DNA sequence for preparing recombinant salmon PDRN, recombinant salmon PDRN composition as well as preparation method and application of recombinant salmon PDRN composition

By designing specific tandem gene sequences and using engineered bacteria to ferment and produce recombinant salmon PDRN, the dependence on natural salmon DNA and the problem of product consistency in existing technologies have been solved, achieving efficient and uniform PDRN preparation, which is suitable for skin repair, anti-aging or anti-inflammatory cosmetics and medical devices.

CN121574977APending Publication Date: 2026-02-27SHANGHAI DAOQU BIOTECHNOLOGY CO LTD

Patent Information

Application Number
CN202610106114.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-27
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Existing PDRN preparation methods rely on natural salmon DNA, which suffers from unstable supply, high costs, and difficulty in controlling batch-to-batch product consistency. Furthermore, alternative solutions lack functional targeting and large-scale production capabilities.

Method used

A specific tandem gene sequence (SEQ ID NO.1) was designed and recombinant salmon PDRN was produced by fermentation with engineered bacteria. The DNA fragments were then processed by restriction endonuclease digestion and heat treatment to achieve controllable large-scale production.

Benefits of technology

It provides a clear genetic template, enabling the reproducible production of recombinant salmon PDRN with uniform product quality and bioactivity comparable to natural PDRN, making it suitable for industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574977A_ABST
    Figure CN121574977A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene design, and particularly discloses a DNA sequence for preparing recombinant salmon PDRN, a recombinant salmon PDRN composition as well as a preparation method and application of the recombinant salmon PDRN composition, the DNA sequence for preparing the recombinant salmon PDRN comprises a nucleotide sequence as shown in SEQ ID NO.1, and the nucleotide sequence as shown in SEQ ID NO.1 comprises nucleotide sequences derived from all 17 sequences in SEQ ID NO.2 to SEQ ID NO.18. The invention further discloses a preparation method of the recombinant salmon PDRN. The sequence can fundamentally get rid of dependence on natural organism raw materials, realizes directional design of product functions, and is suitable for industrial stable production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of gene design technology, and in particular to a DNA sequence for the preparation of recombinant salmon PDRN, a recombinant salmon PDRN composition, a preparation method thereof, and its uses. Background Technology

[0002] Polydeoxyribonucleotides (PDRNs) are a mixture of DNA fragments with multiple benefits, including promoting tissue repair, anti-inflammation, and anti-aging, and are in high demand in the fields of medical aesthetics and high-end skincare products. Currently, the global PDRN market is experiencing explosive growth, but the supply chain faces severe challenges.

[0003] The mainstream method for PDRN preparation has long relied on extracting and fragmenting natural DNA from salmon sperm. This method has inherent drawbacks that are difficult to overcome: First, the supply of raw materials is constrained by fishery resources, environmental policies, and marine pollution, making it unstable and raising concerns about safety; second, the extraction process is complex, requiring DNA extraction, enzymatic digestion, and multi-step chromatographic purification to remove impurities such as host proteins, resulting in high costs; third, the product is a random fragment of genomic DNA, and its sequence composition and batch-to-batch consistency of functional profiles are difficult to control.

[0004] To overcome raw material limitations, the industry has attempted to develop alternative solutions, but all have significant limitations. For example, one approach uses in vitro enzymatic synthesis technology, which avoids the use of salmon as a raw material, but the resulting product is a random sequence of DNA fragments with unclear function, and is difficult to produce on a large scale at low cost. Another approach turns to extracting DNA fragments from other organisms as PDRN. This approach is essentially an extension of the natural extraction approach, and the product is also a random fragment of the organism's genome with uncertain composition, and its functional equivalence to salmon-derived PDRN is not fundamentally guaranteed. In addition, its production is still constrained by issues such as the cultivation of specific raw materials and the development of extraction processes.

[0005] Therefore, there is an urgent need to develop a high-quality PDRN preparation method that can fundamentally break away from dependence on natural biological raw materials, achieve product functional-oriented design, and is suitable for stable industrial production, in order to overcome the above-mentioned technical bottlenecks and promote industrial development. Summary of the Invention

[0006] This application provides a DNA sequence for the preparation of recombinant salmon PDRN, a recombinant salmon PDRN composition, a preparation method thereof, and its uses. The sequence can provide a clear and reproducible genetic template for the subsequent fermentation of recombinant salmon to produce target PDRN, fundamentally replacing the dependence on natural salmon DNA raw materials.

