Application of DHHB-producing microorganism in daily chemical products

Abstract

The invention discloses an application of a DHHB-producing microorganism in daily chemical products, and belongs to the field of microbial strains. According to the method disclosed by the invention, the diethylamino hydroxybenzoyl hexyl benzoate is identified in a lysate extract of a YC-1 fermentation product by applying a UPLC-Q-TOF / MS technology, and the highest yield is 8.7 mg / g after the diethylamino hydroxybenzoyl hexyl benzoate is cultured for 8 days; therefore, the invention provides a sustainable and environment-friendly method for preparing DHHB by a biological method. Meanwhile, the invention also provides an application of the fermentation product lysate extract in sunscreen fabrics, the fermentation product lysate extract containing diethylamino hydroxybenzoyl hexyl benzoate is sprayed on the surface of a fabric base material, the sunscreen capability of the sunscreen fabrics can be improved, and the preparation method of the sunscreen fabrics is widened.

Description

TECHNICAL FIELD

[0001] The application relates to application of a DHHB-producing microorganism in daily chemical products and belongs to the field of microbial strains. BACKGROUND

[0002] Diethylamino hydroxybenzoyl hexylbenzoate (DHHB or Uvinul A Plus for short) is a chemical sunscreen widely used in cosmetics, with a CAS number of 302776-68-7, a molecular formula of C 24 H 31 NO4, and a molecular weight of 397.51; as a light-stable UV-A absorber, DHHB has excellent compatibility and light stability with other sunscreens and cosmetic ingredients; when used in combination with UV-B sunscreens, DHHB can significantly improve the SPF value of sunscreen products, thereby better protecting the skin from ultraviolet damage. In the field of biological medicine, DHHB can be used as an antiviral drug, an antitumor drug and an antidepressant drug, etc.; in cosmetics, DHHB can effectively absorb ultraviolet rays and protect the skin from ultraviolet damage, thereby preventing skin tanning, sunburn and aging.

[0003] At present, the preparation method of DHHB is a chemical synthesis method; the mainstream DHHB preparation method is generally as follows: 3-N,N-diethylaminophenol is used as a starting material, acylation and esterification are carried out to obtain a reaction solution containing DHHB, then the reaction solution is purified by recrystallization, and impurities are removed by using an adsorbent or a precipitant to obtain a DHHB purified product. However, this preparation method is complex in steps; moreover, the use of adsorbents or precipitants for impurity removal will produce a large amount of waste residue; a large amount of organic solvent is consumed during recrystallization purification, a large amount of waste liquid is produced, and solvent residues in the product are increased; in addition, diethylamino hydroxybenzoyl hexylbenzoate is an organic peroxide with strong oxidizing action, and is prone to produce highly active free radicals during thermal decomposition, and is thermally unstable and may decompose at a relatively low temperature; therefore, chemical synthesis of DHHB not only needs complex operation steps, but also may pollute the environment. Therefore, it is particularly important to find a sustainable and environmentally friendly DHHB production method.

[0004] The biological method for preparing the compound has various advantages, for example, mild reaction conditions and environmental friendliness, the biological method is usually carried out at normal temperature and pressure, without extreme conditions such as high temperature or high pressure, and without the use of a large amount of organic solvent, thereby significantly reducing energy consumption and environmental pollution; for example, cost advantage, the biological method uses microorganisms as biological catalysts and does not need expensive equipment and chemical reagents, the microorganism resources are abundant and renewable, so that the raw material cost is reduced; for example, the biological method has high catalytic activity and selectivity, and a short production cycle, can efficiently synthesize complex molecular structures, and the purification process is simple and efficient.

[0005] Therefore, how to obtain a method for preparing diethylaminohydroxybenzoyl hexyl benzoate by a biological method has become a research hotspot and difficulty. SUMMARY

[0006] In order to solve the above problems, the present application screens a blastococcus strain YC-1 from Shanxi Yuncheng salt lake black mud, the bacteria have strong antioxidant, whitening, anti-ultraviolet and DHHB-producing abilities; the present application also comprehensively identifies the bacteria through physiological and biochemical analysis and phenotype characteristic analysis, so as to lay a certain foundation for developing new and efficient free radical scavengers from the perspective of microorganisms, and provide a new idea and strain resource for the development of the fields of medicines, cosmetics and health products.

[0007] The first object of the present application is to provide a blastococcus (Blastococcus atacamensis) YC-1, which is taxonomically named as Blastococcus atacamensis YC-1, and has been preserved in China Center for Type Culture Collection on January 14, 2025, with a preservation number of CCTCC NO: M 2025129.

[0008] The blastococcus (Blastococcus atacamensis) CCTCC NO: M 2025129 strain provided by the present application has the following characteristics:

[0009] (1) Colony characteristics: the colony shows bright orange-red round colony, opaque, middle protrusion, and the colony edge is neat, stable in size and shape;

[0010] (2) Morphological characteristics: gram-positive bacteria, with flagella, the strain cells are spherical, with a diameter in the range of 0.8-1.0 μm;

[0011] (3) Growth characteristics: can tolerate 0-6% salinity, the optimum salinity range is 1-4%; the optimum growth temperature is 30℃; the growth pH range is 6.0-9.0, and the optimum growth pH value is 7.0; can utilize glucose, maltose, gluconate as carbon source for growth, and cannot utilize arabinose, mannose, mannitol, N-acetyl-glucosamine, capric acid, adipic acid, malic acid, citric acid and phenylacetic acid;

[0012] (4) Physiological and biochemical characteristics: contact enzyme positive, oxidase negative, amylase negative, cellulase negative, glucose oxidation fermentation positive, indole positive, arginine dihydrolase positive, beta-glucosidase positive, protease positive, beta-galactosidase positive; belongs to aerobic bacteria;

[0013] (5) The Blastococcus atacamensis CCTCC NO: M 2025129 fermentation product lysate extract has antioxidant properties, whitening effect, DHHB production capacity, and ultraviolet resistance, and the fermentation product lysate extract is prepared by the following method:

[0014] The Blastococcus atacamensis CCTCC NO: M 2025129 fermentation broth is centrifuged to obtain the bacterial cells, ethanol is added to the bacterial cells after washing, the supernatant is collected after crushing, vacuum concentration, freeze-drying, and the Blastococcus atacamensis CCTCC NO: M 2025129 fermentation product lysate extract is obtained.

[0015] Antioxidant properties:

[0016] a. Can effectively scavenge DPPH free radicals, ABTS cationic free radicals and hydroxyl radicals, and has strong antioxidant capacity: when the concentration of the Blastococcus atacamensis CCTCC NO: M 2025129 fermentation product lysate extract is higher than 13 mg / mL, the DPPH free radical scavenging rate is more than 90%; when the concentration of the Blastococcus atacamensis CCTCC NO: M 2025129 fermentation product lysate extract is higher than 13 mg / mL, the ABTS cationic free radical scavenging rate is more than 80%;

[0017] Preferably, when the concentration of the fermentation product lysate extract is 26 mg / mL, the ABTS cationic free radical scavenging rate is more than 97%; and when the concentration of the intracellular extract of anhydrous ethanol is 9.5 mg / mL, the hydroxyl radical scavenging rate is 72.23%.

[0018] b. Has iron ion reducing capacity, and when the concentration of the Blastococcus atacamensis CCTCC NO: M 2025129 fermentation product lysate extract is 50 mg / mL, the FRAP value is 1.20 mmol / L.

[0019] Whitening effect:

[0020] The Blastococcus atacamensis CCTCC NO: M 2025129 has the ability to inhibit the activity of tyrosinase, and when the concentration of the extract of the fermentation product lysate is 7.1 mg / mL, the inhibition rate of the extract on tyrosinase is 40.69%.

[0021] The Blastococcus atacamensis CCTCC NO: M 2025129 has the ability to produce DHHB.

[0022] Anti-ultraviolet performance:

[0023] The extract of the fermentation product lysate of the Blastococcus atacamensis CCTCC NO: M 2025129 is applied to sunscreen, and the anti-ultraviolet performance of the sunscreen is determined by measuring the sun protection factor (SPF) value and the UVAPF value of the sunscreen. The test results of the sunscreen S1 (blank control, model group) and S2 (3% YC-1FLE added) samples show that the SPF value of the sunscreen S1 is 8.62, while the SPF value of S2 reaches 9.48, which is increased by 10%, and the data has a significant difference (**p<0.01).

[0024] A second object of the present application is to provide an application of the Blastococcus atacamensis YC-1 in the preparation of diethylaminohydroybenzoyl hexyl benzoate or a product containing diethylaminohydroybenzoyl hexyl benzoate.

[0025] In an embodiment of the present application, the application is to ferment diethylaminohydroybenzoyl hexyl benzoate by using the Blastococcus atacamensis CCTCC NO: M 2025129 or a microbial inoculant containing the Blastococcus atacamensis CCTCC NO: M 2025129;

[0026] Preferably, the product includes, but is not limited to, cosmetics, sunscreen fabrics, and daily chemical products.

[0027] In an embodiment of the present application, the application is to centrifuge the supernatant after the fermentation liquid of the Blastococcus atacamensis CCTCC NO: M 2025129, wash the bacterial body precipitate with PBS buffer, and centrifuge to remove the liquid phase to obtain the precipitate.

[0028] The obtained precipitate is added to anhydrous ethanol according to a liquid-solid ratio of 2:1-15:1 (g / L), ultrasonically broken, centrifuged to collect the supernatant, and the supernatant is the fermentation product lysate extract ethanol extract; and the bacterial body precipitate obtained after centrifugation is repeatedly extracted according to the above method, all the fermentation product lysate extract ethanol extracts obtained are combined, reduced pressure concentrated, and freeze-dried to obtain the Blastococcus YC-1 fermentation product lysate extract.

[0029] Preferably, the preparation method of the Blastococcus atacamensis CCTCC NO: M 2025129 fermentation broth is as follows: inoculating the Blastococcus atacamensis CCTCC NO: M 2025129 into a culture medium, culturing in a shaking incubator at 30-35°C and a rotation speed of 200-250 rpm for 4-5 days, then inoculating on a solid culture medium, culturing at 30-35°C and a humidity of 60-70% for 4-5 days, picking a single colony and inoculating into a culture medium, culturing in a shaking incubator at 30-35°C and a rotation speed of 200-250 rpm for 4-5 days, and obtaining a crude salt seed liquid.

[0030] Inoculating the crude salt seed liquid into a fermentation medium at a ratio of 10%-15% (v / v), culturing at 30-35°C and a humidity of 60-70% for 4-5 days, and obtaining the fermentation broth.

[0031] In an embodiment of the present application, the cosmetic can be formulated in the form of a solution, an external ointment, a cream foam, a nourishing skin agent, a soft skin agent, a filler, a soft water, a milky lotion, a cosmetic base, a perfume, a soap, a liquid cleanser, a bath agent, a sunscreen cream, a sunscreen oil, a suspension, a lotion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a foundation, a lotion foundation, a wax foundation, a patch, and a spray.

[0032] In an embodiment of the present application, the cosmetic further comprises at least one cosmetically acceptable carrier.

[0033] In an embodiment of the present application, the carrier can be an oil, water, a surfactant, a humectant, a lower alcohol, a thickening agent, a chelating agent, a pigment, a preservative, and a perfume.

[0034] In an embodiment of the present application, the microbial agent contains the Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application.

[0035] In an embodiment of the present application, the microbial agent contains the Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application.

[0036] In an embodiment of the present application, the number of viable cells of the Blastococcus atacamensis CCTCC NO: M 2025129 strain in the microbial agent is 10 7 ~ 10 9 CFU / mL.

[0037] In an embodiment of the present application, the concentration of the Blastococcus atacamensis CCTCC NO: M 2025129 strain in the bacterial agent is in the range of 10 7 ~ 10 9 CFU / mL.

[0038] In an embodiment of the present application, the bacterial agent is a seed liquid of the Blastococcus atacamensis CCTCC NO: M 2025129 strain, which is then expanded to obtain.

[0039] In an embodiment of the present application, the bacterial agent contains live cells of the Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application, dry cells of the Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application obtained by freeze-drying, immobilized cells of the Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application, fermentation broth of the Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application or its lysate, or a liquid bacterial agent containing the Blastococcus atacamensis CCTCC NO: M 2025129 strain, a solid bacterial agent of the Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application, or the Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application in any other form.

[0040] In an embodiment of the present application, the bacterial agent further contains other auxiliary materials.

[0041] In an embodiment of the present application, the bacterial agent is a microbial preparation that can effectively remove DPPH·, ·OH, ABTS + · free radicals, has reducing power, and has strong antioxidant capacity.

[0042] In an embodiment of the present application, the sunscreen fabric is obtained by spraying a fermentation product lysate extract containing oxybenzone on the surface of a fabric substrate or by immersing the fabric substrate in a solution of the fermentation product lysate extract.

[0043] A third object of the present application is to provide a product composition with antioxidant efficacy, a preparation method of the product composition comprising: adding the cell mass and / or metabolites of the Blastococcus atacamensis CCTCC NO: M 2025129 strain to a product matrix to obtain the product composition. Preferably, the antioxidant efficacy is the ability to scavenge free radicals or the ability to reduce iron ions; further, the free radicals are at least one of DPPH·, ·OH, ABTS + ·.

[0044] A fourth object of the present application is to provide the use of the Blastococcus atacamensis CCTCC NO: M 2025129 strain, the microbial inoculant containing the Blastococcus atacamensis CCTCC NO: M 2025129 strain, or the product composition in the preparation of a product with the ability to scavenge free radicals or antioxidant function.

[0045] In an embodiment of the present application, the product includes, but is not limited to, a pharmaceutical product, a health product, a cosmetic product, or a functional food.

[0046] In an embodiment of the present application, the pharmaceutical product further contains a pharmaceutically acceptable excipient, which includes, but is not limited to, at least one of a diluent, an excipient, a filler, a binder, a humectant, a disintegrant, an emulsifier, a cosolvent, a solubilizer, an osmotic pressure regulator, a surfactant, a coating material, a coloring agent, a pH regulator, an antioxidant, a bacteriostatic agent, or a buffer.

[0047] In an embodiment of the present application, the pharmaceutical product further contains other pharmaceutical ingredients with antioxidant ability.

[0048] In an embodiment of the present application, the pharmaceutical product includes, but is not limited to, an injection, an oral liquid, a tablet, a capsule, a dripping pill, a spray.

[0049] In an embodiment of the present application, the administration mode includes, but is not limited to, subcutaneous injection, intravenous injection, oral administration, smearing, respiratory inhalation administration, topical administration, sublingual administration.

[0050] In an embodiment of the present application, the dosage form of the cosmetic product can be formulated in the form of a solution, an external ointment, a cream foam, a nutrient skin agent, a soft skin agent, a filler, a soft water, a milky lotion, a cosmetic base, a fragrance, a soap, a liquid cleanser, a bath agent, a sunscreen cream, a sunscreen oil, a suspension, a lotion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a foundation, a lotion foundation, a wax foundation, a patch, and a spray.

[0051] In one embodiment of the present application, the cosmetic further comprises at least one cosmetically acceptable carrier.

[0052] In one embodiment of the present application, the carrier can be oil, water, surfactant, humectant, lower alcohol, thickening agent, chelating agent, pigment, preservative, fragrance.

[0053] The sixth object of the present application is to provide a method for producing DHHB (diethylaminohydroyberzoic acid hexyl ester), which utilizes Blastococcus atacamensis CCTCC NO: M 2025129 strain or a microbial inoculum containing the same to produce a fermentation product lysate extract containing DHHB (diethylaminohydroyberzoic acid hexyl ester).

