9 ACCG plasmid. Three primers with sticky ends were designed from the ACCG sequence to the last 10 bp of the gRNA scaffold and then connected together.

[0030] The PAM sequence of TBR1-G275C is GGG, and the three primer sequences with sticky end primers are: sgRNATBR1-275-1F: accgAGGTTTCAAGGAGGCAAATgttttagagctagaaatagcaa sgRNATBR1-275-1R:taacttgctatttctagctctaaaacATTTGCCTCCTTGAAACCT sgRNATBR1-275-2F:gttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgag sgRNATBR1-275-2R:ccgactcggtgccactttttcaagttgataacggactagccttattt sgRNATBR1-275-3F:tcggtgcTGTCCGCTTTGCAGCAAGGAACCCATTTGCCTCCTTGAAACtttttttttg sgRNATBR1-275-3R: aattcaaaaaaaaaGTTTCAAGGAGGCAAATGGGTTCCTTGCTGCAAAGCGGACAgca 2.2. Phosphorylate the primer ends. The system is 20 μL. Add 1 μL of T4 PNK, 2 μL of T4 PNK (10x) buffer, and 17 μL (5.66 μL of each of the three-stage annealed products). The phosphorylation program is 37 °C for 60 min and 65 °C for 5 min. 2.3. Double digestion of CRISPR-Cas9 ACCG plasmid DNA. Reaction system: EcoRI 1 μL, BsaI 1 μL, 10×HBuffer 2 μL, plasmid DNA 10 μL~12 μL ≤1 μg, sterile water 6 μL~4 μL, total volume 20 μL (sterile water added to the total volume). Reaction conditions: temperature 37℃, digestion for 1 hour 30 minutes. Agarose gel electrophoresis was used to detect the digestion results. A 1% agarose gel was prepared, and electrophoresis was performed at 100V for 25~30 min. The results were observed using a UV transilluminator. The digested plasmid was recovered from the gel. 2.4. Ligate the ligation product and the digested CRISPR-Cas9 ACCG plasmid together using T4 ligase. Add 16 μL of phosphorylated ligation product, 1 μL (80-150 ng), and 2 μL of T4 buffer (10x) to a 20 μL system and incubate overnight at 16°C. 2.5. Transform 20 μL of the ligation product into DH5α Escherichia coli, spread the bacterial culture onto LB agar plates containing ampicillin, and incubate overnight at 37°C. 2.6. Pick three single clones and add them to LB medium containing 50 mg / ml, and incubate overnight at 37°C and 220 rpm.

[0031] 2.7. After preserving the bacterial culture, the remaining bacterial culture was sent to a sequencing company for sequencing. The sequencing primers were U6 promoter forwardprimer: CGTAACTTGAAAGTATTTCGATTTCTTGGC; 2.8. After successful plasmid sequencing, extract the plasmid using a plasmid extraction kit for cell transfection. 2.9. Construction of the TBR1-G275C pool: CRISPR-Cas9 ACCG plasmid and PE7 plasmid were co-transfected into D283 cells in a 6 cm culture dish; 2.10. Forty-eight hours after cell transfection with plasmid, cells were collected by trypsin digestion. One-third of the cells were seeded into six-well plates and screened using complete culture medium containing 1 mg / ml puromycin. Another one-third of the cells were used to verify transfection efficiency. The last one-third was frozen at -80°C for later use. 2.1 After screening cells with 1 mg / ml puromycin for 48 hours, the drug was withdrawn. Once the cells were in good condition, they were digested with trypsin and collected. Using the limiting dilution method, the cells were seeded into 96-well plates at a rate of 1 cell / well for screening of single clones. 2.12. Single clone identification: After the single clones are cultured into 6-well plates, a portion of the cells are collected, genomic DNA is extracted, and sequencing is performed for identification.

[0032] 3. Experimental Results: like Figure 4As shown in the C-sequencing map, the D283 TBR1-G275C mutant cell line was successfully constructed. Example 4

[0033] The CCK8 proliferation assay was used to detect the effect of TBR1-G275C mutation on the proliferation of Group 4 subtype medulloblastoma D283 cells.

[0034] 1. Experimental materials: (1) Group 4 subtype medulloblastoma D283 cells (ATCC, USA); (2) EMEM complete culture medium (Vicente, China); (3) GlutaMax™ glutamine additive, sodium pyruvate solution (Gibco, USA) (4) 0.25% EDTA-trypsin (NewCysmin, China); (5) Fetal bovine serum FBS (Vicente, China); (6) Penicillin-Streptomycin-Amphotericin B (New Sami, China); (7) CCK8 kit (Novizan, China).

