Yarrowia lipolytica strain for synthesizing retinol and application of Yarrowia lipolytica strain

Abstract

The invention discloses a Yarrowia lipolytica strain for synthesizing retinol and application of the Yarrowia lipolytica strain, and belongs to the technical field of engineering and bioengineering. According to the method, a retinol synthesis route is constructed in yarrowia lipolytica, a key enzyme Blh is subjected to semi-rational transformation, and the enzyme activity of the key enzyme Blh is improved by 48.2% through iterative mutation; the yield of the retinol is further improved by strengthening a precursor acetyl coenzyme A and increasing supply of NADPH (nicotinamide adenine dinucleotide phosphate), so that the yield of the retinol of the constructed engineering strain reaches 1533 mg / L. The yield of 8.92 g / L of retinol is obtained through optimization of a 5L fermentation tank process, and a solid foundation is laid for industrial application.

Description

TECHNICAL FIELD

[0001] The present application relates to a Yarrowia lipolytica strain for synthesizing retinol and application thereof, and belongs to the technical field of genetic engineering and bioengineering. BACKGROUND

[0002] Retinol (vitamin A) is a fat-soluble vitamin mainly present in natural sources such as animal livers, dairy products and fish. Due to its important physiological activities in maintaining visual function, promoting cell growth and differentiation, enhancing immune function and regulating gene expression, retinol is widely used in the fields of medicine, nutritional supplements and cosmetics. Retinol can be biosynthesized in microorganisms through the carotenoid pathway. The pathway takes acetyl-CoA as the precursor, and generates methylmalonyl-CoA through the catalysis of hydroxymethylglutaryl-CoA reductase (HMGR). Then, through a series of phosphorylation and decarboxylation reactions, isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP) are formed. These C5 units are polymerized to form C20 geranylgeranyl pyrophosphate (GGPP) through the catalysis of geranylgeranyl pyrophosphate synthase (GGPPS). Two molecules of GGPP are condensed into phytoene under the action of phytoene synthase (CrtB), and then phytoene is gradually catalyzed to form lycopene through the catalysis of dehydrogenase (CrtI). Lycopene is converted into β-carotene through the catalysis of cyclase (CrtY), and finally two molecules of retinal are generated through the catalysis of β-carotene dioxygenase (Blh), and then reduced to retinol through the catalysis of retinal reductase (RDH12).

[0003] At present, retinol is mainly extracted from animal tissues such as fish liver oil, and the process is complex and costly, and is limited by the source of raw materials. The chemical synthesis method needs to go through multiple reactions, involves toxic reagents and is prone to produce isomer impurities, and has obvious defects in environmental protection and safety. In contrast, microbial synthesis method has the advantages of renewable raw materials and mild reaction conditions, and is an ideal way to realize the sustainable production of retinol. Literature has disclosed that by using Escherichia coli as the host, through enzyme modification and translation function optimization, and cooperating with dodecane extraction, the yield of the precursor retinal of retinol is 245.73 mg / L in a 4-L bioreactor. In Saccharomyces cerevisiae, through multi-copy overexpression of key genes, the yield of retinol reaches 4.12 g / L in a 5-L fermenter. However, due to the cell toxicity of terpenoids and the characteristics that microorganisms generally lack the storage mechanism of retinol, the yield of microbial production of retinol has encountered some bottlenecks. Therefore, it is particularly important to construct a new strain that can further improve the yield of retinol. SUMMARY

[0004] The present application provides a β-carotene 15,15'-dioxygenase mutant, which has a histidine mutation at position 78 or position 188 relative to the parent.

[0005] In one embodiment, the amino acid sequence of the parent is as set forth in SEQ ID NO. 11.

[0006] In one embodiment, the mutation is a mutation of the histidine at position 78 to alanine, phenylalanine, tryptophan or tyrosine.

[0007] In one embodiment, the mutation is a mutation of the histidine at position 188 to alanine, phenylalanine, isoleucine, leucine, leucine, methionine, tryptophan or tyrosine.

[0008] The present application also provides a gene encoding the mutant.

[0009] The present application also provides an expression cassette comprising the gene.

[0010] The present application also provides a recombinant microorganism expressing the mutant of beta-carotene 15,15'-dioxygenase.

[0011] In one embodiment, the microorganism includes, but is not limited to, Yarrowia lipolytica.