[0054] In one embodiment of the present application, the method is to ferment Blastococcus atacamensis CCTCC NO: M 2025129 or a microbial inoculum containing the same to prepare a fermentation broth, centrifuge the prepared fermentation broth to collect bacterial cells, break the collected bacterial cells, and then extract with ethanol to obtain a fermentation product lysate extract containing diethylaminohydroyberzoic acid hexyl ester.

[0055] The seventh object of the present application is to provide a method for preparing a cosmetic or a sunscreen fabric, which comprises the following steps:

[0056] (1) fermenting Blastococcus atacamensis CCTCC NO: M 2025129 or a microbial inoculum containing the same to prepare a fermentation broth, centrifuging the prepared fermentation broth to collect bacterial cells, breaking the collected bacterial cells, and then extracting with ethanol to obtain a fermentation product lysate extract containing diethylaminohydroyberzoic acid hexyl ester;

[0057] (2) adding the diethylaminohydroyberzoic acid hexyl ester-containing fermentation product lysate extract prepared in step (1) to the preparation process of a cosmetic to prepare a diethylaminohydroyberzoic acid-containing cosmetic;

[0058] or step (2) is to spray the diethylaminohydroyberzoic acid hexyl ester-containing fermentation product lysate extract on the surface of a fabric substrate, or to soak the fabric substrate in the fermentation product lysate extract solution to obtain a sunscreen fabric.

[0059] In an embodiment of the present application, the cosmetic product comprises the fermentation product lysate extract of the Blastococcus atacamensis CCTCC NO: M 2025129 strain or the product composition described above.

[0060] In an embodiment of the present application, the cosmetic product is a skin care product.

[0061] In an embodiment of the present application, the dosage form of the cosmetic product can be formulated in the form of a solution, an external ointment, a cream foam, a nutrient skin moisturizer, a soft skin moisturizer, a filler, a soft water, a milky lotion, a cosmetic base, a perfume, a soap, a liquid cleanser, a body wash, a sunscreen cream, a sunscreen oil, a suspension, a lotion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a foundation, a lotion foundation, a wax foundation, a patch, and a spray.

[0062] In an embodiment of the present application, the cosmetic product further comprises at least one cosmetically acceptable carrier.

[0063] In an embodiment of the present application, the carrier can be an oil, water, a surfactant, a humectant, a lower alcohol, a thickening agent, a chelating agent, a pigment, a preservative, a fragrance.

[0064] The present application also provides the cosmetic product prepared by the preparation method described above.

[0065] The present application also provides the use of the Blastococcus CCTCC NO: M 2025129 in improving the ultraviolet resistance of sunscreen cream or fabric, which comprises the following steps: fermenting the Blastococcus CCTCC NO: M 2025129 or a microbial inoculum containing the Blastococcus CCTCC NO: M 2025129 to obtain a fermentation broth; centrifuging the obtained fermentation broth to collect the bacterial cells, crushing the collected bacterial cells, and then extracting the crushed bacterial cells with ethanol to obtain a fermentation product lysate extract; adding the obtained fermentation product lysate extract to the sunscreen cream, or spraying the fermentation product lysate extract containing diethylamino hydroxybenzoyl hexyl benzoate on the surface of a fabric substrate, or soaking the fabric substrate in the fermentation product lysate extract solution to obtain a fabric.

[0066] Beneficial effects

[0067] (1) The Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application has the ability to produce DHHB. The present application uses UPLC-Q-TOF / MS technology to identify DHHB (diethylamino hydroxybenzoyl hexyl benzoate) in the fermently sate extract (FLE) of YC-1 fermentation product lysate, and the yield is the highest at 8.7 mg / g when cultured for 8 days, which is the first time to find DHHB in halophilic bacteria.

[0068] (2) The Blastococcus atacamensis CCTCC NO: M 2025129 strain of the present application has strong reduction ability and high free radical scavenging ability, can efficiently scavenge DPPH free radicals, ABTS cationic free radicals and hydroxyl radicals, shows strong antioxidant performance, and has certain tyrosinase inhibitory ability and strong anti-ultraviolet ability.

[0069] Biological material preservation:

[0070] The Blastococcus atacamensis YC-1 is taxonomically named as Blastococcus atacamensis YC-1, and the strain has been preserved in China Center for Type Culture Collection on January 14, 2025, with a preservation number of CCTCC NO: M 2025129 and a preservation address of Wuhan University, Wuhan, China. BRIEF DESCRIPTION OF DRAWINGS

[0071] Figure 1 It is a colony morphology diagram of Blastococcus atacamensis YC-1.

[0072] Figure 2 It is a cell morphology diagram of Blastococcus atacamensis YC-1.

[0073] Figure 3 It is a scanning electron microscope (SEM) diagram of Blastococcus atacamensis YC-1.

[0074] Figure 4 It is a growth condition diagram of Blastococcus atacamensis YC-1 under different temperatures.

[0075] Figure 5 It is a growth condition diagram of Blastococcus atacamensis YC-1 under different salinity.

[0076] Figure 6 Tyrosinase inhibition rate of Blastococcus atacamensis YC-1 fermentation product lysate extract.

[0077] Figure 7 Total ion current chromatogram of DHHB standard sample.

[0078] Figure 8 Primary mass spectrum and secondary mass spectrum of DHHB standard sample.

[0079] Figure 9 Total ion current chromatogram of sample solution.

[0080] Figure 10 Primary mass spectrum and secondary mass spectrum of the substance with peak at 6.83 min in sample solution.

[0081] Figure 11 Effect of Blastococcus atacamensis YC-1 fermentation product lysate extract concentration on cell survival rate.

[0082] Figure 12 Sunscreen factor SPF and UVAPF values of sunscreen cream S1 (blank control group) and S2 (sample group). DETAILED DESCRIPTION

[0083] The present application is not limited to the examples described, and the examples are only illustrative of the present application, and are not intended to limit the scope of protection of the present application. Modifications or substitutions of the method, steps or conditions of the present application, without departing from the spirit and essence of the present application, all belong to the scope of the present application.

[0084] In the following examples, unless otherwise specified, the solution mentioned is water as solvent.

[0085] The crude salt referred to in the following examples is Yuncheng salt pond salt, which is a commercially available product.

[0086] The medium formula described in the following examples is as follows:

[0087] Crude salt liquid medium: crude salt 50 g, MgSO4·7H2O 20 g, KCl 2.0 g, sodium citrate 3.0 g, anhydrous calcium chloride 0.2 g, yeast extract 2.0 g, peptone 10.0 g, add distilled water to 1 L, adjust pH to 7.0-7.2.

[0088] Coarse salt solid culture medium: coarse salt 50 g, MgSO4·7H2O 20 g, KCl 2.0 g, sodium citrate 3.0 g, anhydrous calcium chloride 0.2 g, yeast extract 2.0 g, proteose peptone 10.0 g, add distilled water to 1 L, adjust pH 7.0-7.2, add agar 15.0 g. High pressure 1×105 Pa, 121℃ sterilization for 30 min, cool the culture medium to 50-60℃, then pour into culture dishes, about 15-20 mL of culture medium is poured into each culture dish, after cooling and solidification, store for later use.

[0089] Example 1: YC-1 strain morphology observation

[0090] 1. Strain source

[0091] The strain is isolated from black mud in Yuncheng salt lake, Shanxi. The specific isolation method is as follows:

[0092] In the clean bench, add black mud to the coarse salt culture medium, the amount is 5% of the culture medium, shake well, put into the 30℃ shaking incubator for induction culture for 48 h, then transfer to the 30℃ incubator. When the upper clear liquid becomes turbid, dilute the bacterial liquid with sterile water to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , etc. Take 100 μL of different concentrations of diluent on the coarse salt solid culture medium, evenly spread it with a disposable spreader, and place it in a 30℃ constant temperature incubator after the diluent is dried. After obvious colonies grow on the culture medium, different colonies are transferred and cultured, and strains with typical characteristics such as bright orange-red round edge, neat edge, and shiny surface are picked and cultured on the coarse salt solid culture medium plate one by one. The bright orange-red YC-1 strain is the strain involved in the present application. The purified strain is stored in 20% glycerol at -80℃ refrigerator for later use.

