Bacillus sonolani serving as genetic engineering chassis bacterium and application of bacillus sonolani
By screening and modifying Bacillus sonoran, and using corn cob hydrolysate as a carbon source for fermentation, the problem of poor tolerance of existing Bacillus strains to industrial waste has been solved, achieving cost savings and improved enzyme activity, making it suitable for the application of genetically engineered chassis bacteria.
Patent Information
- Application Number
- CN202511652686.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-12
- Publication Date
- 2026-02-27
AI Technical Summary
Existing Bacillus subtilis and Bacillus amyloliquefaciens have poor tolerance to industrial waste carbon sources such as corn cob hydrolysate, resulting in high industrial production costs.
A strain of Bacillus sonorensis C3 is provided, which is resistant to high temperature and salt. It can use corn cob hydrolysate as a carbon source for fermentation and can be genetically modified using genetic tools to construct recombinant Bacillus sonorensis Bso-PHY-DPE.
Fermentation using corn cob hydrolysate (an agricultural waste product) as a carbon source was achieved, reducing production costs. Furthermore, the recombinant Sonoran Bacillus exhibited enzyme activity comparable to that of recombinant Bacillus subtilis and recombinant Bacillus amyloliquefaciens during fermentation, demonstrating high potential for industrial applications.
Smart Images

Figure CN121574860A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial engineering technology, and specifically relates to a Sonoran Bacillus used as a genetically engineered chassis bacterium and its applications. Background Technology
[0002] Bacillus species, such as Bacillus subtilis ( Bacillus subtilis ), Bacillus licheniformis ( B. licheniformis ), Bacillus brevis ( B. pumilus ), Bacillus amyloliquefaciens ( B. amyloliquefaciens Bacillus subtilis and other bacteria are widely studied and used in industry. Among them, Bacillus subtilis is the most studied Gram-positive bacterium and is certified by the U.S. Food and Drug Administration (FDA) as a food safety microorganism, a typical industrial model microorganism for food safety. Due to its ease of cultivation and strong ability to secrete extracellular proteins, Bacillus has been widely used in metabolic engineering. In recent decades, Bacillus has been used for large-scale fermentation to produce various enzymes, including amylase and protease, as well as various chemical products such as D-ribose, vitamins, hyaluronic acid, and squalene. With the development of molecular biology techniques, various research strategies and tools have been applied to construct Bacillus for the synthesis of bioproducts.
[0003] Sonoran Bacillus ( B. sonorensis First isolated in 2001 from sandy soil in the Sonoran Desert, *Bacillus sonoran* and *Bacillus licheniformis* (… B. licheniformis They are closely related and can be distinguished by salt tolerance, pigment accumulation under different culture media, and differences in some conserved sequences in their genomes. Sonoran Bacillus possesses heat and salt tolerance, making it valuable for applications in agriculture and the food industry. Studies have confirmed that Sonoran Bacillus has the potential to induce plant growth and secrete bioactive compounds such as cellulases and extracellular polysaccharides. Furthermore, Sonoran Bacillus can produce surfactants, iturin, and fengycin, exhibiting surfactant properties and antifungal, antibacterial, antiviral, antitumor, and anti-inflammatory functions, demonstrating significant application potential.
[0004] Currently, the most common genetically engineered Bacillus substrate strains are Bacillus subtilis and Bacillus amyloliquefaciens. These two strains primarily use starch, wheat bran, soybean protein powder, and yeast powder as raw materials in industrial production. However, existing Bacillus subtilis and Bacillus amyloliquefaciens strains exhibit poor tolerance to industrial waste carbon sources such as corn cob hydrolysate. Summary of the Invention
[0005] The technical problem this invention aims to solve is to provide a Sonoran Bacillus strain for use as a genetically engineered substrate strain and its applications. Sonoran Bacillus is easy to cultivate and exhibits excellent high-temperature and salt tolerance. It can utilize agricultural waste corn cob hydrolysate as a carbon source for fermentation, making good use of resources and saving costs. Through genetic tool mining, it has been discovered that this Sonoran Bacillus can undergo genetic manipulation, thus serving as a novel substrate strain for genetically engineered Bacillus. Furthermore, because its fermentation process has relatively low material requirements, it can save costs during fermentation, thus possessing high industrial application value.