[0035] D283 cells were cultured in EMEM medium supplemented with 10% FBS, 1% penicillin-streptomycin-amphotericidal B, and 1% sodium pyruvate. The cells were incubated at 37°C in a 5% CO2 incubator. Cells in the logarithmic growth phase were used for subsequent experiments.

[0036] 2. Experimental steps: Wild-type D283 cells and TBR1-G275C mutant D283 cells were divided into 1x10 groups. 4 The wells were seeded at a density of / wells in a 96-well plate, and the absorbance at 450 nm was measured using a microplate reader at 0 h, 24 h, 48 h, 72 h, and 96 h.

[0037] 3. Experimental Results: CCK8 assays showed that the TBR1-G275C mutation could promote the proliferation of Group 4 subtype medulloblastoma D283 cells, such as Figure 5 As shown in Figure A. Example 5

[0038] EdU proliferation assay was used to detect the effect of TBR1-G275C mutant on the proliferation of Group 4 subtype medulloblastoma D283 cells.

[0039] 1. Experimental materials: (1) Group 4 subtype medulloblastoma D283 cells (ATCC, USA); (2) EMEM complete culture medium (Vicente, China); (3) GlutaMax™ glutamine additive, sodium pyruvate solution (Gibco, USA) (4) 0.25% EDTA-trypsin (NewCysmin, China); (5) Fetal bovine serum FBS (Vicente, China); (6) Penicillin-Streptomycin-Amphotericin B (New Sami, China); (7) EdU cell proliferation assay kit (Beyotime, China).

[0040] D283 cells were cultured in EMEM medium supplemented with 10% FBS, 1% penicillin-streptomycin-amphotericidal B, and 1% sodium pyruvate. The cells were incubated at 37°C in a 5% CO2 incubator. Cells in the logarithmic growth phase were used for subsequent experiments.

[0041] 2. Experimental steps: Wild-type D283 cells and TBR1-G275C mutant D283 cells were divided into 5 x 10 groups. 4 The cells were seeded at a density of / wells in a six-well plate. After adhesion, cell proliferation was analyzed using an EdU cell proliferation assay kit, and EdU insertion was observed and analyzed under a fluorescence microscope.

[0042] 3. Experimental Results: The increased proportion of EdU-labeled positive cells in TBR1-G275C mutant cells promotes the proliferation of Group 4 subtype medulloblastoma D283 cells, such as Figure 5 As shown in BC. Example 6

[0043] Plate clone assay was used to detect the effect of TBR1-G275C mutant on the clonogenic ability of Group 4 subtype medulloblastoma D283 cells.

[0044] 1. Experimental materials: (1) Group 4 subtype medulloblastoma D283 cells (ATCC, USA); (2) EMEM complete culture medium (Vicente, China); (3) GlutaMax™ glutamine additive, sodium pyruvate solution (Gibco, USA) (4) 0.25% EDTA-trypsin (NewCysmin, China); (5) Fetal bovine serum FBS (Vicente, China); (6) Penicillin-Streptomycin-Amphotericin B (New Sami, China); D283 cells were cultured in EMEM medium supplemented with 10% FBS, 1% penicillin-streptomycin-amphotericidal B, and 1% sodium pyruvate. The cells were incubated at 37°C in a 5% CO2 incubator. Cells in the logarithmic growth phase were used for subsequent experiments.

[0045] 2. Experimental steps: Wild-type D283 cells and TBR1-G275C mutant D283 cells were digested and counted separately, and 1.5 x 10⁻⁶ cells were collected. 3 The cells were seeded into P60 culture dishes and cultured at 37 ℃ and 5% CO2. The culture was terminated after 10 days.

[0046] Discard the culture medium, wash twice with PBS, fix with 4% paraformaldehyde (PFA) for 10 min, stain with crystal violet for 5 min, slowly wash away the staining solution with running water, air dry, take pictures, and observe the number of cell clones.

[0047] 3. Experimental Results: Plate colony assays showed that the number of cell clones increased and the cell colony-forming ability was significantly enhanced after TBR1-G275C mutation. Figure 5 As shown in DE. Example 7

[0048] The effect of the TBR1-G275C mutant on the stemness of Group 4 subtype medulloblastoma D283 cells was detected by tumor spheroidization assay.

