Application of substance taking Angpt18 as target in preparation of medicine for treating and delaying senescence
By constructing an Angptl8 gene knockout mouse model and using CRISPR/Cas9 technology to target and delete the Angptl8 gene exons, the problem of lacking a clear target in existing technologies has been solved, achieving significant effects in delaying aging and improving aging-related symptoms, and providing tools for drug development and diagnosis.
Patent Information
- Application Number
- CN202511482155.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-16
- Publication Date
- 2026-02-27
AI Technical Summary
Current technologies lack key molecules with well-defined targets, clear mechanisms of action, and clinical translational potential for delaying aging, and the direct regulatory role of Angptl8 in the aging process remains unclear.
By constructing an Angptl8 gene knockout mouse model, CRISPR/Cas9 gene editing technology was used to target and delete key exon regions of the mouse Angptl8 gene, inhibiting or downregulating Angptl8 gene expression, developing drugs to delay aging, and providing reagents for detecting Angptl8 expression levels to assess the degree of aging and diagnose aging-related diseases.
The Angptl8 gene knockout mouse model significantly delays the aging process on multiple levels, improves memory decline and behavioral impairment during aging, and provides broad scientific research and clinical translational value. The Angptl8 gene can serve as an intervention target and diagnostic biomarker for aging.
Smart Images

Figure CN121570593A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of life science and biomedical technology, and in particular relates to the application of substances targeting Angptl8 in the preparation of drugs for treating and delaying aging. Background Technology
[0002] Aging is a complex physiological process involving the gradual decline of multiple system functions and is one of the root causes of various chronic diseases, such as metabolic syndrome, neurodegenerative diseases, and skeletal muscle dysfunction. Current anti-aging research focuses on areas such as calorie restriction, antioxidant intervention, or regulation of signaling pathways (such as mTOR and SIRT1), but there is still a lack of key molecules with clearly defined targets, clear mechanisms of action, and clinical translational potential.
[0003] Angptl8 (Angiopoietin-like protein 8) is a liver-derived and adipose-derived secretory protein. Traditional research suggests that it primarily participates in lipid metabolism regulation by inhibiting lipoprotein lipase (LPL) activity. Recent studies have hinted that Angptl8 may be involved in age-related metabolic changes, but whether it directly regulates the aging process remains inconclusive. Currently, there are no studies based on Angptl8 loss-of-function models to investigate its role in physiological aging, nor are there any publicly available technologies for delaying aging by knocking out Angptl8 genes. Summary of the Invention
[0004] The purpose of this invention is to provide the application of substances targeting Angptl8 in the preparation of drugs for treating and delaying aging. Through systematic and in-depth research, this invention is the first to discover that the Angptl8 gene plays a crucial regulatory role in the occurrence and progression of normal aging and age-related diseases. Further experiments have confirmed that inhibiting or downregulating Angptl8 gene expression can significantly delay the aging process and effectively improve manifestations such as memory decline and behavioral impairment that occur during aging. Therefore, the Angptl8 gene can serve as an important intervention target for aging and related diseases, both for developing drugs with anti-aging or therapeutic effects and as a biomarker for assessing the degree of aging and for the diagnosis and prognosis of age-related diseases, demonstrating broad application prospects and clinical translational value.
[0005] To achieve the above objectives, this application adopts the following technical solution: In a first aspect, the present invention provides the application of substances targeting Angptl8 in the preparation of drugs for treating and delaying aging, wherein targeting Angptl8 refers to reducing the expression of the Angptl8 gene by gene knockout or gene reduction.
[0006] Secondly, this invention provides the application of Angptl8 gene inhibitors in the preparation of drugs for treating and delaying aging.
[0007] In the above technical solutions, the Angptl8 gene inhibitor includes reagents that knock down or silence Angptl8.
[0008] Thirdly, the present invention provides a reagent for detecting Angptl8 expression levels for use in the preparation of products for assessing aging.
[0009] In the above technical solutions, the product includes reagents or kits.
[0010] Fourthly, this invention provides a reagent for detecting Angptl8 expression levels for use in the preparation of products for the diagnosis or prognostic assessment of aging-related diseases.
[0011] Fifthly, this invention provides a method for constructing an Angptl8 gene knockout mouse model, which uses CRISPR / Cas9 gene editing technology to target and delete key exon regions of the mouse Angptl8 gene, thus successfully constructing an Angptl8 gene knockout mouse model.