[0006] The present invention is achieved by providing a Bacillus sonorensis C3 for use as a genetically engineered chassis bacterium, which was deposited on November 28, 2024, at the China Center for Type Culture Collection in Wuhan, China, with accession number CCTCC No: M20242660.
[0007] This invention is implemented as follows, and also provides a method for screening Sonoran Bacillus as described above for use as a genetically engineered chassis bacterium, comprising the following steps: Take 5g of vineyard soil sample, add ultrapure water and stir, then soak for 1 hour; filter twice with filter paper, and take the filtrate, dilute it 10 times, 100 times, 1000 times and 10000 times successively; take the 10000 times dilution and spread it on solid LB agar plates, and incubate at 37℃ upside down for 24-48 hours until colonies grow; pick a single colony, inoculate it into liquid LB agar, and incubate overnight at 37℃ and 220 rpm, then send the bacterial culture for sequencing identification; after 16S rRNA and rhoB gene sequencing, the sequence was compared with the NCBI database, and the results showed that the isolated strain belonged to Sonoran Bacillus; take 1mL of the liquid culture of this strain, then add an equal volume of 50% glycerol, and store at -80℃; The solid LB medium consisted of 10.0 g / L peptone, 10.0 g / L yeast extract, 5.0 g / L NaCl, and 12 g / L agar; the liquid LB medium consisted of 10.0 g / L peptone, 10.0 g / L yeast extract, and 5.0 g / L NaCl. 10 mL of the medium was added to a 50 mL Erlenmeyer flask for culturing.
[0008] The present invention is implemented in such a way that it also provides a product comprising Sonoran Bacillus as described above as a genetically engineered chassis bacterium.
[0009] This invention is implemented as follows, and also provides a method for constructing recombinant Bacillus subtilis, recombinant Bacillus amyloliquefaciens, and recombinant Bacillus sonoran, comprising the following steps: Step 1. The plasmid PHY300PLK (Takara Bio) was double-digested with restriction endonucleases HindIII and EcoRI to obtain the vector fragment; Step 2. Using primers P1 and P2, and the synthesized gene as a template, PCR amplification of dpe (Accession Number WP_015924461.1) was performed to obtain the target gene fragment dpe (908bp). Step 3. Using primers P3 and P4, with the Bacillus subtilis genome as a template, PCR amplification was performed to synthesize promoter fragment P43 (350bp). Step 4. Using primers P3 and P2, and with gene fragment dpe and promoter fragment P43 as templates, PCR amplification was performed to fuse the two fragments, resulting in fragment P43-dpe (1234p). Step 5. The above vector fragment and fragment P43-dpe were ligated seamlessly, the cloning product was transformed into the cloning host Escherichia coli DH5α, positive transformants were screened, plasmids were extracted, and the recombinant artificial expression vector PHY300PLK-dpe (6022bp) was obtained. Step 6. The plasmid PHY300PLK-dpe was electrotransformed into Bacillus subtilis, Bacillus amyloliquefaciens, and Bacillus sonoran. Positive transformants were then screened on solid plates containing tetracycline. After colony PCR and sequencing verification, recombinant Bacillus subtilis Bsu-PHY-DPE, recombinant Bacillus amyloliquefaciens Bam-PHY-DPE, and recombinant Bacillus sonoran Bso-PHY-DPE were obtained, respectively.
[0010] This invention is implemented in the following way, and also provides an application of preparing xylose or D-allulose using recombinant Bacillus subtilis, recombinant Bacillus amyloliquefaciens, or recombinant Sonoran Bacillus.