[0049] 1. Experimental materials: (1) Group 4 subtype medulloblastoma D283 cells (ATCC, USA); (2) Neural culture medium (Gibco, USA); (3) GlutaMax™ glutamine additive, sodium pyruvate solution (Gibco, USA) (4) 0.25% EDTA-trypsin (NewCysmin, China); (5) Insulin-transferrin-selenium (Gibco, USA); (6) Human epidermal growth factor, human fibroblast growth factor (Gibco, USA); (7) B27 supplement (Gibco, USA); (8) D-(+)-glucose solution (Gibco, USA); (9) N-acetylcysteine ​​(Gibco, USA); (10) Ultra-low adhesion board (CORNING, USA) D283 cells were cultured in EMEM medium supplemented with 10% FBS, 1% penicillin-streptomycin-amphotericidal B, and 1% sodium pyruvate. The cells were incubated at 37°C in a 5% CO2 incubator. Cells in the logarithmic growth phase were used for subsequent experiments.

[0050] 2. Experimental steps: Wild-type D283 cells and TBR1-G275C mutant D283 cells were digested with trypsin, counted, and then suspended in spheroidizing culture medium. 8 x 10⁸ cells were collected. 3 Cells were seeded into ultra-low adhesion six-well plates and cultured for 7 days. The number of tumor spheres with a diameter greater than 75µm was then counted by photographing.

[0051] 3. Experimental Results: Tumor spheroid experiments showed that TBR1-G275C cells could promote tumor spheroid formation, such as... Figure 5 As shown in FG, TBR1-G275C increases the stemness of Group 4 subtype medulloblastoma cells. Example 8

[0052] Western blotting was used to determine the effect of TBR1-G275C mutation on the expression levels of related proteins in Group 4 subtype medulloblastoma D283 cells.

[0053] 1. Experimental materials: (1) Group 4 subtype medulloblastoma D283 cells (ATCC, USA); (2) EMEM complete culture medium (Vicente, China); (3) GlutaMax™ glutamine additive, sodium pyruvate solution (Gibco, USA) (4) 0.25% EDTA-trypsin (NewCysmin, China); (5) Fetal bovine serum FBS (Vicente, China); (6) Penicillin-Streptomycin-Amphotericin B (New Sami, China); (7) BCA protein assay kit (Thermo Fisher Scientific, USA); (8) Rabbit anti-TBR1 polyclonal antibody (Sanying Biotechnology, China); (9) Mouse anti-ACTIN polyclonal antibody (Affinity, China); (10) Horseradish peroxidase-labeled goat anti-mouse or anti-rabbit IgG (Jackson Immuno Research, USA); D283 cells were cultured in EMEM medium supplemented with 10% FBS, 1% penicillin-streptomycin-amphotericidal B, and 1% sodium pyruvate. The cells were incubated at 37°C in a 5% CO2 incubator. Cells in the logarithmic growth phase were used for subsequent experiments.

[0054] 2. Experimental steps: Wild-type D283 cells and TBR1-G275C mutant D283 cells were seeded in six-well plates, digested and collected, washed twice with PBS, and proteins were extracted with RIPA lysis buffer. Protein concentration was detected by BCA method. 5x protein loading buffer was added at a ratio of 1:4 and the plates were heated at 95°C for 5 min to completely denature the proteins.

[0055] Prepare separating gel and stacking gel according to the SDS-PAGE kit formulation, and perform electrophoretic separation at a constant voltage of 180V for 50 minutes.

[0056] The protein was transferred onto a PVDF membrane using a sandwich structure. The membrane was transferred at a constant current of 400 mA for 40 min, blocked with skim milk at room temperature for 2 h, and the primary antibody was diluted 1:1000 according to the instructions and incubated overnight at 4°C.

[0057] The next day, wash the membrane 2-3 times with TBST for 15 minutes each time, dilute the secondary antibody at a ratio of 1:5000, and incubate at room temperature for 2 hours.

[0058] The target band was exposed using ECL exposure solution, and the protein content was detected using ACTIN as an internal control.

[0059] 3. Experimental Results: The expression level of TBR1 protein decreases after the TBR1-G275C mutation, such as Figure 6 As shown in Figure A. Example 9

[0060] Real-Time PCR was used to determine the effect of TBR1-G275C mutation on the expression level of related mRNA in Group 4 subtype medulloblastoma D283 cells.

[0061] 1. Experimental materials: (1) Group 4 subtype medulloblastoma D283 cells (ATCC, USA); (2) EMEM complete culture medium (Vicente, China); (3) GlutaMax™ glutamine additive, sodium pyruvate solution (Gibco, USA) (4) 0.25% EDTA-trypsin (NewCysmin, China); (5) Fetal bovine serum FBS (Vicente, China); (6) Penicillin-Streptomycin-Amphotericin B (New Sami, China); (7) TRIzol reagent (TaKaRa Corporation, Japan); (8) HiScript II Q-RT SuperMix for qPCR (gDNA wiper) reverse transcription kit, AceQqPCR SYBR Green Master Mix real-time PCR kit (Novizan, China); D283 cells were cultured in EMEM medium supplemented with 10% FBS, 1% penicillin-streptomycin-amphotericidal B, and 1% sodium pyruvate. The cells were incubated at 37°C in a 5% CO2 incubator. Cells in the logarithmic growth phase were used for subsequent experiments.