[0012] Sixthly, this invention provides the application of the Angptl8 gene knockout mouse model constructed using the above-described method in the study of the mechanisms of aging-related diseases.
[0013] In a seventh aspect, the present invention provides the application of the Angptl8 gene knockout mouse model constructed using the above-described construction method in the research of screening therapeutic drugs or interventions for aging-related diseases.
[0014] Eighthly, the present invention provides a medicament for delaying aging, the medicament comprising an active ingredient and pharmaceutically acceptable excipients, the active ingredient comprising a reagent that inhibits the expression of the Angptl8 gene.
[0015] The beneficial effects of this invention are as follows: 1. This invention is the first to demonstrate that Angptl8 can promote the aging process of multiple tissues and organs in vivo. Its role involves not only exocrine signals, but may also directly participate in aging signal transduction through intracellular binding to the AKT / mTOR signaling pathway.
[0016] 2. The Angptl8 gene knockout mouse model constructed in this invention exhibits advantages such as delaying aging, improving tissue structure, and maintaining functional status throughout the entire aging cycle. This model can serve as a core tool for animal aging delay research and has broad scientific research and clinical translational value. Attached Figure Description
[0017] Figure 1: Schematic diagram of the strategy for constructing Angptl8 knockout mice.
[0018] Figure 2 : Comparison of sequencing results before and after knockout. Where: Query is the wild-type genome sequence, and Subject is the actual sequencing result.
[0019] Figure 3 The level of circulating Angptl8 increases with age during aging. Data is from the China Cardiometabolic Disease and Cancer Cohort Study (4C) database.
[0020] Figure 4 During aging, the expression level of Angptl8 in adipocytes and other tissues in human adipose tissue increases. (Data source: GSE235529 database)
[0021] Figure 5 The expression level of Angptl8 in the circulation of mice gradually increases during aging, while the Angptl8 level in Angptl8 knockout mice decreases to almost zero.
[0022] Figure 6 The appearance of aging wild-type mice and knockout homozygous mice was compared with CT scans, and the knockout homozygous mice showed a reduced degree of aging.
[0023] Figure 7 Comparing the mineral content (BMC) per unit volume of femoral head tissue between aging wild-type mice and knockout homozygous mice, knockout homozygous mice had a higher BMC content.
[0024] Figure 8 Comparing the mineral density (BMD) per unit volume of femoral head tissue between aging wild-type mice and knockout homozygous mice, knockout homozygous mice had a higher BMC density.
[0025] Figure 9 Record the body weight of Angptl8 knockout homozygous and wild-type mice from young (around 4 months) to old (around 22 months).
[0026] Figure 10 Comparison of organ weights between aging wild-type mice and knockout homozygous mice at 22 months of age: knockout homozygous mice had lighter adipose tissue and heavier skeletal muscle.
[0027] Figure 11 mRNA levels of the aging gene P16 in adipose tissue and skeletal muscle of wild-type mice and knockout homozygous mice.
[0028] Figure 12mRNA levels of the aging gene P21 in adipose tissue and skeletal muscle of wild-type mice and knockout homozygous mice.
[0029] Figure 13 Protein levels of the aging gene P16 in adipose tissue and skeletal muscle of wild-type mice and knockout homozygous mice.
[0030] Figure 14 Protein levels of the aging gene P21 in adipose tissue and skeletal muscle of wild-type mice and knockout homozygous mice.
[0031] Figure 15 The proportion of fast and slow muscle groups in the skeletal muscle of wild-type and knockout homozygous mice.
[0032] Figure 16 SA-β-gal staining of third-generation primary adipocytes from wild-type and knockout homozygous mice in vitro.
[0033] Figure 17 SA-β-gal staining of fifth-generation primary adipocytes from wild-type and knockout homozygous mice in vitro.
[0034] Figure 18 Results of open field experiments on wild-type and knockout homozygous mice.
[0035] Figure 19 Results of the rotating rod experiment on wild-type mice and knockout homozygous mice. Detailed Implementation
[0036] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below in conjunction with specific embodiments. This invention can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the inventive concept to those skilled in the art. This invention will be defined only by the claims.