[0011] Compared with existing technologies, the present invention relates to *Bacillus sonoran* used as a genetically engineered substrate bacterium and its applications. *Bacillus sonoran* was deposited on November 28, 2024, at the China Center for Type Culture Collection (CCTCC) in Wuhan, China, with accession number CCTCC No: M20242660. After domestication, *Bacillus sonoran* can grow and ferment using corn cob hydrolysate as a carbon source. Furthermore, *Bacillus sonoran* was used as a substrate bacterium to introduce an artificial expression vector to construct an engineered *Bacillus sonoran* bacterium. After screening, recombinant *Bacillus sonoran* Bso-PHY-DPE was obtained. After conventional shake-flask fermentation, its enzyme activity was measured at 32.3 U / mL, comparable to that of recombinant *Bacillus subtilis* and recombinant *Bacillus amyloliquefaciens*. After shake-flask fermentation using corn cob hydrolysate as a carbon source, the enzyme activity of recombinant *Bacillus sonoran* Bso-PHY-DPE was measured at 31.3 U / mL. It has been confirmed that the genetically modified Sonoran Bacillus can be used as an engineered bacterium to produce enzymes and can use agricultural waste as a carbon source for fermentation, thus saving material costs. Attached Figure Description
[0012] Figure 1 This is a schematic diagram of the electrophoresis of the artificial expression vector PHY300PLK-dpe in Embodiment 2 of the present invention; Figure 2 The OD values of recombinant Bacillus subtilis Bsu-PHY-DPE, recombinant Bacillus amyloliquefaciens Bam-PHY-DPE, and recombinant Sonoran Bacillus Bso-PHY-DPE in Example 3 of this invention are... 600 Measurement results; Figure 3 The results of DPE enzyme activity assays for recombinant Bacillus subtilis Bsu-PHY-DPE, recombinant Bacillus amyloliquefaciens Bam-PHY-DPE, and recombinant Sonoran Bacillus Bso-PHY-DPE in Example 3 of this invention; Figure 4 This figure shows the carbon source utilization of recombinant Sonoran Bacillus during 24h shake-flask culture using 10% corn cob hydrolysate as a carbon source in Example 4 of the present invention. In the figure, glc is the glucose curve and xyl is the xylose curve. Figure 5 This is a description of the growth of recombinant Sonoran Bacillus during a 24-hour shake-flask culture using 10% corn cob hydrolysate as a carbon source in Example 4 of the present invention. Figure 6 The results of DPE enzyme activity assay of recombinant Sonoran Bacillus during 24h shake-flask culture using 10% corn cob hydrolysate as a carbon source in Example 4 of this invention. Detailed Implementation
[0013] To make the technical problems, solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0014] Example 1: Screening and identification of Sonoran Bacillus The preferred embodiment of the present invention is Sonoran Bacillus used as a genetically engineered chassis bacterium, which was deposited on November 28, 2024, at the China Center for Type Culture Collection in Wuhan, China, with accession number CCTCC No: M20242660.
[0015] This invention also discloses a method for screening Sonoran Bacillus as described above for use as a genetically engineered chassis bacterium, comprising the following steps: Take 5g of vineyard soil sample, add ultrapure water, stir, and soak for 1 hour; filter twice with filter paper, and take the filtrate, diluting it successively by 10, 100, 1000, and 10000 times; spread the 10000-fold dilution onto solid LB agar plates and incubate upside down at 37℃ for 24-48 hours until colonies grow; pick a single colony, inoculate it into liquid LB agar, and incubate overnight at 37℃ and 220 rpm, then send the bacterial culture for sequencing identification. Sequencing of 16S rRNA and rhoB genes, and sequence alignment with the NCBI database, showed that the isolated strain belongs to *Bacillus sonoranus*. Take 1mL of the liquid culture of this strain, add an equal volume of 50% glycerol, and store at -80℃.
[0016] The solid LB medium consisted of 10.0 g / L peptone, 10.0 g / L yeast extract, 5.0 g / L NaCl, and 12 g / L agar, and was cultured in 10 mL of medium added to a 50 mL Erlenmeyer flask. The liquid LB medium consisted of 10.0 g / L peptone, 10.0 g / L yeast extract, and 5.0 g / L NaCl.
[0017] The present invention also discloses a product comprising Sonoran Bacillus as described above as a genetically engineered chassis bacterium.
[0018] Specifically, the product is any one of bacterial liquid, enzyme agent, and antibacterial agent.
[0019] Example 2: Construction of recombinant Bacillus subtilis, recombinant Bacillus amyloliquefaciens, and recombinant Bacillus sonoran This invention also discloses a method for constructing recombinant Bacillus subtilis, recombinant Bacillus amyloliquefaciens, and recombinant Bacillus sonoran, comprising the following steps: Step 1. The plasmid PHY300PLK (Takara Bio) was double-digested with restriction endonucleases HindIII and EcoRI to obtain the vector fragment. The restriction endonucleases were purchased from Takara Bio, and the digestion was performed according to the restriction endonuclease instructions.
[0020] Step 2. Using primers P1 and P2, and the synthesized gene as a template, PCR amplification of dpe (Accession Number WP_015924461.1) was performed to obtain the target gene fragment dpe (908bp).