[0062] 2. Experimental Methods: Wild-type D283 cells and TBR1-G275C mutant D283 cells were seeded in six-well plates. After trypsin digestion, the cells were collected, washed twice with PBS, and then RNA was isolated and purified by TRIzol reagent, chloroform, isopropanol, sodium acetate, and 75% ethanol (prepared with DEPC water) and its concentration was determined.

[0063] cDNA was generated by reverse transcription using the HiScript II Q-RT SuperMix for qPCR kit. The reverse transcription product was diluted 10-fold, and 1 μL was used for qPCR.

[0064] All primers used were human, and their sequences are as follows: TBR1 upstream 5′-ATGATCATCACCAAACAGGGAA-3′ Downstream 5′-ATATTGTAATGAGCCGTGGGAT-3′ ACTIN upstream 5'-CATCGAGCACGGCATCGTCA-3' Downstream 5'-TAGCACAGCCTGGATAGCAAC-3' 3. Experimental Results: TBR1 mRNA expression is reduced after the TBR1-G275C mutation, such as Figure 6 As shown in B. Example 10

[0065] The nuclear-cytoplasmic separation assay was used to determine the effect of TBR1-G275C mutation on the nuclear localization of TBR1 in Group 4 subtype medulloblastoma D283 cells.

[0066] 1. Experimental materials: (1) Group 4 subtype medulloblastoma D283 cells (ATCC, USA); (2) EMEM complete culture medium (Vicente, China); (3) GlutaMax™ glutamine additive, sodium pyruvate solution (Gibco, USA) (4) 0.25% EDTA-trypsin (NewCysmin, China); (5) Fetal bovine serum FBS (Vicente, China); (6) Penicillin-Streptomycin-Amphotericin B (New Sami, China); (7) Rabbit anti-TBR1 polyclonal antibody (Sanying Biotechnology, China); (8) Mouse anti-LAMINB1 polyclonal antibody (Sanying Biotech, China) 2. Experimental Methods: (1) Transfer the cells to 500 ml of separation buffer* and incubate on ice for 15 min.

[0067] (2) Homogenize the cell suspension 10 times or until all cells are dissolved using a 1ml syringe through a 27-gauge needle.

[0068] (3) After standing on ice for 20 min, centrifuge at 3000 rpm and 4℃ for 5 min. The precipitate after centrifugation will contain the cell nucleus, and the supernatant will contain the cytoplasm, cell membrane and mitochondria.

[0069] (4) Transfer the supernatant to a new centrifuge tube, resuspend the cell nucleus pellet in 500 ml of separation buffer, and then homogenize it 10 times through a 25-gauge needle. Centrifuge at 3000 rpm for 10 min at 4°C, discard the supernatant and retain the cell nucleus pellet.

[0070] (5) Resuspend the precipitate with RIPA lysis buffer, briefly sonicate the suspension to cut genomic DNA and homogenize the lysis buffer.

[0071] *Separation buffer: 20mM HEPES (pH=7.4), 10mM KCl, 2mM MgCl2, 1mM EDTA, 1mM EGTA. Before use, add 10ml of 1mM DTT and 200ml of 50×PI, and bring the volume to 10ml with ddH2O.

[0072] 3. Experimental Results: The TBR1-G275C mutation does not affect the nuclear localization of TBR1, such as Figure 6 As shown in C, this suggests that the TBR1-G275C mutation may promote the development of medulloblastoma by affecting other aspects. Example 11

[0073] CUT&Tag experiments were conducted to identify downstream target genes that differentially bind to WT-TBR1 in D283 cells by the TBR1-G275C mutant.

[0074] Experimental materials: (1) Group 4 subtype medulloblastoma D283 cells (ATCC, USA); (2) EMEM complete culture medium (Vicente, China); (3) GlutaMax™ glutamine additive, sodium pyruvate solution (Gibco, USA) (4) 0.25% EDTA-trypsin (NewCysmin, China); (5) Fetal bovine serum FBS (Vicente, China); (6) Penicillin-Streptomycin-Amphotericin B (New Sami, China); (7) Hyperactive Universal CUT&Tag Assay Kit for Illumina Pro (Novizan, China); (8) TruePrep DNA Library Prep Kit V2 for Illumina (Novozymes, China) Experimental methods: (1) D283 TBR1-WT and TBR1-G275C cell lines were collected at room temperature. After digestion with trypsin, the cell suspension was collected, the supernatant was discarded after centrifugation, and the cells were collected. It is estimated that 100,000 cells will be collected. (2) Take the required number of cells into a 1.5 ml EP tube, centrifuge at 2,500 rpm (600 × g) for 5 min at room temperature, and discard the supernatant.