[0037] Unless otherwise specified, the test methods or experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are obtained from conventional commercial sources or prepared by conventional methods.
[0038] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0039] This invention, through systematic analysis of the 4C database, discovered that the Angptl8 gene is expressed in the liver and adipose tissue and secreted into the peripheral blood, with its expression level gradually increasing with age. Further experiments in mice of different ages confirmed that Angptl8 gene expression was significantly higher in aging mice than in younger mice.
[0040] Functional studies revealed that wild-type mice consistently increased in weight with age, while Angptl8 knockout mice had significantly lower body weight in older mice compared to the wild-type control group; however, in younger mice, there was no significant difference in body weight between knockout and control mice. Furthermore, Angptl8 knockout significantly improved motor function in older mice and effectively alleviated their age-related anxiety-like behaviors.
[0041] In terms of mechanism, this study proposes Angptl8 as a novel mechanism of action for a potential aging-regulating molecule. The research found that Angptl8 protein can bind to AKT2 protein and regulate AKT2 activity, thereby affecting cellular aging-related pathways. The results indicate that Angptl8 plays a key regulatory role in physiological and pathological aging processes and can serve as an important target for intervening in aging and promoting healthy aging, showing promising prospects for drug development and clinical translation.
[0042] This invention constructs an Angptl8 gene knockout mouse model ( The study found that this model exhibits significant anti-aging effects across multiple dimensions. It significantly outperforms wild-type mice in several aspects, including aging phenotypes, motor function, organ degeneration, and expression of aging molecular markers. This model can be widely used for research on anti-aging mechanisms, candidate drug screening, and the establishment of intervention models for age-related diseases.
[0043] This invention includes the following: 1. Methods for constructing the Angptl8 gene knockout mouse model: (1) Using CRISPR / Cas9 gene editing technology, the key exon region of the mouse Angptl8 gene was deleted, and Angptl8 systemic knockout mice were successfully constructed.
[0044] (2) The resulting mice were based on the C57BL / 6J background line to ensure consistency with conventional experimental animals. (3) The mice were identified by genotype and verified by protein level, confirming that Angptl8 was completely knocked out.
[0045] 2. Experimental Design Structure: (1) Mice were divided into knockout groups from 4 months of age ( The control group (WT) was matched by sex.
[0046] (2) Long-term monitoring includes weight, survival rate, and behavioral capacity.
[0047] (3) Samples were taken in batches at 20 months of age to detect tissue aging markers (P16, P21 expression) and changes in muscle and fat structure.
[0048] (4) Some mice were kept in the pens until they died naturally, and their lifespan was recorded.
[0049] 3. Observation of aging phenotypes: (1) WT mice showed signs of aging at 24 months of age, including whitening and loss of hair, shrinkage of body size, and increased kyphosis.
[0050] (2) Mice, on the other hand, retained their shiny fur, had a plump body, and showed a significantly delayed aging process.
[0051] 4. Tissue and molecular level evaluation: (1) In iWAT and soleus muscle, The expression of P16 and P21 in mice was significantly lower than that in the WT group.
[0052] (2) The cross-sectional area of the muscles is larger and the proportion of fast-twitch muscles is higher, suggesting that the decline of skeletal muscle function is slowed down.
[0053] (3) Open field experiment, rotatable bar experiment and treadmill test showed that its motor ability and exploratory behavior were better than those of WT old rats.
[0054] 5. Cell-level validation: (1) Extract WT and Primary preadipocytes from mouse adipose tissue were passaged continuously in vitro.
[0055] (2) The number of WT cells increased significantly with passage of SA-β-Gal positive cells, while the cell senescence phenotype of the knockout group was delayed.
[0056] (3) This suggests that Angptl8 can directly induce cell senescence, which is unrelated to systemic metabolic factors.
[0057] Experimental procedure: 1. Construction of Angptl8 Knockout Mice using CRISPR / Cas9: To study the function of Angptl8 in aging, this invention uses CRISPR / Cas9 gene editing technology to construct systemic Angptl8 knockout mice. A schematic diagram of the construction strategy is shown below. Figure 1 As shown. The specific method is as follows: (1) Specific gRNA sequences targeting the coding region (exon) of the mouse Angptl8 gene were designed (see Table 1), and the corresponding gRNA templates were synthesized. Cas9 mRNA and gRNA were obtained using an in vitro transcription system. After purification and quality testing, they were prepared for microinjection. The Cas9 mRNA and gRNA were mixed and injected into single-cell fertilized eggs of C57BL / 6J mice via microinjection. After injection, the embryos were transferred to the uterus of recipient pseudopregnant mice for development, resulting in the birth of F0 generation mice.