[0012] The present application also provides a Yarrowia lipolytica engineering strain with high yield of retinol, which is a lycopene-producing Yarrowia lipolytica as a starting strain, and expresses lycopene dehydrogenase from Mucor circinelloides CarB geranylgeranyl diphosphate synthase from Phaffia rhodozyma CrtE and phytoene synthase / lycopene cyclase from Mucor circinelloides CrtYB beta-carotene 15,15'-dioxygenase from marine bacteria Blh and retinol dehydrogenase from human RDH12 .

[0013] In one embodiment, the Yarrowia lipolytica engineering strain also has at least one improvement as follows: (1) reduced expression of intracellular oxidase FADH and / or HFD3; (2) enhanced intracellular acetyl-CoA and co-factor NADPH genes POS5, ACL1, ACL2, ACS and AMPD .

[0014] In one embodiment, the Yarrowia lipolytica engineering strain knocks out the intracellular oxidase genes FADH and HFD3.

[0015] In one embodiment, the nucleotide sequence of the lycopene dehydrogenase gene CarB is as set forth in SEQ ID NO. 1.

[0016] In an embodiment, the nucleotide sequence of the phytoene synthase / phytoene cyclase gene CrtYB is shown as SEQ ID NO. 2.

[0017] In an embodiment, the nucleotide sequence of the β-carotene dioxygenase gene is shown as SEQ ID NO. 3.

[0018] In an embodiment, the β-carotene dioxygenase is replaced by the β-carotene 15,15'-dioxygenase mutant.

[0019] In an embodiment, the nucleotide sequence of the retinol dehydrogenase gene RDH12 is shown as SEQ ID NO. 4.

[0020] In an embodiment, the gene CarB and the gene CrtE are integrated in the E4 site.

[0021] In an embodiment, the gene CrtYB is integrated in the B3 and / or E5 site.

[0022] In an embodiment, the gene Blh and RDH12 are integrated in the rDNA site.

[0023] In an embodiment, the N20 sequence for recognizing the E4 site is GAGAGGGACAGGATACACCG; the N20 sequence for recognizing the B3 site is AGCCGTCGGAACACCGCGGG; and the N20 sequence for recognizing the E5 site is ACAAGCATACAGCCCTCGGG.

[0024] In an embodiment, the nucleotide sequences of the genes POS5, ACL1, ACL2, ACS and AMPD are shown as SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10, respectively.

[0025] In an embodiment, the lutein-producing Yarrowia lipolytica is Yarrowia lipolytica F12, which has been disclosed in the paper De Novo Biosynthesis of Lutein in Yarrowia lipolytica.

[0026] In an embodiment, the Yarrowia lipolytica engineering strain is further complemented with the Leu marker.

[0027] The present application also provides the use of the Yarrowia lipolytica engineering strain in the production of retinol.

[0028] In an embodiment, the engineered Yarrowia lipolytica is fermented in YPD medium at 28~30℃.

[0029] In an embodiment, the engineered Yarrowia lipolytica is fermented in inorganic salt medium at 28~30℃ for at least 72 h.

[0030] In an embodiment, glucose is supplemented during fermentation to make the glucose concentration in the fermentation system ≤1 g / L.

[0031] In an embodiment, Tween 80 is also added to the fermentation system.

[0032] In an embodiment, fermentation is performed for 72~168 h.

[0033] In an embodiment, 2,6-di-tert-butyl-p-cresol is added to the fermentation system periodically during fermentation.

[0034] In an embodiment, 2,6-di-tert-butyl-p-cresol is added to make its concentration in the fermentation system 1 g / L.

[0035] The application also claims the use of the engineered Yarrowia lipolytica in the production of flavonoid-containing products in the fields of food, medicine and chemical industry.

[0036] Advantages: (1) The application uses the engineered Yarrowia lipolytica F12 with high lycopene yield as host to express the genes in the retinol synthesis pathway, and the obtained recombinant Yarrowia lipolytica realizes the synthesis of retinol.

[0037] (2) The key enzyme Blh in the synthesis pathway is semi-rationally modified in the application, and the hydrophobic amino acid residues in the substrate channel and active center of the enzyme are mutated by site-directed mutagenesis, which significantly improves the catalytic efficiency and increases the enzyme activity of the mutant by 48.2%.

[0038] (3) The application also knocks out the oxidase to reduce the synthesis interference or degradation of the precursor, so that the yield of retinol of the constructed recombinant bacteria is further increased to 700.5~897.0 mg / L.