[0093] 2. Culture characteristics, morphological characteristics and physiological and biochemical characteristics

[0094] The isolated YC-1 strain is streaked on the coarse salt solid culture medium and cultured at 30℃. The colony morphology is shown in Figure 1 The colony shows bright orange-red round colony, opaque, central protrusion, and neat colony edge, stable size and shape. The smear of the strain is gram stained, and the bacterial morphology is shown in Figure 2 The strain is gram-positive. The SEM scanning electron microscope image is shown in Figure 3 It is spherical with flagella, and the diameter ranges from 0.8 to 1.0 μm.

[0095] 3. Growth characteristics of Blastococcus atacamensis YC-1

[0096] The YC-1 strain grows at a temperature range of 30-37℃, and the optimum growth temperature is 30℃. Figure 4 The YC-1 strain can tolerate a salinity of 0-6%, and the optimum salinity range is 1-4%. Figure 5 The YC-1 strain grows at a pH range of 6.0-9.0, and the optimum growth pH is 7.0.

[0097] 4. Physiological and biochemical characteristics of Blastococcus atacamensis YC-1

[0098] The YC-1 strain is positive for contact enzyme, negative for oxidase, negative for amylase, negative for cellulase, positive for glucose oxidation and fermentation, positive for indole, positive for arginine dihydrolase, positive for beta-glucosidase, positive for protease, and positive for beta-galactosidase.

[0099] Example 2: 16S rRNA classification identification of the YC-1 strain

[0100] The YC-1 strain of Example 1 was subjected to molecular biology identification, and its 16S rRNA gene was amplified by PCR. After electrophoresis detection, sequencing was performed. The primers used in the PCR are as follows: 27F primer sequence (5'-3'): AGAGTTTGATCCTGGCTCAG (SEQ ID NO. 1) and 1492R primer sequence (5'-3'): GGTTACCTTGTTACGACTT (SEQ ID NO. 2).

[0101] The sequencing result shows that the sequence is as shown in SEQ ID NO. 3. The sequence was subjected to Blast sequence alignment analysis on the NCBI database, and finally determined that the YC-1 strain is Blastococcus atacamensis, with a homology score of 99.72%.

[0102] The Blastococcus YC-1 of the present application was deposited with the China Center for Type Culture Collection on January 14, 2025, and the deposit number is CCTCC NO: M 2025129.

[0103] The sequence of the 16s rDNA of Blastococcus atacamensis YC-1 is as follows (SEQ ID NO. 3):

[0104]

[0105] Example 3: Preparation of Blastococcus atacamensis YC-1 fermentation product lysate extract

[0106] Fermentation medium: coarse salt 20 g, MgS04-7H20 20 g, KCl 2.0 g, Na-citrate 3.0 g, CaCI2-2H20 0.2 g, yeast extract 2.0 g, peptone 10.0 g, add distilled water to 1 L, adjust pH to 7.2.

[0107] (1) Take a sample from the Blastococcus atacamensis YC-1 strain cryovial, inoculate into a coarse salt liquid medium, and place in a 30°C shaking incubator (rotation speed: 200 rpm) for 4 days. When the culture solution becomes a turbid and opaque red liquid, inoculate on a coarse salt solid medium plate and place in a constant temperature and humidity incubator for 4 days (30°C, humidity 70%) to activate the strain.

[0108] Pick a single colony and inoculate into a conical flask containing 100 mL of coarse salt liquid medium, and place in a 30°C shaking incubator (rotation speed: 200 rpm) for 4 days. At this time, detect the OD 600 of the bacterial solution, which is about 0.4, and use it as a coarse salt seed solution.

[0109] Add the cultured coarse salt seed solution to a sterile conical flask containing 250 mL of the above sterilized fermentation medium at a volume ratio of 10% (v / v), and place in a 30°C shaking incubator (rotation speed: 200 rpm) for 4 days or more, i.e., until the OD 600 is about 0.4, to obtain a cultured fermentation solution.

[0110] (2) Centrifuge the fermentation solution (OD 600 0.4) obtained in step (1) at 4°C and 8000 rpm for 10 min, remove the supernatant, wash the bacterial pellet with PBS twice, centrifuge to remove the liquid phase, and obtain the pellet;

[0111] Add the obtained pellet to anhydrous ethanol at a liquid to mass ratio of 10:1 (g / l), and break it in an ultrasonic cell disruptor (1200 W, power: 80%, time: 15 min) for two cycles. After centrifugation at 4°C and 8500 rpm for 10 min, collect the supernatant to obtain the fermentation product lysate extract ethanol extract.

[0112] (3) In the bacteria precipitate obtained by centrifugation in step (2), fresh anhydrous ethanol was added in a liquid to solid ratio of 10:1 (g / l), and the ultrasonic cell disrupter (1200 W, power: 80%, time: 15 min) was used again for repeated extraction once. All the ethanol extracts of the fermentation product cytolysate extract were combined, concentrated under reduced pressure, and freeze-dried to obtain Blastococcus atacamensis YC-1 fermentation product cytolysate extract, which was stored in a refrigerator at 4°C for standby use.

[0113] Example 4: Determination of the antioxidant activity of Blastococcus atacamensis YC-1 fermentation product cytolysate extract

[0114] 1. Determination of DPPH free radical (DPPH·) scavenging ability

[0115] (1) The Blastococcus atacamensis YC-1 fermentation product cytolysate extract obtained in Example 3 was prepared into Blastococcus atacamensis YC-1 fermentation product cytolysate extract ethanol solutions with a mass concentration of 13 mg / mL, 6.5 mg / mL, 3.3 mg / mL, 1.6 mg / mL, 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, and 0.1 mg / mL, respectively, using anhydrous ethanol.

[0116] (2) A 2,2-diphenyl-1-picrylhydrazyl (DPPH) solution with a concentration of 0.12 mg / mL was prepared using 95% ethanol.

[0117] (3) Experimental group, control group, and blank group were set up, respectively, and the specific groups were as follows:

[0118] Experimental group: 100 μL of the fermentation product cytolysate extract ethanol solution obtained in step (1) was transferred into a 96-well plate, and then 100 μL of the DPPH-ethanol solution obtained in step (2) was added, mixed uniformly, and reacted in the dark for 30 min, after which the absorbance A of the mixture was measured at 517 nm. 样品 .

[0119] Control group: The specific steps were the same as those of the experimental group, except that an equal volume of 95% ethanol was used instead of the DPPH solution, and the absorbance A was measured at 517 nm. 对照 .

[0120] Blank group: The specific steps were the same as those of the experimental group, except that an equal volume of anhydrous ethanol was used instead of the sample solution (the sample solution refers to the fermentation product cytolysate extract ethanol solution described above); and the absorbance A was measured at 517 nm. 空白 .

[0121] Each group needs to repeat 3 times, the results were averaged, and the DPPH radical scavenging rate was calculated.

[0122] The DPPH radical scavenging rate calculation formula is shown below, and the results are shown in Table 1.

[0123] DPPH radical scavenging rate / % = [1-(A 样品 -A 对照 ) / A 空白 )] x 100%

[0124] (4) Ascorbic acid solution with 0.1 mg / mL, 0.08 mg / mL, 0.04 mg / mL, 0.02 mg / mL, 0.01 mg / mL as positive control, specifically: 100 μL of different concentrations of ascorbic acid solution was removed into a 96-well plate, then 100 μL of DPPH-ethanol solution obtained in step (2) was added, mixed uniformly and reacted for 30 min in the dark, then the absorbance A 样品-1 of the mixture was measured at 517 nm.

[0125] Control group: the specific method is the same as above, the difference is that the absorbance A 对照-1 at 517 nm is measured with equal volume of 95% ethanol instead of DPPH solution.