[0058] The target gene name (Ensembl number) is: Angptl8 (ENSMUSG00000047822).
[0059] The transcript targeted by the protocol (Ensembl number): Angptl8-201 (ENSMUST00000058777.7).
[0060] Flox targets exons 1-4.
[0061] Table 1: gRNA sequence information
[0062] (2) Genotyping of F0 generation mice: tail tissue was collected, genomic DNA was extracted, specific primers were designed to amplify the Angptl8 site by PCR, and the gene editing effect was analyzed by Sanger sequencing to screen out positive F0 generation individuals with insertion / deletion mutations (leading to frameshift and loss of function in the protein coding region).
[0063] 1) PCR products from F0 generation mice were sequenced. The positive F0 generation mouse was mouse number 4. The mutated genome sequence is shown in Table 2 below: Table 2: Sequence Mutation Status of F0 Generation Mice
[0064] 2) PCR identification method for positive F0 generation mice Primer information is as follows: Forward (5' -->3'): ACCGCAACCTCAGAGTGTAACG (SEQ ID NO.5) Reverse (5' -->3'): GCTGGGCAAGTGAGGTCCGATAAG (SEQ ID NO.6) The reaction system is shown in Table 3 below: Table 3 Reaction System
[0065] * PrimeStar GXL (TaKaRa, Code No: R050A) The reaction system is shown in Table 4 below: Table 4 Reaction Time
[0066] (3) Positive F0 generation mice were mated with wild-type C57BL / 6J mice to obtain F1 generation mice, and PCR amplification and sequencing identification were repeated. Finally, four positive F1 generation mice with Angptl8 gene knockout were obtained for subsequent breeding and experiments.
[0067] 1) The obtained F1 generation heterozygous mice were of one type: knockout type 1, with a deletion of 1844 base pairs. The final information of the F1 generation heterozygous mice is shown in Table 5 below: Table 5 Information on F1 generation heterozygous mice
[0068] 2) Sequence alignment before and after knockout: WT: Ctgtgttggatgtgaagggagccacgttctacacttagatgggaaactgaggctcaaggcagtgatatgctcatacagacactggcgctgagagctctggtctgagcttgcccactacctccaacccccacacacagctggccctgagttctagcagcgtgatatcagcatggcctgcttagccatcagtct gatgcaatggctgagcct…..CCAGCCTGAGACTACCTGGATGCCACCGAGGACCAGTTGTGCTGCAAGGAACACTGAAGCGCTCCACCAGGCCCATGAACAGGGCTGACAGAGCCGGCTGCCCATCAGCTGGACCTGGCCAGTGCACCCCGCTTCCTGGCAGAGCGGAGACAGAAGCAAGCAGGCGGGATG MT: Actgggcctgctgtgttggatgtgaagggagccacgttctacacttagatgggaaactgaggctcaaggcagtgatatgctcatacagacactggcgctgagagctctggtctgagcttgcccactacctc caa….(-1844bp)….ACAGGGCTGACAGAGCCGGCTGCCCATCAGCTGGACCTGGCCAGTGCACCCCGCTTTCCTGGCAGAGCGGAGACAGAAGCAAGCAGGCGGGATGGAAGGCAGAAGACAGAGCCCTGT 3) Comparison of sequencing results before and after knockout, see Figure 2 As shown.
[0069] 4) Gene function analysis before and after knockout In this mouse strain, the changes in the protein encoded by the target gene before and after gene knockout are shown below: WT: MAVLALCLLWTLASAVRPAPVAPLGGPEPAQYEELTLLFHGALQLGQALNGVYRATEARLTEAGHSLGLYDRALEFLGTEVRQGQDATQELRTSLSEIQVEEDALHLRAEATARSLGEVARAQQALRDTVRRLQVQLRGAWLGQAHQEFETLKARADKQSHLLWALTGHVQRQQREMAEQQQWLRQIQQRLHTAALPA MT: None The entire animal handling process complied with national regulations on laboratory animal ethics review, and the gene editing and reproduction process was completed in an SPF-grade animal facility.