[0039] (4) The application further increases the yield of retinol by enhancing the expression of the genes Yl POS5, Yl ACL1, Yl ACL2, Yl ACS and Yl AMPD , so that the yield of retinol reaches 1553 mg / L at the shake flask level.

[0040] (5) The engineering strain of the backfilling tag is fermented in a 5L fermenter level, inorganic salt medium, and the retinol yield of 6.7 g / L is obtained after 168 h of fermentation. And by regularly adding 2,6-di-tert-butyl-p-cresol, the retinol yield of 8.92 g / L is obtained after 168 h of fermentation, which is the highest yield so far.

[0041] High production of retinol is achieved. The animal heterologous metabolic pathway is integrated into the genome of Yarrowia lipolytica to achieve heterologous synthesis of retinol, which lays a foundation for subsequent synthesis of terpenoids. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 It is a metabolic schematic diagram for heterologous synthesis of retinol in Yarrowia lipolytica.

[0043] Figure 2 It is the yield of fermentation product of the strain constructed in Example 1.

[0044] Figure 3 It is the retinol yield of the engineering strain Re01 constructed for retinol pathway under YPD shake flask culture.

[0045] Figure 4 It is the retinol yield of the engineering strain Re01 after enzyme modification to obtain Re02 under YPD shake flask culture.

[0046] Figure 5 It is the retinol yield of the engineering strain Re02 after knocking out the oxidase HFD3 and FADH to obtain Re18 under YPD shake flask culture.

[0047] Figure 6 It is the retinol yield of the engineering strain Re18 after integrating the genes for providing precursors acetyl coenzyme A and coenzyme NADPH to obtain Re23 under YPD shake flask culture.

[0048] Figure 7 It is the retinol yield of the engineering strain Re23 after backfilling the tag in a 5-L fermenter for 168 h of inorganic salt fermentation. DETAILED DESCRIPTION

[0049] (I) Culture medium LB medium: Peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L. Add 20 g / L agar powder to prepare LB solid medium.

[0050] YNB medium: Yeast Nutrition Base 67.4 g / L, glucose 20 g / L, amino acids (5 g / L uracil, 10 g / L tryptophan, 10 g / L leucine, 10 g / L histidine, and appropriate deletion of corresponding amino acids as needed).

[0051] YPD medium: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L.

[0052] Mineral salt medium: 5 g / L ammonium sulfate, 3.5 g / L potassium phosphate dibasic, 5 g / L magnesium sulfate heptahydrate.

[0053] 5×Mineral salt medium: 25 g / L ammonium sulfate, 16.5 g / L potassium phosphate dibasic, 25 g / L magnesium sulfate heptahydrate.

[0054] (ii) Preparation of Yarrowia lipolytica competence: Yarrowia lipolytica competence was prepared using Frozen-EZ Yeast Transformation II kit, 30℃, and 5 mL YPD medium was used to culture Yarrowia lipolytica to the middle order (OD 600 =0.8-1.0). The following steps were carried out at room temperature.

[0055] 1. Centrifuge the cells at 3500 rpm for 5 min, and aspirate the supernatant; 2. Add 10 mL of EZ1 solution to wash the precipitate, and centrifuge the precipitated cells again, and aspirate the supernatant; 3. Add 1 mL of EZ2 solution to resuspend the precipitated cells.

[0056] (iii) Transformation of Yarrowia lipolytica: 1. Scrape the yeast colonies from the YPD plate and inoculate in YPD liquid medium, and place in a constant temperature incubator at 30℃ for 16-22 h; 2. Prepare the yeast transformation buffer solution (if multiple transformations, scale up × n): 50% PEG3350, the volume added is 90 µL; 2M lithium acetate (M CHCOOLi 65.99), the volume is 5 µL; ssDNA, the volume is 5 µL, which needs to be boiled in water for 3 min before being added to the transformation buffer, and then cooled on ice; 3. Use a pipette to take 500 µL of bacterial solution and add it to a centrifuge tube, centrifuge the centrifuge tube at an appropriate speed, and discard the supernatant to obtain the yeast cells. Transfer the yeast cells to a centrifuge tube containing 100 µL of transformation buffer, mix gently, add 0.25-0.5 µg of plasmid DNA or linear DNA, mix thoroughly and shake for 2 min (at least 0.25-0.5 µg of DNA is added for each plasmid); 4. Incubate the centrifuge tube containing the transformation mixture in a metal bath at 30 °C for 30-45 min, shake the mixture for 15 s every 10 min, and then perform an additional 10 min heat shock at 39 °C to improve transformation efficiency; 5. Transfer the centrifuge tube to a centrifuge and centrifuge at 8000 rpm for 2 min. Pour off the supernatant in a sterile clean bench, resuspend the bacterial cells with an appropriate amount of sterile water, and add to the YPD solid medium. Uniformly spread on the YPD solid medium with a sterile spreader, and then place the medium in a constant temperature incubator at 30 °C for culture.