[0021] The synthesized gene fragments were synthesized by Beijing Qingke Biotechnology Co., Ltd. The enzyme used for PCR was 2×HighFidelity PCR Master Mix (Sangon Biotech). The PCR amplification system and amplification program are shown in Tables 1 and 2, respectively.
[0022] Table 1 PCR reaction system
[0023] Table 2 PCR amplification program
[0024] The sequence of P1: TAGGTAAGAGAGGAATGTACACATGAAACATGGTATATACTACGCATAT, The sequence of P2: TGATCCTTTTTTTATAACAGGAATTCTCAGGAGTGTTTATGACATTCTAATACA.
[0025] Step 3. Using primers P3 and P4, with the Bacillus subtilis genome as a template, PCR amplification was performed to synthesize promoter fragment P43 (350bp).
[0026] P3 sequence: TATGGAAAAACGCTTTGCCCAAGCTTTGATAGGTGGTATGTTTTCGCTTGA, P4 sequence: TGCGTAGTATATACCATGTTTCATGTGTACATTCCTCTCTTACCTA.
[0027] Step 4. Using primers P3 and P2, and with gene fragment dpe and promoter fragment P43 as templates, PCR amplification was performed to fuse the two fragments, resulting in fragment P43-dpe (1234p).
[0028] Step 5. The above vector fragment and fragment P43-dpe were ligated seamlessly. The cloning product was transformed into the cloning host *E. coli* DH5α, positive transformants were screened, and plasmids were extracted to obtain the recombinant artificial expression vector PHY300PLK-dpe (6022 bp). The cloning procedure was performed according to the ClonExpress Ultra One Step Cloning Kit instructions. The electrophoresis image of the recombinant artificial expression vector PHY300PLK-dpe is shown below. Figure 1 As shown.
[0029] Step 6. The plasmid PHY300PLK-dpe was electrotransformed into Bacillus subtilis, Bacillus amyloliquefaciens, and Bacillus sonoran. Positive transformants were then screened on solid plates containing tetracycline. After colony PCR and sequencing verification, recombinant Bacillus subtilis Bsu-PHY-DPE, recombinant Bacillus amyloliquefaciens Bam-PHY-DPE, and recombinant Bacillus sonoran Bso-PHY-DPE were obtained, respectively.
[0030] Example 3: Fermentation enzyme production and enzyme activity determination of recombinant Bacillus subtilis, recombinant Bacillus amyloliquefaciens, or recombinant Sonoran Bacillus. The recombinant Bacillus subtilis Bsu-PHY-DPE, recombinant Bacillus amyloliquefaciens Bam-PHY-DPE, and recombinant Sonoran Bacillus Bso-PHY-DPE constructed in Example 2 were subjected to fermentation enzyme production and enzyme activity assays, including the following steps: Step 31: Using an inoculation loop, recombinant Bacillus subtilis Bsu-PHY-DPE, recombinant Bacillus amyloliquefaciens Bam-PHY-DPE, and recombinant Sonoran Bacillus Bso-PHY-DPE were inoculated onto the solid LB medium of Example 1 via streak plating. The solid medium was then incubated at 37°C for 18–24 h. Afterward, a single colony was picked up using an inoculation loop and inoculated into 10 mL of liquid LB medium from Example 1. The culture was then incubated at 37°C and 220 rpm in a shaker for 20 h.
[0031] Step 32: Inoculate the activated bacterial solution obtained in Step 31 into the fermentation medium at an inoculum rate of 2%, and incubate at 33℃ and 280 rpm for 24 hours. Take samples to measure OD. 600 And enzyme activity. Figure 2 The OD values of recombinant Bacillus subtilis Bsu-PHY-DPE, recombinant Bacillus amyloliquefaciens Bam-PHY-DPE, and recombinant Sonoran Bacillus Bso-PHY-DPE were displayed. 600 Measurement results Figure 3The results show the DPE enzyme activity assays of recombinant Bacillus subtilis Bsu-PHY-DPE, recombinant Bacillus amyloliquefaciens Bam-PHY-DPE, and recombinant Sonoran Bacillus Bso-PHY-DPE.