[0075] (3) Add 500 μl Wash Buffer to resuspend the cells at room temperature, centrifuge at 2,500 rpm (600 × g) for 5 min, and discard the supernatant.

[0076] (4) Add 100 μl of Wash Buffer to each sample to resuspend the cells. (5) Transfer 100 μl of cells (nuclei) into an 8-tube containing activated ConA Beads Pro, invert and mix well, and incubate at room temperature for 10 min, inverting and mixing 2-3 times during the incubation period.

[0077] (6) Centrifuge briefly (<100 × g) to collect the reaction solution, place the 8-tube tube on a magnetic rack, and discard the supernatant after the solution becomes clear (about 2 min).

[0078] (7) Add 50 μl of pre-cooled Antibody Buffer to each sample to resuspend the cell (nucleus)-magnetic bead complex.

[0079] (8) Add the antibody to the 8-tube and mix by inverting. Centrifuge briefly to collect the liquid at the bottom of the tube (avoid centrifugation for too long, which may cause the magnetic beads to accumulate at the bottom of the tube), and place the 8-tube at 4°C overnight.

[0080] (9) Dilute the secondary antibody with Dig-wash Buffer at a certain ratio (1:100 dilution is generally recommended), 50 μl per sample. Take the 8-tube incubating with the primary antibody, briefly centrifuge to collect the reaction solution, place the 8-tube on a magnetic rack, and after the solution becomes clear (30 sec - 2 min), discard the supernatant. Add the diluted secondary antibody, invert several times to mix the antibody with the cell (nucleus)-magnetic bead complex evenly, and incubate at room temperature for 30 - 60 min.

[0081] (10) Collect the reaction solution by instantaneous centrifugation. Place the 8-tube strip on a magnetic rack and wait for the solution to clarify (30 sec - 2 min). Discard the supernatant. Add 200 μl of Dig-wash Buffer to the 8-tube strip and invert it several times to ensure that the Buffer is thoroughly mixed with the cell (nucleus)-magnetic bead complex. Repeat twice (3 times in total).

[0082] (11) Take 2 μl of pA / G-Tnp Pro and add it to 98 μl of Dig-300 Buffer to mix, with a final concentration of 0.04 μM. Use 100 µl for each sample. Take the 8-tube incubation of the secondary antibody, centrifuge briefly to collect the reaction solution, place the 8-tube on a magnetic rack, and after the solution becomes clear (30 sec - 2 min), discard the supernatant.

[0083] (12) Add 100 μl of the diluted pA / G-Tnp Pro transposon from step 1 to each sample and incubate by inverting the transposon several times to ensure that it is mixed evenly with the cell (nucleus)-magnetic bead complex. Incubate at room temperature for 1 h.

[0084] (13) Centrifuge briefly, place the 8-tube tube on a magnetic rack, and discard the supernatant after the liquid has clarified (30 sec - 2 min).

[0085] (14) Add 200 μl of Dig-300 Buffer to the 8-tube strip, invert it several times to ensure that the Buffer is thoroughly mixed with the cell (nucleus)-magnetic bead complex. Repeat the step twice (3 times in total). (15) Take 40 μl of Dig-300 Buffer, add 10 μl of 5 × TTBL, and mix well. Take the incubating 8-tube, centrifuge briefly to collect the reaction solution, place the 8-tube on a magnetic rack, and after the liquid becomes clear (30 sec - 2 min), discard the supernatant. Add 50 µl of diluted TTBL to each sample and mix well.

[0086] (16) Place the 8-tube strip in the PCR instrument and incubate at 37°C for 60 min. (Note that a heat seal is not required; the PCR instrument can be kept open.) (17) Centrifuge briefly, add 2 μl of 10% SDS and an appropriate amount of DNA Spike-in (adjust according to the abundance of the target protein in the sample and the amount of cells added) to the fragmented sample after step 4 of 08-8 / fragmentation, mix by inverting, and incubate at 55℃ for 10 min, inverting and mixing 2-3 times during the incubation period.

[0087] (18) Centrifuge briefly, place the 8-tube on a magnetic rack, let stand for about 2-3 minutes, carefully transfer the supernatant to a new 8-tube, and discard the magnetic beads.