[0070] 2. Primary Adipocyte Culture: Eight-week-old male C57BL / 6J mice were sacrificed, and subcutaneous adipose tissue or intraperitoneal fat pads (such as mesenteric or retroperitoneal fat) were rapidly isolated. The tissue was aseptically minced and placed in a digestion solution containing 1 mg / mL collagenase I (dissolved in PBS and supplemented with 1% fetal bovine serum). Digestion was performed at 37°C with shaking in a water bath for 30–45 minutes. After digestion, the cell suspension was filtered through a 100 μm filter, and the filtrate was collected and centrifuged (500 × g, 10 minutes, 4°C). The supernatant was discarded, and the precipitate was a mixture of cells containing preadipocytes and stromal vascular fraction (SVF). The precipitate was resuspended in preheated DMEM / F12 medium, supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin, and seeded into 6-well plates or culture flasks. The cells were incubated at 37°C in a 5% CO2 incubator. After 24 hours, the medium was replaced, and non-adherent cells were removed. Once the cells have grown to 80-90% confluence, induction differentiation experiments or other subsequent treatments can be performed.
[0071] 3. Mouse Rotating Bar Test: To assess the motor coordination and balance of mice, a rotating bar device was used. Before the experiment, 8-week-old or 24-month-old male C57BL / 6J mice were acclimatized to the test environment for 30 minutes. The experiment was conducted in a quiet environment with the room temperature maintained at 22–25°C. All mice were trained twice daily for 3 consecutive days before the test to familiarize them with the rotating bar. A fixed rotation speed (e.g., 5 rpm) was set during the training phase, and each training session lasted no more than 300 seconds. During the formal test, the rotating bar was accelerated uniformly from 4 rpm (e.g., accelerating to 40 rpm per minute), and the time it took for the mouse to fall off the rotating bar (dwell time, in seconds) was recorded. Each mouse was tested three times consecutively, with an interval of at least 15 minutes to avoid fatigue. The average of the three tests was used for statistical analysis. During the test, if a mouse jumped off voluntarily or fell involuntarily, the timing was stopped immediately. After the experiment, the equipment was cleaned with 75% ethanol to prevent odor interference with other animals.
[0072] 4. The open field test was used to assess the activity level and anxiety-like behavior of mice. The experimental setup consisted of a black acrylic cube (40 cm × 40 cm base, 40 cm height), with the bottom divided into a central area and a peripheral area. Mice were acclimatized to the environment for 30 minutes before the experiment, then placed in the center of the setup and allowed free movement for 5 minutes, during which their movement trajectory and activity data were recorded using a video tracking system. After each experiment, the setup was thoroughly cleaned with 75% alcohol to avoid odor interference. The mice's behavioral status was assessed by analyzing indicators such as the time spent in the central area, total movement distance, and movement speed, and differences between different groups were compared.
[0073] 5. Single-cell RNA sequencing data analysis: This invention uses Python to analyze single-cell RNA sequencing data, primarily based on the Scanpy (version 1.9.6) bioinformatics toolkit. The analysis process is as follows: Data preprocessing: Raw sequencing data (10X Genomics platform) undergoes initial quality control and alignment using Cell Ranger to obtain a gene-cell expression matrix (h5 or mtx format). Scanpy is used to read the expression matrix and perform the following preprocessing operations: Quality control filtering: Low-quality cells are filtered out, removing cells with fewer than 200 genes or a mitochondrial gene ratio higher than 10%; genes expressed in fewer than 3 cells are also removed. Normalization and logarithmic transformation: The expression matrix is normalized to a total count (each cell is normalized to 10,000 counts), followed by log1p logarithmic transformation. High-variability gene selection: High-variability genes (top 2000) are identified based on the coefficient of variation for subsequent dimensionality reduction analysis. Dimensionality reduction and clustering: PCA dimensionality reduction: PCA is performed on the high-variability genes, retaining the top 30 principal components. Adjacency Graph Construction and Clustering: A k-nearest neighbor graph (n_neighbors=10) was constructed based on PCA results, and cell clustering was performed using the Louvain or Leiden algorithm (resolution=0.5–1.0). UMAP Visualization: UMAP dimensionality reduction was performed based on the adjacency graph, and the cell cluster distribution was visualized. Marker Gene Analysis and Cell Type Annotation: Differential expression analysis (Wilcoxon rank-sum test) was performed using the rank_genes_groups function in Scanpy to identify cluster-specific marker genes, and cell type annotation was performed in conjunction with literature or known cell marker genes. Specific Gene Expression Analysis: Target genes (such as Angptl8) were selected, and their expression distribution in various cell types was plotted (dot plot, violin plot, or feature plot), and their expression levels in specific cell populations were quantitatively analyzed. Image and Statistical Processing: All visualizations were generated using matplotlib and seaborn (Python), with a uniform resolution of 300 dpi. Statistical analysis was performed in Python or R, with a p-value <0.05 considered significant.