[0057] (IV) Detection method: The analysis of the organic phase containing carotenoids was performed using a SHIMADZU LC-20AT high-performance liquid chromatography system equipped with a variable wavelength detector and a SHIMADZU Shim-pack Velox Biphenyl (2.7 µm, 4.6 x 150 mm) column. For the detection of lycopene and β-carotene, the mobile phase was acetonitrile containing 0.1% anhydrous formic acid. The flow rate was set to 1.2 mL·min -1 , the injection volume was 10 µL, the column temperature was 35 °C, the time was 20 min, and the detection wavelength was 350 nm. For the detection of retinol, the mobile phase was methanol. The flow rate was set to 0.8 mL·min -1 , the injection volume was 10 µL, the column temperature was 40 °C, the time was 15 min, and the detection wavelength was 325 nm. The OD 600 was measured using a spectrophotometer (722N, Jinghua, Shanghai, China).

[0058] (V) Strain information as shown in Table 1.

[0059] Table 1 Strains involved in the present application

[0060] Example 1 Construction of retinol synthesis pathway in Yarrowia lipolytica To synthesize retinol, CarB (nucleotide sequence as shown in SEQ ID NO. 1) from Mucor circinelloides , AL-1 (Genbank: M57465.1) from Neurospora crassa , CrtB (Genbank: PQ468285.1), Pantoea ananatis (Genbank: HQ003248.1), or Erwinia herbicola Rhodobacter sphaeroides ​(Genbank: S71770.1) were integrated into the E4 site of F12, respectively, to obtain strains Ly01-1, Ly01-2, Ly01-3, Ly01-4 and Ly01-5. The recombinant strains Ly01-1~Ly01-5 were fermented in YPD medium with 10% (v / v) Tween 80 at 30 ℃, 220 rpm for 96 h, and it was found that the lycopene yield of Ly01-1 was higher. Therefore, F12 was used as the starting strain, and the genes CarB (nucleotide sequence as shown in SEQ ID NO. 1) and CrtE (nucleotide sequence as shown in SEQ ID NO. 5) were co-expressed at the E4 site to obtain strain Ly02. Further, the genes CarRP (Genbank: AJ250827.1) from filamentous fungus Absidia cookei and CrtYB (nucleotide sequence as shown in SEQ ID NO. 2) from Rhodotorula rubra were integrated into the E5 site (N20: ACAAGCATACAGCCCTCGGG) of Ly02, respectively, to obtain strains Ca01-1 and Ca01-2, respectively. The β-carotene yield of Ca01-2 was 770.3 mg / L. Further, the gene CrtYB was integrated into the B3 site (N20: agccgtcggaacaccgcggg) of Ca01-2 to obtain Ca02. The constructed strain Ca02 was fermented in YPD medium with 10% Tween 80 at 30 ℃, 220 rpm for 96 h, and it was found that the β-carotene yield was 822.7 mg / L.

[0061] On the basis of strain Ca02, the Blh (nucleotide sequence as shown in SEQ ID NO. 3) from uncultured marine bacterium and the RDH12 (nucleotide sequence as shown in SEQ ID NO. 4) from human were expressed at the rDNA multicopy site of Ca02. The above-mentioned genes were synthesized, and the homologous arms of the E4 site (N20 sequence for recognizing the site: GAGAGGGACAGGATACACCG) and the B3 site (N20 sequence for recognizing the site: AGCCGTCGGAACACCGCGGG) and the fragments of the target genes were PCR amplified together. The PCR amplified fragments and the Cas9 plasmid of the corresponding site were added in the process of yeast transformation. The obtained engineering strain Re01 was fermented in YPD medium at 30 ℃, 220 rpm with the addition of 10% Tween 80 for 96 h, and the fermentation broth was extracted and identified by liquid phase. The results showed that the retinol yield of strain Re01 reached 389.6 mg / L, as shown in FIG. 6.Figure 3 .