[0126] Blank group: the specific method is the same as above, the difference is that equal volume of ultrapure water is used instead of ascorbic acid solution; the absorbance A 空白-1 at 517 nm is measured.

[0127] According to the above method, A 样品-1 , A 对照-1 and A 空白-1 were obtained, and the DPPH radical scavenging rate was calculated.

[0128] The DPPH radical scavenging rate calculation formula is shown below, and the results are shown in Table 1.

[0129] DPPH radical scavenging rate / % = [1-(A 样品-1 -A 对照-1 ) / A 空白-1 )] x 100%.

[0130] Table 1: DPPH radical scavenging effect of Blastococcus atacamensis YC-1 fermentation product lysate extract

[0131]

[0132] 2. Determination of ABTS cationic radical (ABTS + ·) scavenging ability

[0133] (1) Preparation of the solution

[0134] Potassium persulfate solution: 6.6 mg of potassium persulfate was weighed and dissolved in 10 mL of distilled water to obtain a potassium persulfate solution with a concentration of 2.45 mmol / L;

[0135] ABTS working solution: 7.7 mg of ABTS was weighed and dissolved in 2 mL of the potassium persulfate solution. After 16 h of reaction in the dark, it was diluted to obtain a 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS + ) working solution with an absorbance of 0.7 at 734 nm.

[0136] (2) The Blastococcus atacamensis YC-1 fermentation product lysate extract obtained in Example 3 was prepared into Blastococcus atacamensis YC-1 fermentation product lysate extract ethanol solutions with concentrations of 26 mg / mL, 13 mg / mL, 6.5 mg / mL, 3.3 mg / mL, and 1.6 mg / mL, respectively, using anhydrous ethanol.

[0137] (3) 10 μL of the Blastococcus atacamensis YC-1 fermentation product lysate extract ethanol solutions with different concentrations obtained in step (2) were transferred into a 96-well plate, and then 190 μL of the ABTS working solution obtained in step (1) was added. After 15 min of reaction in the dark, the absorbance A 样品 734 was measured at 734 nm.

[0138] Control group: The specific steps were the same as above, except that anhydrous ethanol was used instead of the ABTS working solution. The absorbance A 对照 734 was measured at 734 nm.

[0139] Blank group: The specific steps were the same as above, except that an equal volume of anhydrous ethanol was used instead of the sample solution (the sample solution refers to the fermentation product lysate extract ethanol solution described above). The absorbance A 空白 734 was measured at 734 nm.

[0140] Each test group was repeated 3 times, and the results were averaged to calculate the ABTS cation radical scavenging rate.

[0141] The ABTS cation radical scavenging rate was calculated according to the following formula, and the results are shown in Table 2.

[0142] ABTS cation radical scavenging rate % = [1 - (A 样品 -A 对照 ) / A 空白 )] x 100%.

[0143] (4) Ascorbic acid solution with concentration of 0.80 mg / mL, 0.12 mg / mL, 0.10 mg / mL, 0.08 mg / mL, 0.05 mg / mL, 0.025 mg / mL as positive control, specifically: 10 μL of ascorbic acid solution with different concentrations was taken in 96-well plate, then 190 μL of ABTS working solution obtained in step (1) was added, and the absorbance A at 734 nm was measured after 15 min of reaction in dark 样品-1 .

[0144] Blank group: The specific method was the same as above, except that equal volume of ultrapure water was used instead of ascorbic acid solution; the absorbance A at 734 nm was measured 空白-1 .

[0145] Control group: The specific method was the same as above, except that equal volume of ultrapure water was used instead of DPPH solution; the absorbance A at 734 nm was measured 对照-1 .

[0146] According to the above method, A 样品-1 , A 对照-1 and A 空白-1 were obtained, and the ABTS cation radical scavenging rate was calculated.

[0147] The ABTS cation radical scavenging rate calculation formula was as follows, and the results were shown in Table 2.

[0148] ABTS cation radical scavenging rate / % = [1 - (A 样品-1 -A 对照-1 ) / A 空白-1 ] x 100%.

[0149] Table 2: ABTS radical scavenging effect of Blastococcus atacamensis YC-1 fermentation product lysate extract +

[0150]

[0151] 3. Determination of hydroxyl radical (·OH) scavenging ability

[0152] (1) The Blastococcus atacamensis YC-1 fermentation product lysate extract obtained in Example 3 was used to prepare Blastococcus atacamensis YC-1 fermentation product lysate extract ethanol solution with concentration of 10.0 mg / mL, 5.0 mg / mL, 2.5 mg / mL, 1.25 mg / mL, and 0.6 mg / mL, respectively.

[0153] ​(2) Take 50 μL of each concentration gradient solution obtained in step (1) above, add 50 μL of 9 mmol / L H2O2 solution, 50 μL of 9 mmol / L FeSO4 solution, and 50 μL of 9 mmol / L salicylic acid-anhydrous ethanol solution, vortex uniformly, and incubate in a 37°C water bath for 35 min. Measure the absorbance at 510 nm, and record it as A 样品 .

[0154] The control group: the specific steps are the same as above, except that distilled water is used to replace the H2O2 solution. The specific steps are the same as above, and the absorbance at 510 nm is measured and recorded as A 对照 . The hydroxyl radical scavenging rate is calculated.

[0155] The blank group: the specific steps are the same as above, except that distilled water is used to replace the sample solution (the sample solution refers to the ethanol solution of the extract of the fermentation product lysate). The specific steps are the same as above, and the absorbance at 510 nm is measured and recorded as A 空白 ;

[0156] Each group of experiments is repeated 3 times, and the average value is taken. The hydroxyl radical scavenging rate calculation formula is as follows, and the results are shown in Table 3.

[0157] Hydroxyl radical scavenging rate / % = [1 - (A 样品 -A 对照 ) / A 空白 ] x 100%.

[0158] (3) Take 50 μL of each of the ascorbic acid solutions with concentrations of 0.84 mg / mL, 0.42 mg / mL, 0.21 mg / mL, 0.10 mg / mL, and 0.05 mg / mL as positive controls. Specifically, take 50 μL of each of the ascorbic acid solutions above, add 50 μL of 9 mmol / L H2O2 solution, 50 μL of 9 mmol / L FeSO4 solution, and 50 μL of 9 mmol / L salicylic acid-anhydrous ethanol solution, vortex uniformly, and incubate in a 37°C water bath for 35 min. Measure the absorbance at 510 nm, and record it as A 样品-1 .

[0159] The control group: the specific steps are the same as above, except that an equal volume of ultrapure water is used to replace the H2O2 solution. The specific steps are the same as above, and the absorbance at 510 nm is measured and recorded as A 对照-1 . The hydroxyl radical scavenging rate is calculated.

[0160] The blank group: the specific steps are the same as above, except that an equal volume of ultrapure water is used to replace the ascorbic acid solution. The specific steps are the same as above, and the absorbance at 510 nm is measured and recorded as A 空白-1 ;

[0161] According to the above method, A 样品-1 , A 对照-1 , and A空白-1 The hydroxyl radical scavenging rate was calculated.

[0162] Each group of experiments was repeated three times in parallel, and the average value was taken. The hydroxyl radical scavenging rate was calculated as follows, and the results are shown in Table 3.

[0163] Hydroxyl radical scavenging rate / % = [1 - (A 样品-1 -A 对照-1 ) / A 空白-1 ] x 100%.

[0164] Table 3: Hydroxyl radical scavenging effect of Blastococcus atacamensis YC-1 fermentation product lysate extract

[0165]

[0166] As can be seen from Tables 1, 2 and 3, the Blastococcus atacamensis YC-1 fermentation product lysate extract ethanol solution has high DPPH radical, ABTS cation radical and hydroxyl radical scavenging effects.

[0167] 4. Determination of ferric ion reducing power (FRAP)

[0168] (1) Preparation of TPTZ working solution

[0169] A TPTZ working solution was prepared by mixing 25 mL of acetic acid buffer (pH = 3.6), 2.5 mL of 10 mmol / L 2,4,6-tripyridyl triazine (TPTZ) solution and 2.5 mL of 20 mmol / L ferric trichloride solution.