[0074] 6. ELISA Kit Detection: The expression levels of various target proteins in plasma were detected using a commercially available enzyme-linked immunosorbent assay (ELISA) kit. The experiment was performed according to the kit instructions. Peripheral blood from different groups of mice was anticoagulated and centrifuged to separate plasma samples. All reagents and samples were equilibrated at room temperature before use, and a standard curve was prepared using a gradient of standard concentrations. Samples and standards were added to the ELISA plate and incubated. After washing, enzyme conjugate and substrate solutions were added sequentially for color development. Finally, stop solution was added, and the absorbance values of each well were read at 450 nm. The concentration of the target protein in the sample was calculated based on the standard curve, and statistical analysis was performed to compare the expression differences between different groups.
[0075] 7. mRNA Level Detection: Total RNA was extracted from tissues using Trizol reagent according to the instructions, and cDNA was obtained by reverse transcription. The mRNA expression level of the target gene was detected using the SYBR Green real-time quantitative PCR system, with GAPDH as an internal reference gene. The results were analyzed using the ΔΔCt method and normalized to compare the relative expression differences between different samples.
[0076] 8. Protein Level Detection: Tissue protein was extracted using a homogenization method. Lysis buffer was added, and the mixture was ultrasonically disrupted to extract total protein. Protein concentration was determined using the BCA method. Equal volumes of protein were separated by SDS-PAGE electrophoresis, transferred to a PVDF membrane, and blocked. The target protein was detected using a primary antibody incubation method. Anti-Angptl8 antibody and anti-β-actin antibody were used as internal controls. ECL luminescence imaging was performed, and bands were photographed and analyzed for grayscale to compare protein expression levels in different samples.
[0077] 9. Fluorescent staining of skeletal muscle (fast and slow muscle): Mouse skeletal muscle was washed with PBS, embedded in OCT, and flash-frozen in liquid nitrogen. Frozen sections (8–10 μm) were prepared. After blocking with 5% normal goat serum, sections were incubated overnight at 4°C with primary antibodies (anti-slow muscle MyHC, anti-fast muscle MyHC). After washing with PBS, fluorescently labeled secondary antibodies (Alexa Fluor 488 / 594) were added, and the sections were incubated at room temperature in the dark for 1 h. Cell nuclei were counterstained with DAPI, mounted with anti-quenching mounting medium, and observed under a fluorescence microscope.
[0078] Experimental results: 1. The relationship between Angptl8 expression levels and aging This invention first uses a population 4C database analysis to extract plasma proteomic data from individuals of different age groups, and then employs statistical methods to assess the correlation between Angptl8 protein expression levels and age. The results show that Angptl8 expression significantly increases with age. Figure 3 ).
[0079] Angptl8 gene expression is very widespread, appearing in tissues such as adipose tissue. Therefore, we used single-cell sequencing datasets of adipose tissue from both older and younger individuals for analysis. We found that Angptl8 expression in adipocytes increases significantly with age. Figure 4 To further verify the relationship between Angptl8 levels and age, we used 8-week-old (juvenile group) and 24-month-old (senior group) male C57BL / 6J mice in an animal model, with n≥5 in each group. Liver tissue, subcutaneous adipose tissue, and peripheral plasma samples were collected. Angptl8 expression was detected at both mRNA and protein levels. All animals were kept under standard SPF conditions and fasted for 6 hours before sampling. We also found that Angptl8 expression increased synchronously with increasing aging. Figure 5 ).