[0088] (19) Resuspend DNA Extract Beads Pro thoroughly using a pipette. Transfer 25 μl of DNA Extract Beads Pro to a 1.5 ml centrifuge tube, add 200 μl of 1× B&W Buffer, and gently mix by pipetting. Place the tube on a magnetic rack and wait for the solution to clarify (about 2 min). Discard the supernatant. Remove the 1.5 ml centrifuge tube from the magnetic rack, add 200 μl of 1× B&W Buffer, and gently mix by pipetting.

[0089] (20) Place the 1.5 ml centrifuge tube on a magnetic rack and wait for the liquid to become clear (about 2 min). Discard the supernatant and add 50 μl of 2 × B&W Buffer to resuspend the DNA Extract Beads Pro for later use.

[0090] (21) Add 50 μl of 08-9 / DNA Extract Beads Pro (processed in step 3) to the transferred supernatant, mix thoroughly, and incubate at room temperature for 20 min, inverting and mixing 2-3 times during the incubation period. Centrifuge briefly, place the 8-tube tube on a magnetic rack, let stand for about 2-3 min, and carefully remove the supernatant.

[0091] (22) Keep the PCR tube on the magnetic rack at all times, add 200 µl of 1 × B&W Buffer, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Repeat step 22 once.

[0092] (23) Open the cap and let it air dry at room temperature for 2-5 minutes until there is no liquid residue in the tube and no reflection on the surface of the magnetic beads. Remove the above sample from the magnetic rack and add 15 μl ddH2O to resuspend the DNA Extract Beads Pro. The resuspended sample can be stored at -30 ~ -15℃ or directly used for PCR amplification.

[0093] (24) Library amplification: Prepare the following components in a sterile PCR tube: total volume 50 μl, namely DNA ExtractBeads Pro 15 μl, 2 × CAM 25 μl, N5XX 5 μl, N7XX 5 μl. Gently mix with a pipette and perform the following reaction in a PCR instrument: (25) Vortex the VAHTS DNA Clean Beads and add 100 μl to the PCR reaction product. Vortex or pipette 10 times to ensure the whole system is homogeneous. Incubate at room temperature for 5 min.

[0094] (26) Briefly centrifuge the reaction tube and place it on a magnetic rack to separate the magnetic beads and liquid. After the solution becomes clear (about 5 min), carefully remove the supernatant, being careful not to disturb the magnetic beads. Keep the PCR tube on the magnetic rack at all times, add 200 μl of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 sec, and carefully remove the supernatant.

[0095] (27) Repeat the steps for a total of two rinses.

[0096] (28) Keep the PCR tube on the magnetic rack at all times and air dry for 3-5 min with the cap off. After the magnetic beads have dried, remove the PCR tube from the magnetic rack, add 22 μl of ddH2O to elute, vortex or pipette 10 times to mix the magnetic beads thoroughly, and incubate at room temperature for 5 min. Briefly centrifuge the PCR tube, place it on the magnetic rack to separate the magnetic beads and liquid, and wait for the solution to become clear (about 5 min). Carefully transfer 20 μl of the supernatant to a new EP tube and store at -30 ~ -15℃.

[0097] (29) The obtained library was sent to Pasino for data analysis.

[0098] Experimental results: Preliminary screening identified differentially bound genes after the TBR1-G275C mutation: CSF2RB (involved in regulating the proliferation, differentiation and function of immune cells), SOX2 (regulating the differentiation and maintenance of multiple cell types during embryonic development), and ABLIM3 (formation of the cytoskeleton).

[0099] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely preferred examples and are not intended to limit the invention. Various changes and modifications can be made to the present invention without departing from its novel spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.