[0170] (2) The Blastococcus atacamensis YC-1 fermentation product lysate extract obtained in Example 3 was used to prepare Blastococcus atacamensis YC-1 fermentation product lysate extract ethanol solutions with concentrations of 50 mg / mL, 25 mg / mL, 12.5 mg / mL, 6.25 mg / mL, 3.13 mg / mL, 0.78 mg / mL, 0.39 mg / mL and 0.20 mg / mL, respectively.

[0171] (3) 10 μL of the fermentation product lysate extract ethanol solutions with different concentrations obtained in step (2) above, 190 μL of the TPTZ working solution obtained in step (1) were sequentially added to a 96-well plate, and incubated at 37°C for 10 min, and the absorbance was measured at a wavelength of 593 nm on an enzyme marker instrument after shaking for 10 s, and the absorbance was A 样品 .

[0172] Control group: the specific steps are the same as above, the difference is that the acetic acid buffer solution is used instead of TPTZ working solution, and the absorbance is measured at 593 nm wavelength, which is A 对照 .

[0173] Blank group: the specific steps are the same as above, the difference is that anhydrous ethanol is used instead of sample solution (sample solution refers to the above fermented product lysate extract ethanol solution), and the specific steps are the same as above, and the absorbance A is measured at 593 nm 空白 .

[0174] Each test group needs to be repeated 3 times, and the average value is taken.

[0175] Prepare ferrous sulfate standard solution with a concentration of 0.1-1 mmol / L, and measure the absorbance under the same conditions. With the concentration of ferrous sulfate as the abscissa and the absorbance as the ordinate, the standard curve is drawn, and the regression equation is y=0.675x+0.019 (R 2 =0.999). According to the regression equation, the iron ion reducing capacity of the sample is calculated, and the equivalent concentration of ferrous ion is expressed (FRAP value), with the unit of mmol / L.

[0176] y=A 样品 -A 对照 -A 空白 , substitute the equation to get the value of x, that is, the FRAP value.

[0177] (4) Ascorbic acid solution with a concentration of 11 mg / mL, 5.5 mg / mL, 1.38 mg / mL, 0.69 mg / mL, 0.34 mg / mL, 0.02 mg / mL, 0.01 mg / mL is used as a positive control, which is: 10 μL of the above ascorbic acid solution, 190 μL of TPTZ working solution obtained in step (1) is added into the 96-well plate in turn, and the enzyme marker is shaken for 10 s, incubated at 37°C for 10 min, and the absorbance is measured at 593 nm wavelength, which is A 样品-1 .

[0178] Control group: the specific steps are the same as above, the difference is that the acetic acid buffer solution is used instead of TPTZ working solution, and the absorbance is measured at 593 nm wavelength, which is A 对照-1 .

[0179] Blank group: the specific steps are the same as above, the difference is that the same volume of ultrapure water is used instead of ascorbic acid solution, and the specific steps are the same as above, and the absorbance A is measured at 593 nm 空白-1 .

[0180] According to the above method, A 样品-1 , A 对照-1 and A 空白-1 are obtained.

[0181] Each test group needs to repeat 3 times, the results take the average value.

[0182] Preparation of concentration of 0.1-1 mmol / L range of ferrous sulfate standard solution, under the same conditions to determine its absorbance. With ferrous sulfate concentration as the abscissa, the ordinate, draw the standard curve, the regression equation is: y = 0.675x + 0.019 (R 2 = 0.999). According to the regression equation to calculate the sample of iron ion reducing power, expressed as the equivalent concentration of ferrous ion (FRAP value), unit: mmol / L.

[0183] y = A 样品-1 -A 对照-1 -A 空白-1 , into the equation, get x value, namely: FRAP value.

[0184] The results are shown in Table 4.

[0185] Table 4: Blastococcus atacamensis YC-1 fermentation product lysate extract of iron ion reducing capacity

[0186]

[0187] From Table 4, when the Blastococcus atacamensis fermentation product lysate extract ethanol solution concentration of 6.25 mg / mL, its FRAP value is 0.24 mmol / L, close to the concentration of ascorbic acid is 0.02 mg / mL FRAP value (0.27 mmol / L), to prove that Blastococcus atacamensis fermentation product lysate extract has a certain reduction capacity.

[0188] Example 5: Blastococcus atacamensis YC-1 fermentation product lysate extract on tyrosinase activity inhibition of determination

[0189] The specific steps are as follows:

[0190] (1) Blastococcus atacamensis YC-1 fermentation product lysate extract obtained by example 3 with anhydrous ethanol preparation mass concentration of 14.1 mg / mL, 7.06 mg / mL, 1.77 mg / mL, 0.88 mg / mL, 0.44 mg / mL Blastococcus atacamensis YC-1 fermentation product lysate extract ethanol solution;

[0191] (2) L-dopa (2.5 mg / mL) and tyrosinase (250 U / mL) solutions were prepared with a phosphate buffer (PBS) having a pH of 6.8, and 50 μL of the PBS having a pH of 6.8, the sample, and the tyrosinase solution were sequentially added in a 96-well plate, and after incubation at 37°C for 10 min, 50 μL of L-dopa was added and incubation was continued at 37°C for 5 min. The absorbance was measured at 475 nm using a microplate reader, and was recorded as OD 样品 ;

[0192] The control group: the specific steps were the same as above, except that the sample solvent was used instead of the sample; the absorbance was measured at 475 nm using a microplate reader, and was recorded as OD 对照组 ;

[0193] The blank group: the specific steps were the same as above, except that the PBS was used instead of the tyrosinase solution; the absorbance was measured at 475 nm using a microplate reader, and was recorded as OD 空白组 ;

[0194] Three parallel experiments were performed for each sample, and kojic acid was used as a positive control.

[0195] The calculation formula of the tyrosinase activity inhibition rate (A) is:

[0196] A% = [1 - (OD 样品 - OD 空白组 ) / (OD 对照组 - OD 空白组 )] x 100%

[0197] The test results are shown in Figure 6 and Table 5:

[0198] Table 5: Tyrosinase inhibition rate of Blastococcus atacamensis YC-1 fermentation product lysate extract and kojic acid

[0199]

[0200] From Figure 6 and Table 5, it can be seen that the Blastococcus atacamensis fermentation product lysate extract has a certain inhibitory effect on tyrosinase activity, and the inhibitory effect gradually increases with increasing concentration. When the concentration is 7.06 mg / mL, the inhibition rate of tyrosinase reaches a maximum of 40.69%, and then tends to be flat, and is generally weaker than kojic acid.

[0201] Therefore, the Blastococcus atacamensis fermentation product lysate extract has certain application potential in whitening.

[0202] Example 6: Qualitative analysis of the DHHB production capacity of Blastococcus atacamensis YC-1

[0203] The specific steps are as follows:

[0204] (1) The preparation method of the fermentation product lysate extract of Blastococcus atacamensis YC-1 is the same as that in Example 3, except that the cultured crude salt seed liquid is added to a sterile conical flask containing 250 mL of the fermentation medium prepared in Example 3 at a volume ratio of 10% (v / v), and cultured in a shaking incubator at 30°C (speed: 200 rpm) for 5 days to obtain the cultured fermentation liquid;

[0205] The other steps are the same as in Example 3, and the fermentation product lysate extract of Blastococcus atacamensis YC-1 is prepared according to the method of Example 3.

[0206] (2) Add 1 mL of methanol to the lysate extract of the fermentation product of Blastoccus atacamensis YC-1 obtained in Example 3 and vortex redissolve. After centrifugation at 8000-9000 rpm, take the supernatant to obtain the sample to be tested.

[0207] DHHB in the extract of lysate from the fermentation products of Blastococcus atacamensis YC-1 was qualitatively analyzed using ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF / MS).