[0062] Table 2 Primers and sequences

[0063] Example 2 Semi-rational modification of β-carotene dioxygenase Blh In the retinol synthesis pathway, β-carotene 15,15'-dioxygenase (Blh) can cut 1 molecule of β-carotene symmetrically to generate 2 molecules of retinaldehyde; retinol dehydrogenase (RDH12) can reduce retinaldehyde to retinol. The β-carotene yield of the Ca02 strain is 822.7 mg / L, while the retinol yield of the Re01 strain is only 389.6 mg / L, with a conversion rate of 40.5%. To verify whether Blh is the rate-limiting enzyme, Blh was integrated into the F5 site of the Ca02 strain (N20 recognition site: CACGAAGAGAGGTAAAACAG) according to the method of Example 1 to obtain the strain Ca02-Blh.

[0064] The metabolic product yields of the strains Ly02, Ca02, Re01 and Ca02-Blh constructed in Example 1 were detected respectively. The above strains were cultured according to the method of Example 1, the product titers were detected by liquid phase, and the yield units were converted to mmol / L to directly observe the catalytic effect of the enzyme. The results showed that in the Ca02-Blh strain, the concentration of β-carotene decreased from 1.54 mmol / L to 0.39 mmol / L after conversion, and the molar concentration of retinaldehyde was only 1.52 mmol / L, indicating that the catalytic efficiency of Blh was only 66%. In addition, the conversion rate of retinaldehyde in the Re01 strain reached 90% (Figure 3A). Therefore, Blh was determined to be the rate-limiting enzyme in the retinol synthesis pathway.

[0065] Since there is no resolved structure with more than 15% sequence identity to Blh in the PDB database, AlphaFold3 was used for modeling to determine the approximate structure of Blh. The Blh structure is mainly composed of 9 α-helices (Figure 2B), and the active site is located in the center of the α-helices. Figure 3 B), to further clarify the precise active site of the enzyme, Rosetta Dock was used for the docking experiment of Blh and β-carotene, generating 200 docking structures, and the structure with the lowest energy was selected for subsequent analysis. According to the UniProt database information, Blh belongs to iron-dependent dioxygenase, and the analysis of the docking conformation of Blh and β-carotene shows that there are 4 histidine residues (His21, His78, His188 and His256) around the approximate geometric center of β-carotene (carbon-carbon double bond). It is speculated that in this reaction, two histidine residues pass their Nε atoms to Fe² +Coordinate bonds are formed and O2 is activated. This is for screening with Fe²⁺. + The coordinated amino acid residues were mutated by alternating alanine (Ala) residues from the four histidine residues mentioned above (Figure 3C). Using plasmid pYLXP' as a vector, the amino acid sequence shown in SEQ ID NO.3 was synthesized. Blh Genes, constructing recombinant plasmid pYLXP'- Blh Primers were designed to introduce mutations that replaced four amino acids—His21, His78, His188, and His256—with alanine. The recombinant plasmid carrying these mutated genes was then transformed into the recombinant strain Re01 constructed in Example 1. The obtained strains were cultured according to the method in Example 1. The results showed that the H78A / H188A-Blh mutant retained its activity and showed a slight increase (Figure 3D), preliminarily confirming that His21 and His256 are stable Fe²⁺ amino acids. + The main residues. Considering the formation of Fe before O2 activation. 3+ -OO - His78 or His188 may form triple coordination bonds with Fe together with His21 and His256. Saturation mutagenesis of His78 and His188 yielded H78W with increased activity of 48.2% and 33%, respectively. Figure 4 A) and H188F mutant ( Figure 4 B). The Blh-H78W mutant was integrated into the Trp (Gene ID: 2907223) site of the Re01 strain to construct the Re02 strain, which produced retinol at a yield of 692.7 mg / L. Following the same strategy, the H78W / H188F combined mutant was constructed and expressed in Re01. Fermentation was carried out in YPD medium at 30 °C and 220 rpm with 10% Tween 80 added for 96 h, resulting in a retinol yield of 386.2 mg / L.