[0032] The fermentation medium consisted of: 20 g / L glucose, 20 g / L soybean peptone, 15 g / L corn steep liquor powder, 1 g / L ammonium citrate, 12.54 g / L K₂HPO₄, 2.31 g / L KH₂PO₄, 1 g / L MgSO₄·7H₂O, and 1 mM CoCl₂·6H₂O; and 3 mL / L of trace element solution. 50 mL of the medium was added to a 250 mL Erlenmeyer flask for incubation. The trace element solution consisted of: 0.5 g / L CaCl₂, 0.18 g / L ZnSO₄·7H₂O, 0.1 g / L MnSO₄·H₂O, 10.05 g / L Na₂EDTA, 8.35 g / L FeCl₃, 0.16 g / L CuSO₄·5H₂O, and 0.18 g / L CoCl₂·6H₂O.
[0033] The DPE enzyme activity assay was performed as follows: At 60℃ and pH 7.5, using 100 g / L fructose in 800 µL of reaction solution as substrate, 200 µL of diluted enzyme solution was added, and the reaction was precisely controlled at 800 rpm / min for 10 min, followed by boiling for 5 min to terminate the reaction. Enzyme activity is defined as the amount of enzyme that generates 1 µmol of D-allulose within 1 min at 60℃ and pH 7.5. A Shimadzu SPD-20A high-performance liquid chromatography system, equipped with a RID-20A differential refractive index detector and a SUGAR SC1011 column, was used, with pure water as the mobile phase. The flow rate was set to 0.8 mL / min, column temperature to 80℃, detector temperature to 40℃, and injection volume to 10 μL. The amounts of D-fructose and D-allulose were determined using the external standard method based on peak retention time and peak area.
[0034] from Figure 3 It was found that after 24 hours of shake-flask fermentation, the enzyme activities of the three recombinant Bacillus strains reached 56.7 U / mL, 35.3 U / mL, and 32.3 U / mL, respectively. This confirms that several Bacillus strains successfully produced enzymes.
[0035] Example 4: Enzyme production by shake-flask fermentation using recombinant Sonoran Bacillus with corn cob hydrolysate as a carbon source. This invention also discloses an application of using recombinant Bacillus subtilis, recombinant Bacillus amyloliquefaciens, or recombinant Sonoran Bacillus to prepare xylose or D-allulose.
[0036] This embodiment 4 includes the following steps: Step 41: The preserved recombinant Sonoran Bacillus spp. culture was inoculated onto the solid LB medium of Example 1 using an inoculation loop via streak plating, and the solid medium was incubated in a 37°C incubator for 18-24 hours. Then, a single colony was picked up using an inoculation loop and inoculated into 10 mL of liquid LB medium from Example 1, and incubated in a shaker at 37°C and 220 rpm for 20 hours.
[0037] Step 42: The corn cob hydrolysate contains approximately 500-600 g / L xylose, 40-60 g / L glucose, and 40-60 g / L arabinose. Take the activated bacterial culture from Step 41 and inoculate it into the acclimatization medium at a dosage of 2%. Gradually increase the proportion of corn cob hydrolysate in the medium, setting the concentrations at 2%, 5%, and 10%, and culture two batches at each concentration. After acclimatization, the recombinant Sonoran Bacillus can enhance its tolerance to growth-inhibiting substances in the hydrolysate while improving xylose utilization.
[0038] The acclimatization culture medium was prepared as follows: 10.0 g / L peptone, 10.0 g / L yeast extract, 5.0 g / L NaCl, and additionally 2%, 5%, and 10% corn cob hydrolysate were added, and the pH was adjusted to 7.0. 50 mL of the culture medium was added to a 250 mL Erlenmeyer flask for incubation.
[0039] Step 43: Inoculate the activated bacterial solution into fermentation medium A at an inoculum rate of 2% and incubate at 33℃ and 280 rpm for 24 hours. Take samples to measure OD. 600 And enzyme activity.
[0040] The fermentation medium A consisted of: 10% corn cob hydrolysate, 10 g / L soybean peptone, 5 g / L corn steep liquor powder, 1 g / L ammonium citrate, 12.54 g / L K₂HPO₄, 2.31 g / L KH₂PO₄, 1 g / L MgSO₄·7H₂O, 1 mM CoCl₂·6H₂O, and 3 mL / L trace element solution. 50 mL of the medium was added to a 250 mL Erlenmeyer flask for incubation. The trace element solution contained: 0.5 g / L CaCl₂, 0.18 g / L ZnSO₄·7H₂O, 0.1 g / L MnSO₄·H₂O, 10.05 g / L Na₂-EDTA, 8.35 g / L FeCl₃, 0.16 g / L CuSO₄·5H₂O, and 0.18 g / L CoCl₂·6H₂O.