[0007] In a first aspect, this application provides a DNA sequence for preparing recombinant salmon PDRN, employing the following technical solution: A DNA sequence for the preparation of recombinant salmon PDRN, comprising the nucleotide sequence shown in SEQ ID NO.1:

[0008] By adopting the above technical solution, a DNA sequence that does not exist in nature, is artificially designed and contains a specific tandem gene sequence (SEQ ID NO.1), provides a clear and reproducible genetic template for the subsequent production of target PDRN from recombinant salmon fermentation, fundamentally replacing the dependence on natural salmon DNA raw materials.

[0009] Optionally, the nucleotide sequence shown in SEQ ID NO.1 contains a functional fragment that has at least 95% identity with the sequences shown in SEQ ID NO.2 to SEQ ID NO.18.

[0010] Specifically, SEQ ID NO.2 is shown below: GTTGGTAGAGCATGGCGTTTGTAACGCCAGGGTAGTGGGTTCGATCCCCGGGACCACCCATACGTAGAATGTATGCACACATGACTGTAAGTCGCTTTGGATAAAAGCGTCTGCTAAATGGCATATATTGTTATTATATTAATGT GGGCCAATGAGGCAGTGTTGGCCGACTGGTAAAATATTATGATGTCTAGTTTTAATGTAGGCCAATGAGGCAGTGTTGGCCGACTGGTAAAATATTATGATGTTTTGTTTTAAGGTGGGCCAATGAGGCACTGATACATGCAGAA; SEQ ID NO.3 is shown below: CAATAGAGACAGTAGATCTAGCTGGTATGTCATAATAATAGAGATAGTAGATCTACCTGGTCTGTCATTTTATAATAGAGACAGTCGATCTATCTGGTCTGTCCTAATATAATAAAGACAGTAGATCTAGCTGGTCTGTCAT AATATAATAAAGACAGTAGATCTAGCTGTTCTGTCATAATAATAATAGACAGTAGATCTAGCTGGTCTGTCATAGTATAATAGGGACAGTAGATCTACCTGGTCTGTCAAAATATAATACAAACAGTAGATTTAGTTGGTCT; SEQ ID NO.4 is shown below: ATAAAGGTGTTCTCAACTGGCCTACCTGGTTAAATAAAGATGTTCTCGACTAACCTACCTAGTTAAATAAAGGTATTCTCGACTAGCCTACCTGGTTAAATAAAGGTGTTCTCAACTAGCCTACCTGGTTAAATAAAGGTGTTCTCAACTAGCCTACCTGGTTAAATAAAGGTGTTCTCAACCAGCCTACCTAGTTAAATAAAGATGTTCTCAACTGGCCTATCTGGTTAAATAAAGGTGTTCTCAACTAGCCTACCTGGTTAAATAAAAATGTTCTCAACTAGCCTACC; SEQ ID NO.5 is as follows: CTGAGAGAGAGAGAGAGAGACAGAGAGAGAGCGAGAGAGAGAGAGAAAGACAGAGAGCGAGACACACGGAGGGAGAGAGACATAGAGGGAGAGAGACACATAGAGAGAGAGAGTGAGACTGACTCTAACTCATTACATAAACTTGGAAGTATCTGAGAACAAATCACTCAGGACCTCATATCTGAACAGACAGCTAATAAACTCAGAAATCACAATGGGACTGCTTGAGTTTATTAAGGATTATTTTCTTGGTTTCTGGGACTAT; SEQ ID NO.6 is as follows: CATCGGTAGTTATTGGAGTTAAATTTGTCTTCATTTTTGTGGATTGGGGTTATCGGTCCTTGGTTCCAAATATTGGGGAAGATGCCTGAGCTGAGGATGATGTTAAAGAGTTTAAGTAAAGCCAATTGGAATTAGTGATCCATAGGTCTTTTTGGATTAGAGGGTTTGTGTATTGTCTGTAGTTCTTTCTTTCTCTCTTTGTCTGTCTGTCTCTCTATCTATCTGTCTCTCTGTCTGTCTCTGTCTCTCTGTCTGTCTCTCTCTCTGTCTGTCTCTCTCTCTGTCT; SEQ ID NO.7 is as follows: ACTTAATATAATATAATACATAAATAAACAAACAAACACGACCGGAACAAGATTATCCATATGTACTGATCATATTTTTACTAATACTGTAGAACTGTTCTAAAGCTGGATCCGTATCCATCGGATGCATTGAGCACAATATAGTGGGCCTAAAATAGTGTGTATGAGACATTGTGGTCCTTCTGTAGCACAGTTGGTAGAGCATGGTGCTTGTAACGCCAGGGTAGTGGGTTCGATTCCCGGGACCACCCATACGTAGAATGTATGCACACATGACTGTAAATCACTT; SEQ ID NO.8 is as follows: TTCTCTCTCTCTCCCTTCCTCCTCTCTGTATCTTCCTACTCTCCCCCTCTATCTTCATCTCCTTAGTAACTCTGAACAGCAGATGCAGGTCAGAGAGAGTTGACATATTGTGTTTAGCAGCTATTAAAAAAATCTCTCTATTTTCTCTCCTCTTTCTCCTCCTCTCCTCCTTTGTCTTCTGACCTCCTCTACCTTTCCATTGCTCTGACAGCCTGTTTAACCTCTCTGACTGCCTGTTTTATCACCTCTCTGACTGCCTGTTTAACTCTCTCTCTGACT; SEQ ID NO.9 is as follows: ATATGGTGCCATTTGACCTGGTTTATAGGGAATACGGTGCCATTTGACCTGGTCTATAGGGAATACGGTGCTATTTGACCTAGTCTATAGGGAATATGGTGCTATTTGACTTGGTCTATAGGGAATATGGTACCATTTGCCCTGGTCTATAGGGAATACGTTGCTATTTGACCTGGTCTATAGGGAATATGGTGCTATTTGACTTGGTCTATAGGGAATATGGTACCATTTGACCTGGTCTATAGGGAATATGGTGCTATTTGACCTGGTCTATAGGGAATATGATGCCA; SEQ ID NO.10 is as follows: GGTAGGCCAGTTGAGAACACCTTTATTTAACCAGGTAGGCCAGTTGAGAACACCTTTATTTAACCAGGTAGGCCAGTTGAGAACATCTTTATTTAACCAAGTAGGCCAGTTGAGAACACTCTTATTTCACCAGGTAGGCTAGTTGAGAACACCTTTATTTAACCAGGTAGGTTAGTTGAGAACACTTTTATTTAACCAGGTAGGTCAGTTGAGAACACCTTTATTTAACCAGGTAGGCCAGTTGAGAACATCTTTATTTAATCAGGTAGGCTAGTTGAGAACACCTTTAT; SEQ ID NO.11 is as follows: CCATCCATTTACCACTAACCTAACCCTACTATAATGCTAATCCTAACCTTAACCCTAACCTTAACCCGTTACCATAACCCAAACCCTAAAACTAACCACTAACCTAACCCTACTATAACGCTAATCCTGATCTTAACCCTAACCCTAACCTTAGTCCGTTACCATAAGCCAGGCCTGGAGCCTAAAATTAACCACTAACCTAACCCTACTATAATGCTAATCCTAACCTTAACCCTAACCTTAACCCGTTACCATAACCCAAACCCTAAAACTAACCACTAACCTAACCC; SEQ ID NO.12 is as follows: GGAAGAGAGAAAGAAAGAGAGGGAGAGAGAGAGAGAGTTCATATTTGAATACAGAGAATATGTGCATATAGTGTATATGGAGAAAAGGGTGCCATTTGGGACACAGTTGAGATGTAAAAGGAGAAGGAGAGAGTTATACTACTTGCTCACGTACGCCTAGAGAGGAGACAGGTGGAGGGAGATGAA; SEQ ID NO.13 is as follows: TAGGGAATATGGTGCCATTTGACTTGGTCTATAGGGAATATGGTGTCATTTGACCTGGTCTATAGGGAATATGGTGCTATTTGACCTGGTCTATAGGGAATATGGTGCTATTTGATCTGGTCTATAGGGAATATGGTGCTATTTGACCTGGTTTATAGGGAATATGGTGCTATTTGACCTGGTCTATAGGGAATATGGTGCTATTTGACCTGGTCTATAGGGAATATGGTGCCATTTGACCTGGTCTATAGGGAATATGGTGCCATTTGACCTGGTCTATGGGAAATAGG; SEQ ID NO.14 is as follows: AAAGTATAGGACCTCCCGAGTGGCGCAGTGGTCTAAGGCACTGCATCGCAGTGTTGAGGCATCACTACAGACCCTGATTTGATTCCAGACTGTATCACAACCAGTCGTGATTGGGAGTTTCATGAGATAGTGCACAATTGGTCCAGTAATGTTAGGGTTTGGCTGGGGTAGGTTGTCATTGTAAATAAGAATTTGTTTTAAACTGACTTGCCTAATTAAATAAAGAATAAATATAAAATTCCACAACACGGGATACAACAATATGCATGGGTAAGCAATATATTATATAT; SEQ ID NO.15 is as follows: ACACAGAGTCAATGAATGCACATATTTAGAGAATGCTACTCAGATTGTTGGGATTATTTCTTATCACATTGGATTTCATGAGAGTTGCTAAAATCCCTGTCTTTTAGACATCTTTTATGGTGCATTTATGGCGAGTTGTATTTTTTTCTCTTCTCTCCATTACCTTGAGGAATGACAGGGAGTTTAAAAAAGGAAGGATCATTATCACACACCTATCCCTGTCCTTCATCCTCTTTCTCTCTTTCTCTCTGTCTCTCTCCCTTTCTCTCT; SEQ ID NO.16 is as follows: TCAGTTTGATGGTAGACATAGATATCATAGTATTTGTGTTAAGTCTGTGGGCTTATTTGCCTAATTGCTTAACACGTTGTGTGGGTGTGTATATATTTCGATTTATGCACGTGTGTCATGTCTGACGCTTGTCTTTGTGTGTGTGTGCGTGTGTGTGCATACGTACATGCGTGCGTGCGTGTGGTTGTACTTATGTGTGAGTGCGGCCGGTATTCGTCATTTCTTTGTCTCAGTATGTGTTAAACATCCTTTACTAGACCTTGATTTGAACATACACTTACTGTT; SEQ ID NO.17 is as follows: CACATACACACACACACACACCCAGTGAAAACACTACCAGATTGGTATATCTAGAGACTCACACACATCCTCCCTTCTCACTAAAAACCAAGGTCCTATTGATTTCTCTGTTTGGAATTACCAAGCAGTATTGACTGACAGGTCCGGATGGCATGGAACATCTCACCATAGCAAACACAAATATTCTCTCTCCCACAAAACAGACAGACACACACACACACACTCACACACAGTCCTGTCATCACCTAAGC; SEQ ID NO.18 is as follows: ACGTTACATTAGCACTAACATTAGCTCTACCAGCCTGACAGTAATGATGTGCCACTAGCAGCCCTCACACACCTCTCTCTGTCCATCCCACCTCTTTCCCCTTCTTCTGGCTTTTCCCTGTCCTTTTCCTACTCCTCCTCACGTACCCTTCCCAAATACCTCCACCTTTCCCCTGCCACCACCACCTCCCATTCTACTTCTCTTCTTGTTCTCCCTCTCCCTCCACCTTCCTCAACCTCTTCTCCCTCCCTCC。