[0208] Liquid chromatography conditions: Column: ACQUITY UPLC BEH C 18 Column (2.1 mm × 100 mm, 1.7 μm); mobile phase: A is 0.1% formic acid-water solution, B is acetonitrile; gradient elution program is shown in Table 6, flow rate is 0.3 mL / min; diode array (PDA) detector; column temperature 45 °C; injection volume 5.0 μL.

[0209] Table 6 Gradient elution program

[0210] Time (min) Mobile phase A (%) Mobile phase B (%) 0.00 100 0 7.00 70 30 8.00 20 80 9.00 0 100 10.00 100 0

[0211] Mass spectrometry conditions: positive ion mode, electrospray ionization source, multiple reaction monitoring mode, ion source temperature 100℃, capillary voltage 3.5kV, cone voltage 20V, desolvation gas temperature 400℃, IMS gas flow rate 24mL / min, collision energy 6 / 20eV.

[0212] The sample to be tested was injected into UPLC-Q-TOF / MS for qualitative analysis. The total ion chromatogram of the DHHB standard solution (5 μg / mL) is shown below.Figure 7 The primary mass spectrum (TOF MS) and secondary mass spectrum (TOF MS / MS) of the substance eluted at 6.83 min are shown in FIG. 2A and FIG. 2B, respectively. Figure 8 The maximum proton number m / z 398.1951 is [M+H]. + The ion peak is +149, +233, +296.

[0213] The total ion current chromatogram of the solution of the extract of the Blastococcus atacamensis YC-1 fermentation product lysate (5d) is shown in FIG. 3A. Figure 9 The primary mass spectrum (TOF MS) and secondary mass spectrum (TOF MS / MS) of the substance eluted at 6.83 min are shown in FIG. 2A and FIG. 2B, respectively. Figure 10 The maximum proton number m / z 398.2025 is [M+H]. + The ion peak is +149, +233, +296. Figure 9 10 The ion peak is +149, +233, +296. Figure 7 8 As can be seen from the comparison, the substance eluted at 6.83 min in the sample is consistent with the elution time of the DHHB standard, and the [M+H] ion peak is consistent with that of the DHHB standard, so it is determined that the substance eluted at 6.83 min is DHHB, and the Blastococcus atacamensis YC-1 fermentation product lysate extract solution contains DHHB. + The ion peak is +149, +233, +296.

[0214] Example 7: Quantitative analysis of the DHHB-producing ability of Blastococcus atacamensis YC-1

[0215] The specific steps are as follows:

[0216] 1. Preparation of the standard curve:

[0217] A 1.0 mg / mL DHHB standard solution was prepared using anhydrous methanol as the solvent. This standard solution was sequentially diluted to a concentration of 3.00, 1.50, 0.75, 0.38, and 0.19 μg / mL standard working solutions, which were injected and analyzed according to the above chromatographic conditions. The DHHB concentration was used as the abscissa, and the peak area was used as the ordinate to draw the standard curve. The results showed that, within the range of 3.00-0.19 μg / mL, the peak area and the mass concentration showed a good linear relationship, and the regression equation was Y = 1246.76X + 763.04 (R 2 = 0.990).

[0218] 2. Preparation of the Blastococcus atacamensis YC-1 fermentation product lysate extract ​​

[0219] The method for preparing the Blastococcus atacamensis YC-1 fermentation product lysate extract was the same as in Example 3, except that the prepared crude salt seed liquid was added to 300 mL of the above fresh culture medium (salinity 2%, pH 7.2) in a sterile conical flask at a proportion of 10% (v / v), and the culture was carried out at 30°C in a shaking incubator (rotation speed: 200 rpm) for 4, 5, 6, 7, 8, 10, and 12 days, respectively, to obtain fermentation liquids cultured for different days; the Blastococcus atacamensis YC-1 fermentation product lysate extract prepared by culturing for 4, 5, 6, 7, 8, 10, or 12 days was prepared according to the method of Example 3; and 1 mL of methanol was used to vortex and dissolve the fermentation product lysate extract obtained by culturing for different days.

[0220] 3. Determination of the DHHB content

[0221] The DHHB content in the ethanol extract of the Blastococcus atacamensis YC-1 fermentation product lysate extract obtained in step 2 was determined using the determination method of Example 6 and the above standard curve, as shown in Table 7.

[0222] Table 7. DHHB content in Blastococcus atacamensis YC-1 fermentation product lysate extract for different days (d)

[0223]

[0224] The results showed that the highest DHHB content was 2.17 μg / mL when the cells were cultured for 8 days. Since the volume of the bacterial liquid used was 250 mL, the content was converted to 8.7 mg / L.

[0225] In addition, the mass of the Blastococcus atacamensis YC-1 cells after freeze-drying for 8 days was 0.2489 g, and the highest DHHB production capacity of the Blastococcus atacamensis YC-1 strain was calculated to be 8.7 mg / g.

[0226] Example 8: Cytotoxicity experiment of Blastococcus atacamensis YC-1

[0227] The specific steps are as follows:

[0228] HaCAT cell toxicity experiment was performed by CCK-8 kit. The purchased HaCAT cells were cultured in a 37℃, 5% CO2 incubator using DMEM complete medium. When the cell growth reached more than 80%, the cells were digested and separated with EDTA-trypsin, and a cell suspension with a cell density of 1×10 5 The 100 μL suspension was added to a 96-well plate, and after 24 h of incubation in the incubator, 10 μL of Blastococcus atacamensis fermentation product lysate extract solution with different concentrations was added to each well, and after mixing, the cells were cultured for another 24 h. Then, 10 μL of CCK-8 solution was added, and the cells were incubated in the dark for 1 h in the incubator. The absorbance was measured at 450 nm. The results are shown in Table 1. YC-1FLE had no toxicity to HaCaT cells in the range of 0.15-5.0 mg / mL, and all could maintain the stability of the cells, showing good biocompatibility. Figure 11

[0229] Example 9: Safety test of Blastococcus atacamensis YC-1

[0230] The specific steps are as follows:

[0231] (1) The preparation method of Blastococcus atacamensis YC-1 fermentation product lysate extract was the same as in Example 3, except that the cultured crude salt seed liquid was added to a sterile conical flask containing 250 mL of the above sterilized fermentation medium at a volume ratio of 10% (v / v), and cultured in a 30℃ shaking incubator (rotation speed: 200 rpm) for 8 d to obtain the cultured fermentation broth.

[0232] The Blastococcus atacamensis YC-1 fermentation product lysate extract was prepared according to the method of Example 3;

[0233] (2) Safety test

[0234] The safety of Blastococcus atacamensis YC-1 fermentation product lysate extract was detected by human closed patch test. A 3% (w / w) Blastococcus atacamensis YC-1 fermentation product lysate extract solution was prepared with white vaseline as the solvent, and the sample was subjected to human closed patch test according to the “Cosmetic Safety Technology Specification” (2015 edition).

[0235] According to the selection of 30 volunteers who met the inclusion criteria of the subjects, 0.020 g-0.025 g of the sample was weighed in the patch tester chamber, and the control hole was white vaseline. ​

[0236] The test results show that no erythema, edematous erythema, significant redness or papules, etc. occurred in the 30 subjects, indicating that the Blastococcus atacamensis fermentation product lysate extract (3%, w / w) has no obvious irritation to human skin.

[0237] Example 10: Application of Blastococcus CCTCC NO: M 2025129 in sunscreen

[0238] The sunscreen formulation and preparation process of this example are as follows:

[0239] 1. Aqueous phase: water, glycerol. After mixing, heat to 80°C, stir to dissolve uniformly;

[0240] 2. Oil phase: homosalate, isopropyl myristate, cetylstearyl alcohol, caprylic capric glyceride, white oil, lanolin, white vaseline, lauryl PEG-9 polydimethylsiloxyethyl dimethicone, butylated hydroxytoluene, and Blastococcus atacamensis YC-1 fermentation product lysate extract prepared in Example 3. Heat the above raw materials to 80°C, stir to dissolve uniformly;

[0241] 3. Homogenize and emulsify the aqueous phase and oil phase for 5 min after mixing, and cool to room temperature to obtain the sunscreen.