[0100] sequence list Nanjing Medical University A phosphorylated mutant Sufu transgenic mouse model based on homologous recombination technology and its application 2025-9-5 4989bp DNA pGL3-U6-sgRNA-PGK-puromycin-TBR1-G275C 1 ggtaccgatt agtgaacgga tctcgacggt atcgatcacg agactagcct cgagcggccg 61 cccccttcac cgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 121 ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 181 cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 241 tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 301 tgtggaaagg acgaaacacc gaggtttcaa ggaggcaaat gttttagagc tagaaatagc 361 aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgctgtc 421 cgctttgcag caaggaaccc atttgcctcc ttgaaacttt tttttgaat tctcgacctc 481 gagacaaatg gcagtattca tccacaattt taaaagaaaa ggggggattg gggggtacag 541 tgcaggggaa agaatagtag acataatagc aacagacata caaactaaag aattacaaaa 601 aaaattaca aaaattcaaa attttcgggt ttattacagg gacagcagag atccactttg 661 gccgcggctc gagggggttg gggttgcgcc ttttccaagg cagccctggg tttgcgcagg 721 gacgcggctg ctctgggcgt ggttccggga aacgcagcgg cgccgaccct gggactcgca 781 cattcttcac gtccgttcgc agcgtcaccc ggatcttcgc cgctaccctt gtgggcccccc 841 cggcgacgct tcctgctccg cccctaagtc gggaaggttc cttgcggttc gcggcgtgcc 901 961 gagcaatggc agcgcgccga ccgcgatggg ctgtggccaa tagcggctgc tcagcagggc 1021 gcgccgagag cagcggccgg gaaggggcgg tgcgggaggc ggggtgtggggcggtagtgt 1081 gggccctgtt cctgcccgcg cggtgttccg cattctgcaa gcctccggagcgcacgtcgg 1141 cagtcggctc cctcgttgac cgaatcaccg acctctctcc ccagggggatccaccggagc 1201 ttaccatgac cgagtacaag cccacggtgc gcctcgccac ccgcgacgacgtccccaggg 1261 ccgtacgcac cctcgccgcc gcgttcgccg actaccccgc cacgcgccacaccgtcgatc 1321 cggaccgcca catcgagcgg gtcaccgagc tgcaagaact cttcctcacgcgcgtcgggc 1381 tcgacatcgg caaggtgtgg gtcgcggacg acggcgccgc ggtggcggtctggaccacgc 1441 cggagagcgt cgaagcgggg gcggtgttcg ccgagatcgg cccgcgcatggccgagttga 1501 gcggttcccg gctggccgcg cagcaacaga tggaaggcct cctggcgccgcaccggccca 1561 aggagcccgc gtggttcctg gccaccgtcg gcgtctcgcc cgaccaccagggcaagggtc 1621 tgggcagcgc cgtcgtgctc cccggagtgg aggcggccga gcgcgccggggtgcccgcct 1681 tcctggaaac ctccgcgccc cgcaacctcc ccttctacga gcggctcggcttcaccgtca 1741 ccgccgacgt cgaggtgccc gaaggaccgc gcacctggtg catgacccgcaagcccggtg 1801 cctgacgccc gccccacgac ccgcagcgcc cgaccgaaag gagcgcacgaccccatgcat 1861 cggtaccttt aagaccaatg acttacaagg cagctgtaga tcttagccactttctagagt 1921 cggggcggcc ggccgcttcg agcagacatg ataagataca ttgatgagtttggacaaacc 1981 acaactagaa tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgctattgcttta 2041 tttgtaacca ttataagctg caataaacaa gttaacaaca acaattgcattcattttatg 2101 tttcaggttc agggggaggt gtgggaggtt ttttaaagca agtaaaacctctacaaatgt 2161 ggtaaaatcg ataaggatcc gtcgaccgat gcccttgaga gccttcaacccagtcagctc 2221 cttccggtgg gcgcggggca tgactatcgt cgccgcactt atgactgtcttctttatcat 2281 gcaactcgta ggacaggtgc cggcagcgct cttccgcttc ctcgctcactgactcgctgc 2341 gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggtaatacggttat 2401 ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccagcaaaaggcca 2461 ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccccctgacgagc 2521 atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggactataaagatacc 2581 aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctgccgcttaccg 2641 gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagctcacgctgta 2701 ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcacgaaccccccg 2761 ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaacccggtaagac 2821 acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcgaggtatgtag 2881 gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactagaagaacagtat 2941 ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggtagctcttgat 3001 ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcagcagattacgc 3061 gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtctgacgctcagt 3121 ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaaggatcttcacct 3181 agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatatgagtaaactt 3241 ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatctgtctatttc 3301 gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgggagggcttac 3361 catctggccc cagtgctgca atgataccgc gggacccacg ctcaccggctccagatttat 3421 cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgcaactttatccg 3481 cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcgccagttaata 3541 gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcgtcgtttggta 3601 tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcccccatgttgt 3661 gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaagttggccgcag 3721 tgttatcact catggttatg gcagcactgc ataattctct tactgtcatgccatccgtaa 3781 gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatagtgtatgcggc 3841 gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacatagcagaactt 3901 taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaaggatcttaccgc 3961 tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttcagcatctttta 4021 ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgcaaaaaagggaa 4081 taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatattattgaagca 4141 tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttagaaaaataaac 4201 aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgcgccctgtagcggcg 4261 cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacacttgccagcgccc 4321 tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgccggctttcccc 4381 gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgctttacggcacctcg 4441 accccaaaaa acttgattag ggtgatggtt cacgtagtgg gccatcgccctgatagacgg 4501 tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttgttccaaactg 4561 gaacaacact caaccctatc tcggtctatt cttttgattt ataagggattttgccgattt 4621 cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaattttaacaaaa 4681 tattaacgct tacaatttgc cattcgccat tcaggctgcg caactgttgggaagggcgat 4741 cggtgcgggc ctcttcgcta ttacgccagc ccaagctacc atgataagtaagtaatatta 4801 aggtacggga ggtacttgga gcggccgcaa taaaatatct ttattttcattacatctgtg 4861 tgttggtttt ttgtgtgaat cgatagtact aacatacgct ctccatcaaaacaaaacgaa 4921 acaaaacaaa ctagcaaaat aggctgtccc cagtgcaagt gcaggtgccagaacatttct 4981 ctatcgata