[0011] Optionally, the functional fragment comprises nucleotide sequences derived from all 17 sequences among SEQ ID NO.2 to SEQ ID NO.18.

[0012] Secondly, this application provides an expression carrier, which adopts the following technical solution: An expression vector comprising a DNA sequence for the preparation of any of the above-mentioned recombinant salmon PDRN.

[0013] Specifically, the expression vector is a prokaryotic expression vector.

[0014] Specifically, the expression vector is selected from one of the pUC series plasmids, pBR322 plasmid, pUC57 plasmid, and pSC101 plasmid.

[0015] Thirdly, this application provides an engineered microorganism, which adopts the following technical solution: An engineered bacterium carrying one of the aforementioned expression vectors.

[0016] Specifically, the engineered bacteria is Escherichia coli.

[0017] Specifically, the engineered bacteria are selected from one of DH5α, TOP10, and JM109.

[0018] By adopting the above technical solution, engineered bacteria carrying expression vectors were obtained. These engineered bacteria can serve as living cell factories to achieve large-scale, low-cost biosynthesis of target tandem DNA.

[0019] Fourthly, this application provides a method for preparing a recombinant salmon PDRN composition, employing the following technical solution: A method for preparing a recombinant salmon PDRN composition, comprising fermentation production using one of the engineered bacteria described above, and including the steps of restriction endonuclease digestion and heat treatment of tandem DNA containing the sequence shown in SEQ ID NO.1.

[0020] By adopting the above technical solution, tandem DNA is produced by fermentation using engineered bacteria, and the long tandem DNA is processed into active fragments with similar size and conformation to natural PDRN through enzyme digestion and heat treatment steps, thus achieving controllable production process and uniform product quality.