[0242] The sunscreen factor SPF value and UVAPF value of the sunscreen were determined according to the standard method of ISO 24443-2012. 50 mg of sunscreen was evenly applied on a PMMA plate (5 cm x 5 cm), and was allowed to stand for 15 min to form a film in a light-proof, constant temperature and humidity environment. The sunscreen factor SPF and UVAPF values of each point on each plate were determined using a UV transmittance analyzer (UV-2000S, Shanghai Lanfei Optical Instrument Co., Ltd.). Four parallel experiments were performed for the same sunscreen sample, and the average value was calculated. The test results are shown in Table 1. Figure 12 As can be clearly seen from Table 1, the SPF value of sunscreen S1 (blank control group) is 8.62, while the SPF value of S2 (sample group) reaches 9.48, an increase of 10%, and the data has a significant difference (**p < 0.01). It is indicated that YC-1 FLE has good anti-ultraviolet performance and has certain application potential in sunscreen cosmetics.

[0243] Although the present application has been disclosed with reference to the preferred embodiments above, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application. Therefore, the protection scope of the present application should be defined by the claims.

Claims

1. Use of Blastococcus atacamensis YC-1 for the preparation of a product containing or being diethylamino hydroxybenzoyl hexyl benzoate, characterized in that, The blastococcus atacamensis YC-1 was deposited at the China Center for Type Culture Collection on January 14, 2025, with accession number CCTCC NO: M 2025129.

2. Use according to claim 1, characterized in that, The application involves using Blastomyces CCTCC NO: M2025129 or a microbial agent containing Blastomyces CCTCC NO: M 2025129 to ferment and prepare a fermentation product lysate extract containing hexyl diethylaminohydroxybenzoylbenzoate. Preferably, the products include, but are not limited to, cosmetics, sun protection fabrics, and daily chemical products.

3. Use according to claim 2, characterized in that, The dosage forms of the cosmetics can be solutions, topical ointments, emulsions, moisturizing agents, softening agents, fillers, soft water, emulsions, cosmetic bases, fragrances, soaps, liquid cleansers, bath products, sunscreens, sun protection oils, suspensions, emulsions, pastes, gels, lotions, powders, soaps, surfactant-containing cleansers, oils, foundations, emulsion foundations, wax foundations, patches, and sprays. Preferably, the cosmetic further comprises at least one cosmetically acceptable carrier; Preferably, the sunscreen fabric is obtained by spraying a fermentation product lysate extract containing diethylaminohydroxybenzoylhexylbenzoate onto the surface of a fabric substrate, or by immersing the fabric substrate in the fermentation product lysate extract solution. Preferably, the carrier can be oil, water, surfactant, humectant, lower alcohol, thickener, chelating agent, pigment, preservative, or fragrance.

4. Use according to claim 2 or 3, characterized in that, The microbial agent uses Blastomyces CCTCC NO: M 2025129 as the main microorganism; Preferably, the microbial agent contains live cells of Blastomyces strain CCTCC NO: M 2025129, freeze-dried dried cells of Blastomyces strain CCTCC NO: M 2025129, immobilized cells of Blastomyces strain CCTCC NO: M 2025129, fermentation product or lysate of Blastomyces strain CCTCC NO: M 2025129, liquid or solid inoculum of Blastomyces strain CCTCC NO: M 2025129, or Blastomyces strain CCTCC NO: M 2025129 in any other form.

5. A process for the biotechnological production of diethylamino hydrobenzoyl hexyl benzoate, characterized in that, The method involves fermenting a fermentation product lysate extract containing diethylaminohydroxybenzoyl benzoate using Bacillus blastomonas CCTCC NO: M 2025129 or a bacterial agent containing Bacillus blastomonas CCTCC NO: M 2025129. Preferably, the method involves preparing a fermentation broth using *Blastococcus blastomonas* CCTCC NO: M 2025129 or an inoculum containing *Blastococcus blastomonas* CCTCC NO: M 2025129, centrifuging the prepared fermentation broth to collect the bacterial cells, washing the bacterial cells, adding ethanol to the bacterial cells, crushing them, collecting the supernatant, concentrating under reduced pressure, and freeze-drying to obtain a fermentation product lysate extract containing diethylaminohydroxybenzoyl benzoate. Preferably, the preparation method of the fermentation broth of *Blastococcus blazei* CCTCC NO: M 2025129 is as follows: *Blastococcus blazei* CCTCC NO: M 2025129 is inoculated into a culture medium and cultured in a shaking incubator at 30-35℃ and a rotation speed of 200-250 rpm for 4-5 days; then, it is spread and inoculated into a solid culture medium and cultured at 30-35℃ and 60-70% humidity for 4-5 days; then, a single colony is picked and inoculated into a culture medium and cultured in a shaking incubator at 30-35℃ and a rotation speed of 200-250 rpm for 4-5 days to obtain the seed culture; The seed culture was inoculated into the fermentation medium at a volume ratio of 10% to 15% (v / v) and cultured at 30 to 35°C and 60 to 70% humidity for 4 to 5 days to obtain the cultured fermentation broth. Preferably, the disruption is performed by ultrasonic disruption or high-pressure cell disruption.

6. A method for the production of a cosmetic or sunscreen fabric, characterized in that, The method includes the following steps: (1) A fermentation broth was prepared by fermentation using Bacillus blastomonas CCTCC NO: M 2025129 or a bacterial agent containing Bacillus blastomonas CCTCC NO: M 2025129. The fermentation broth was centrifuged and the bacterial cells were collected. After washing, ethanol was added to the bacterial cells. The cells were crushed and the supernatant was collected. The supernatant was concentrated under reduced pressure and freeze-dried to obtain a fermentation product lysate extract containing hexyl ethylaminohydroxybenzoylbenzoate. (2) The fermentation product lysate extract containing diethylaminohydroxybenzoyl benzoate prepared in step (1) is added to the cosmetic preparation process to prepare a cosmetic containing diethylaminohydroxybenzoyl benzoic acid. Alternatively, step (2) can be: spraying a fermentation product lysate extract containing diethylaminohydroxybenzoyl benzoate onto the surface of the fabric substrate, or immersing the fabric substrate in the fermentation product lysate extract solution to obtain a sunscreen fabric.

7. The preparation method according to claim 6, characterized in that, The cosmetics mentioned are skincare and makeup products.

8. The preparation method according to claim 7, characterized in that, The dosage forms of the cosmetics can be solutions, topical ointments, emulsions, moisturizing agents, softening agents, fillers, soft water, emulsions, cosmetic bases, fragrances, soaps, liquid cleansers, bath products, sunscreens, sun protection oils, suspensions, emulsions, pastes, gels, lotions, powders, soaps, surfactant-containing cleansers, oils, foundations, emulsion foundations, wax foundations, patches, and sprays. Preferably, the cosmetic further comprises at least one cosmetically acceptable carrier; Preferably, the carrier can be oil, water, surfactant, humectant, lower alcohol, thickener, chelating agent, pigment, preservative, or fragrance.

9. The preparation method according to any one of claims 6 to 8 yields a cosmetic or sunscreen fabric.

10. The use of Blastococcus sp. CCTCC NO: M 2025129 in improving the ultraviolet resistance of sunscreen cream or fabric, characterized in that, The application is that the blastospore CCTCC NO: M 2025129 or the microbial inoculant containing the blastospore CCTCC NO: M 2025129 is used to ferment to obtain a fermentation liquor; the bacterial body is collected after the prepared fermentation liquor is centrifuged, and the bacterial body is washed, then ethanol is added, and the supernatant is collected after crushing, reduced pressure concentration, and freeze-drying, to obtain a fermentation product lysate extract containing diethylaminohydroxybenzoyl hexyl benzoate; the prepared fermentation product lysate extract is added to sunscreen, or the prepared fermentation product lysate extract is sprayed or coated on the surface of a fabric substrate.

Images