[0066] Example 3 Construction of strains with knocked-out oxidase Because retinol is easily oxidized, regulating the intracellular oxidative environment to reduce retinol production loss has become a feasible strategy. In Yersinia lipolyticis, various endogenous oxidases may degrade or interfere with the accumulation of retinol and its precursors, leading to product loss. Candidate enzymes include alcohol dehydrogenase ADH1 (Gene ID: 2911068), alcohol dehydrogenase ADH2 (Gene ID: 2912417), alcohol dehydrogenase ADH3 (Gene ID: 2906568), alcohol dehydrogenase ADH4 (Gene ID: 2911563), alcohol dehydrogenase ADH5 (Gene ID: 2910516), alcohol dehydrogenase ADH6 (Gene ID: 2905743), hydroxy fatty acid dehydrogenase HFD1 (Gene ID: 2905787), HFD2 (Gene ID: 2906667), HFD3 (Gene ID: 2911999), HFD4 (Gene ID: 2908746), pyruvate decarboxylase PDC1 (Gene ID: 2910997), and fatty acid oxidase FAO1 (Gene ID: 2910997). NADH (Gene ID: 2906990) and S-(hydroxymethyl)glutathione dehydrogenase FADH (Gene ID: 2908970). These enzymes may directly or indirectly affect intracellular redox balance or the NADH / NAD ratio. + The ratio. Therefore, the above-mentioned oxidase genes were knocked out in strain Re02 constructed in Example 2 to evaluate its effect, and strains Re03 to Re15 were constructed respectively. The strains were cultured according to the method in Example 1. The results showed that the retinol yield of strain Re08 with the ADH6 gene knocked out reached 700.5 mg / L ( Figure 5 A); the Re11 and Re14 strains had higher yields, at 788.2 mg / L and 897.0 mg / L, respectively. Figure 5 B) indicates that knocking out HFD3 and FADH can alleviate NAD. + The competitive consumption of retinaldehyde ensures the supply of cofactors required for its reduction to retinol.

[0067] To further balance the intracellular redox environment and explore its potential to promote the conversion of retinaldehyde to retinol, a combination of oxidases that positively impact retinol production after single-gene knockout were knocked out. Based on strain Re08, HFD3 and FADH genes were knocked out to construct strains Re16 and Re17, respectively. Furthermore, based on strain Re15, HFD3 gene was knocked out to construct strain Re18. These strains were cultured according to the method described in Example 1, and the results showed (…). Figure 5The production of retinol was increased after the combined knockout of oxidase genes: the Re18 strain with the simultaneous knockout of HFD3 and FADH reached a production of 963.3 mg / L, and the Re17 strain reached a production of 900.3 mg / L.

[0068] Example 4: Enhancement of Acetyl-CoA and NADPH To promote the supply of the precursor acetyl-CoA and the cofactor NADPH, the endogenous gene of *Yamylostella lipolytica* was overexpressed. POS5, ACL1, ACL2, ACS and AMPD (The corresponding nucleotide sequences are shown in the sequence listing SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10). The gene was amplified from the genome of *Yolopsis lipolyticus* using primers YlACS-F / YlACS-R. ACS, Genes were amplified from the genome of *Yolopsis lipolyticis* using primers YlAMPD-F / YlAMPD-R. AMPD, Genes were amplified from the genome of *Yolopsis lipolyticis* using primers YlACL1-F / YlACL1-R. ACL1, Genes were amplified from the genome of *Yolopsis lipolyticis* using primers YlACL2-F / YlACL2-R. ACL2 The strain Re18 constructed in Example 3 integrates at the C7 site (N20 recognition site: TCAAAAGTCAGTGTGAGGGG) POS5 We obtained strain Re23, and then... ACL1, ACL2, ACS and AMPD Strains Re24 were obtained by integrating the F5 site (N20 recognition site: CACGAAGAGAGGTAAAACAG) of strain Re23. The obtained engineered strains were cultured according to the method in Example 1, fermented for 96 h, and the fermentation broth was extracted and analyzed by HPLC. The results showed that the recombinant engineered strain Re24 had the highest retinol yield, at 1533 mg / L. Figure 6 .

[0069] Table 3 Primer sequences

[0070] Example 5: Preparation of retinol by fermentation with engineered bacteria Re25 Based on Re24, LEU (SEQ ID NO. 12) was reintroduced using the zeta multicopy plasmid (which carries the Leu gene), and the TRP gene (nucleotide sequence such as Gene ID: 2907223) was integrated at the F7 site (N20 recognition site: AGAGATCTATATGGTTAACG) to obtain strain Re25.