[0041] After culturing in shake flasks for 24 hours using 10% corn cob hydrolysate as a carbon source, the utilization rate of xylose in recombinant Sonoran Bacillus reached 59.8%. Figure 4As shown, this demonstrates promising application prospects. The growth of recombinant Sonoran Bacillus during 24 hours of shake-flask culture using 10% corn cob hydrolysate as a carbon source is illustrated below. Figure 5 As shown. The enzyme activity of recombinant Sonoran Bacillus reached 31.3 U / mL, as... Figure 6 As shown in the figure. The above experiments have confirmed that recombinant Sonoran Bacillus successfully produces enzymes after fermentation using corn cob hydrolysate.
[0042] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A Sonoran Bacillus strain used as a genetically engineered chassis bacterium, characterized in that, The Sonoran Bacillus was deposited on November 28, 2024, at the China Center for Type Culture Collection in Wuhan, China, with accession number CCTCC No: M20242660.
2. The method for screening Sonoran Bacillus as used as a genetically engineered chassis bacterium as described in claim 1, characterized in that, Includes the following steps: Take 5g of vineyard soil sample, add ultrapure water and stir, then soak for 1 hour; filter twice with filter paper, and take the filtrate, dilute it 10 times, 100 times, 1000 times and 10000 times successively; take the 10000 times dilution and spread it on solid LB agar plates, and incubate at 37℃ upside down for 24-48 hours until colonies grow; pick a single colony, inoculate it into liquid LB agar, and incubate overnight at 37℃ and 220 rpm, then send the bacterial solution for sequencing identification; after 16S rRNA and rhoB gene sequencing, the sequence was compared with the NCBI database, and the results showed that the isolated strain belonged to Sonoran Bacillus; The solid LB medium consisted of 10.0 g / L peptone, 10.0 g / L yeast extract, 5.0 g / L NaCl, and 12 g / L agar; the liquid LB medium consisted of 10.0 g / L peptone, 10.0 g / L yeast extract, and 5.0 g / L NaCl.
3. A product characterized in that, It contains Sonoran Bacillus as described in claim 1, which is used as a genetically engineered chassis bacterium.
4. The product as described in claim 3, characterized in that, The product can be any one of bacterial solution, enzyme, or antibacterial agent.
5. A method for constructing recombinant Bacillus subtilis, recombinant Bacillus amyloliquefaciens, and recombinant Bacillus sonoran, characterized in that, Includes the following steps: Step 1. The plasmid PHY300PLK was double-digested with restriction endonucleases HindIII and EcoRI to obtain the vector fragment; Step 2. Using primers P1 and P2, and with the synthesized gene as a template, PCR amplification of dpe was performed to obtain the target gene fragment dpe; Step 3. Using primers P3 and P4, and with the Bacillus subtilis genome as a template, PCR amplification was performed to synthesize promoter fragment P43. Step 4. Using primers P3 and P2, and with gene fragment dpe and promoter fragment P43 as templates, PCR amplification was performed to fuse the two fragments, resulting in fragment P43-dpe (1234p). Step 5. The above vector fragment and fragment P43-dpe were ligated by seamless cloning. The cloning product was transformed into the cloning host Escherichia coli DH5α, positive transformants were screened, plasmids were extracted, and the recombinant artificial expression vector PHY300PLK-dpe was obtained. Step 6. The plasmid PHY300PLK-dpe was electrotransformed into Bacillus subtilis, Bacillus amyloliquefaciens, and Bacillus sonoran. Positive transformants were then screened on solid plates containing tetracycline. After colony PCR and sequencing verification, recombinant Bacillus subtilis Bsu-PHY-DPE, recombinant Bacillus amyloliquefaciens Bam-PHY-DPE, and recombinant Bacillus sonoran Bso-PHY-DPE were obtained, respectively.
6. An application of using recombinant Bacillus subtilis, recombinant Bacillus amyloliquefaciens, or recombinant Sonoran Bacillus to prepare xylose or D-allulose.