[0080] In summary, these results systematically validated the continuously increasing expression trend of Angptl8 during aging through three levels: population databases, human fat cell sequencing, and mouse assays, suggesting its important role in aging regulation. Furthermore, these results indicate that Angptl8 can be targeted for the diagnosis and prognostic assessment of aging or age-related diseases.
[0081] 2. Knocking out Angptl8 can delay aging in mice. To investigate the regulatory role of the Angptl8 gene in aging, this invention constructed Angptl8 knockout mice using the CRISPR / Cas9 method. To detect aging indicators in mice, homozygous Angptl8 knockout mice were bred to obtain homozygous and wild-type Angptl8 knockout mice within the same litter. Observation of the appearance and CT scans of 22-month-old mice revealed that, compared to homozygous knockout mice, wild-type mice exhibited more severe hair loss, an increased proportion of white hair, and age-related cataracts. CT scans also showed more severe kyphosis in wild-type mice. Figure 6 Using CT scans of the femoral heads of mice, we found that osteoporosis was more severe in wild-type mice. Figure 7 , Figure 8 This study analyzed the aging process of Angptl8 knockout homozygous and wild-type mice. The results showed that wild-type mice exhibited age-dependent weight gain. While the weight difference between Angptl8 knockout homozygous and wild-type mice was not significant in their youth, the weight of Angptl8 knockout mice was significantly lower than that of wild-type mice in old age. Figure 9 We found that the main differences in body weight between wild-type and knockout homozygous mice were in adipose tissue weight and skeletal muscle weight. Figure 10Therefore, we examined aging markers in adipose tissue and skeletal muscle and found that the expression levels of aging-related markers P16 and P21 in adipose tissue and skeletal muscle were significantly decreased in knockout homozygous mice. Figure 11 , Figure 12 , Figure 13 , Figure 14 By examining the proportion of fast and slow muscle fibers in the skeletal muscle of mice, it was found that the proportion of fast muscle fibers in the skeletal muscle of knockout homozygous mice was much higher than that of wild mice, suggesting that their skeletal muscle motor ability was stronger and their aging rate was lower. Figure 15 Primary adipocyte cultures extracted from wild-type and knockout homozygous mice revealed a significantly reduced level of senescence in adipocytes from knockout homozygous mice. Figure 16 , Figure 17 By examining the motor function and age-related anxiety levels of aged mice in the open field test, we found that Angptl8 knockout mice exhibited a greater range of movement in the open field test. Figure 18 ), and those who tend to spend more time in the central region express lower levels of anxiety ( Figure 18 The rotating rod experiment showed that knockout homozygous mice could persist for a longer time on a rotating rod with a faster rotation speed. Figure 19 The results suggest that their skeletal muscles are stronger and their aging levels are lower. These results indicate that Angptl8 gene knockout can delay the aging process in mice, improve the motor function of older mice, and reduce age-related anxiety levels.
[0082] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. The application of substances targeting Angptl8 in the preparation of drugs for treating and delaying aging, characterized in that: The term "targeting Angptl8" refers to methods such as gene knockout or gene reduction to reduce the expression of the Angptl8 gene.
2. Application of Angptl8 gene inhibitors in the preparation of drugs for treating and delaying aging.
3. The application according to claim 2, characterized in that: The Angptl8 gene inhibitors include agents that knock down or silence Angptl8.
4. Reagents for detecting Angptl8 expression levels are used in the preparation of products for assessing the degree of aging.
5. The application according to claim 4, characterized in that: The products include reagents or kits.
6. Reagents for detecting Angptl8 expression levels are used in the preparation of products for the diagnosis or prognostic assessment of aging-related diseases.
7. A method for constructing an Angptl8 gene knockout mouse model, characterized in that: Using CRISPR / Cas9 gene editing technology, a key exon region of the mouse Angptl8 gene was targeted and deleted, thus successfully constructing an Angptl8 gene knockout mouse model.
8. The application of the Angptl8 gene knockout mouse model constructed using the construction method described in claim 7 in the study of the mechanism of aging-related diseases.
9. The application of the Angptl8 gene knockout mouse model constructed using the method described in claim 7 in the study of screening therapeutic drugs or interventions for aging-related diseases.
10. A drug for delaying aging, characterized in that: The drug comprises an active ingredient and pharmaceutically acceptable excipients, the active ingredient including a reagent that inhibits Angptl8 gene expression.