[0071] The strain Re25 was fermented in inorganic salt medium at 28°C, pH=5.5 (50% ammonia water was prepared for pH control) for 168 h, and the dissolved oxygen in the tank was controlled at 20% (stirring speed was automatically controlled, 200-800). The base material was 2xYPD, and the initial sugar was 40 g / L. Nitrogen source was supplemented after 12 h of fermentation, and the nitrogen source was 5x inorganic salt medium. The initial nitrogen source supplement rate was set to 10 ml / h, and the nitrogen source flow rate was adjusted after the glucose flow rate. The nitrogen source flow rate was controlled at 50% of the glucose flow rate. After the initial sugar was consumed, glucose solution with a concentration of 600 g / L was supplemented, and the glucose concentration in the tank was controlled at ≤1 g / L by continuously adjusting the glucose supplement flow rate. In order to better produce retinol, 10% Tween 80 by volume was added to the tank base material, inorganic salt supplement medium and glucose supplement liquid for retinol extraction, and the toxicity of retinol to cells was reduced. It was detected that the yield of retinol after 168 h of fermentation was 6.7 g / L.

[0072] Example 6: Optimization of fermentation of engineered strain Re25 to prepare retinol On the basis of Example 5, in order to reduce the loss of product oxidation, 1‰ of 2,6-di-tert-butyl-p-cresol (BHT) solution with a concentration of 25 g / L was added to the fermentation tank every 48 h, and the final fermentation was carried out for 168 h to obtain the highest yield of retinol reported so far, 8.92 g / L. Figure 7 ).

[0073] Although the present application has been disclosed with reference to the preferred embodiments as above, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, and therefore the protection scope of the present application should be defined by the claims.

Claims

1. A β-carotene 15,15′-dioxygenase mutant, characterized in that, Compared to the parent shown in SEQ ID NO.11, it has histidine mutations at positions 78 and / or 188.

2. The β-carotene 15,15′-dioxygenase mutant according to claim 1, characterized in that, The mutation involves changing histidine at position 78 to alanine, phenylalanine, tryptophan, or tyrosine.

3. The β-carotene 15,15′-dioxygenase mutant according to claim 1, characterized in that, The mutation involves changing histidine at position 188 to alanine, phenylalanine, isoleucine, leucine, methionine, tryptophan, or tyrosine.

4. A gene encoding any of the mutants described in claims 1 to 3.

5. Recombinant microorganisms expressing the β-carotene 15,15′-dioxygenase mutant of any one of claims 1 to 3.

6. The recombinant microorganism according to claim 5, characterized in that, The microorganisms include, but are not limited to, *Aylodis lipophila*.

7. A retinol-producing engineered *Yarrowia lipolytica* strain, characterized in that, Using the high-lycopene-producing *Yamylostella lipolytica* F12 as the starting strain, this study expressed lycopene dehydrogenase derived from the filamentous fungus *Mucor*. CarB Geraniol geraniol diphosphate synthase derived from Pharfia redis CrtE and phytopene synthase / lycopene cyclase CrtYB, β-Carotene 15,15′-dioxygenase Blh and human retinol dehydrogenase RDH12 The β-carotene 15,15′-dioxygenase Blh β-Carotene 15,15′-dioxygenase derived from marine bacteria Blh Or the mutant described in any one of claims 1 to 3.

8. The engineered *Yamylostella lipolytica* strain according to claim 7, characterized in that, The genetically engineered bacteria also has at least one of the following improvements: (1) It reduced the expression of intracellular oxidases FADH and / or HFD3; (2) Gene Yl that enhances intracellular acetyl-CoA and cofactor NADPH POS5 Yl ACL1 Yl ACL2 Yl ACS andYl AMPD .

9. The engineered *Yamylostella lipolytica* strain according to claim 7 or 8, characterized in that, Gene CarB Integrated at the E4 site; gene CrtYB Integrated at the B3 site; gene Blh and RDH12 It is integrated into the rDNA site.

10. The use of the engineered *Yamylostella lipolytica* strain according to any one of claims 7 to 9 in the production of retinol.

11. The application according to claim 10, characterized in that, The engineered *Yamylostella lipolytica* strain according to any one of claims 7 to 9 is fermented in a culture medium at 28 to 30°C for at least 96 h.

12. The application of the mutants according to any one of claims 1 to 3, or the recombinant microorganisms according to any one of claims 5 to 6, or the engineered *Yamylostella lipolytica* according to any one of claims 7 to 9 in the production of flavonoid-containing products in the food, pharmaceutical, and chemical industries.

Images