Claims

1. A method for establishing an antitumor drug screening model based on site-directed mutations in Group 4 subtype MB TBR1, characterized in that, Includes the following steps: Step 1: Integrate data from 39 medulloblastoma (MB) clinical patients from Nanjing Medical University Affiliated Children's Hospital and 491 clinical patients from the EGA database EGAS00001001953 to analyze the number and proportion of MB patients in each subtype. The results show that Group 4 subtype MB patients are the most numerous and have the highest proportion. Taking the intersection of genes with high-frequency mutations in both datasets, it was found that 21 genes have mutations in both datasets. Among them, TBR1 mutation occurs in 100% of Group 4 medulloblastoma, showing the highest specificity. Step 2: Analyze the TBR1 mutation spectrum in clinical patients with Group 4 subtype MB and find that the TBR1-G275C mutation is the most frequent. Step 3: PegRNA was designed targeting the 275 site of the TBR1 T-box region. The Group 4 subtype tumor cell line D283 TBR1-G275C mutant cells were successfully obtained through transfection, drug screening, single-clone culture, and final sequencing verification. Step 4: Experimental methods such as CCK8, EdU, plate cloning, and tumor spheroidization were used to investigate the effect of TBR1-G275C mutation on the functional characteristics of Group 4 subtype MB D283 cells; Step 5: Perform CUT & Tag experiments to identify key downstream target genes that may regulate medulloblastoma progression by differentially binding between wild-type TBR1 and TBR1-G275C mutants.

2. The method for establishing an anti-tumor drug screening model based on Group 4 subtype MB TBR1 site-directed mutation as described in claim 1, characterized in that: In step 1, 39 clinical patients with myocardial infarction (MB) were from the Department of Neurosurgery, Children's Hospital Affiliated to Nanjing Medical University.

3. The method for establishing an anti-tumor drug screening model based on Group 4 subtype MB TBR1 site-directed mutation as described in claim 1, characterized in that: In step 3, the three pegRNA primer sequences are: sgRNATBR1-275-1F: accgAGGTTTCAAGGAGGCAAATgttttagagctagaaatagcaa; sgRNATBR1-275-1R: taacttgctatttctagctctaaaacATTTGCCTCCTTGAAACCT; sgRNATBR1-275-2F: gttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgag; s gRNATBR1-275-2R: ccgactcggtgccactttttcaagttgataacggactagccttattt; sgRNATBR1-275-3F: tcggtgcTGTCCGCTTTGCAGCAAGGA ACCCATTTGCCTCCTTGAAACtttttttttg;sgRNATBR1-275-3R:aattcaaaaaaaaaGTTTCAAGGAGGCAAATGGGTTCCTTGCTGCAAAGCGGACAgca.

4. The method for establishing an anti-tumor drug screening model based on Group 4 subtype MB TBR1 site-directed mutation as described in claim 1, characterized in that: The construction of the TBR1-G275C site-directed mutant cell line in step 3 specifically includes the following steps: Step 3.1: Design three pegRNA primers with sticky ends targeting the 275 site of the TBR1 T-box region, anneal the primers to double strands, and then add phosphorylation to the ends; Step 3.

2. Ligate the annealed product and the CRISPR-Cas9 ACCG plasmid vector digested with EcoR1 and Bsa1 using T4 ligase. Step 3.

3. Transform the ligation product into competent cells, plate them overnight, pick single clones and shake them before sequencing. Step 3.

4. After plasmid extraction, the CRISPR Cas9 ACCG plasmid and PE7 plasmid were co-transformed into D283 cells. After drug screening, single-clone culture and final sequencing, the TBR1-G275C mutant D283 cell line was obtained.

5. The method for establishing an anti-tumor drug screening model based on Group 4 subtype MB TBR1 site-directed mutation as described in claim 4, characterized in that... The map of the CRISPR ACCG plasmid is shown in Figure 1, and the sequence is shown in the sequence list.

6. An application for screening drugs against Group 4 subtype medulloblastoma, characterized in that... Drug screening was performed using the cell model described in claim 3, and compounds that specifically act on the mutant cells were identified.

Images