[0021] Optionally, the restriction endonuclease used for the enzyme digestion is selected from at least one of KpnI, EcoRI, HindIII, and BamHI, and the heat treatment temperature is 50-80℃.

[0022] Fifthly, this application provides a recombinant salmon PDRN composition, employing the following technical solution: A recombinant salmon PDRN composition is prepared by the above-mentioned method for preparing a recombinant salmon PDRN composition.

[0023] Sixthly, this application provides a use of a recombinant salmon PDRN composition, employing the following technical solution: Use of a recombinant salmon PDRN composition, wherein the above-mentioned recombinant salmon PDRN composition is used to prepare cosmetics or medical devices for skin repair, anti-aging or anti-inflammatory purposes.

[0024] In summary, this application includes at least one of the following beneficial technical effects: 1. A DNA sequence that does not exist in nature, is artificially designed and contains a specific tandem gene sequence (SEQ ID NO.1), which provides a clear and reproducible genetic template for the subsequent production of target PDRN from recombinant salmon fermentation, fundamentally replacing the dependence on natural salmon DNA raw materials; 2. Tandem DNA was produced by fermentation using engineered bacteria, and the long tandem DNA was processed into active fragments with similar size and conformation to natural PDRN through enzymatic digestion and heat treatment steps, thus achieving controllable production process and uniform product quality. Attached Figure Description

[0025] Figure 1 This is a plasmid map of the DNA sequence used to prepare recombinant salmon PDRN in Example 1. Detailed Implementation

[0026] Preparation Example

[0027] This application discloses a DNA sequence and its expression vector for the preparation of recombinant salmon PDRN.

[0028] Preparation Example 1 A DNA sequence for preparing recombinant salmon PDRN and its expression vector are constructed through the following steps: S1. Screening and determination of functional sequences: Starting with natural PDRN extracted from salmon testes, total DNA was extracted and shotgun high-throughput sequencing was performed. After back-linking the sequenced sequences to the salmon genome and performing site enrichment, approximately 320,000 PDRN sequences were obtained. The above PDRN sequences were sorted according to their enrichment level, and the potential nucleic acid and protein binding capacity of each sequence was analyzed based on machine learning to further analyze their possible biological functions. Finally, 17 core functional sequences were screened from the 320,000 sequences, and their nucleotide sequences are shown as SEQ ID NO.2 to SEQ ID NO.18, respectively.

[0029] S2. Artificial design and synthesis of the tandem DNA sequence SEQ ID NO.1: EcoRI restriction endonuclease recognition sites were added between each sequence from SEQ ID NO.2 to SEQ ID NO.18. HindIII restriction endonuclease recognition sites were added to both ends of the designed full-length sequence (SEQ ID NO.1). The whole gene was synthesized by a partner. After synthesis, it was cloned into the universal cloning vector pUC57 to obtain a plasmid, which is a DNA sequence for the preparation of recombinant salmon PDRN. Sequencing confirmed that it was correct.

[0030] S3. The pUC57 vector with accurate sequencing was transformed into E. coli DH5α competent cells and plated on LB agar plates containing kanamycin (50 µg / mL). Positive clones were screened by colony PCR and plasmid double digestion (EcoRI / HindIII) and sent to a partner for Sanger sequencing verification. The final expression plasmid contained an expression vector of a DNA sequence for the preparation of recombinant salmon PDRN.

[0031] Example

[0032] This application discloses a method for preparing a recombinant salmon PDRN composition.

[0033] Example 1

[0034] A method for preparing a recombinant salmon PDRN composition includes the following steps: P1. Preparation and fermentation of engineered bacteria: The expression vector verified in Example 1 was transformed into the expression host bacterium *Escherichia coli* DH5α by heat shock to construct recombinant salmon PDRN engineered bacteria. 750 μL of bacterial solution was added to 750 mL of seed culture medium and cultured at 37.0 °C and 220 rpm with shaking for 12 hours. When the OD600 of the bacterial solution reached 3.0, the seed solution was inoculated into a 50 L fermenter at an inoculation rate of 3%. The fermentation conditions were controlled as follows: temperature 37 °C, pH 7.0 (adjusted by automatic addition of NaOH and H3PO4), dissolved oxygen (DO) maintained above 30% (controlled by adjusting the stirring speed to 450 rpm and the aeration rate to 1.5 vvm), and the fermentation cycle was approximately 18 hours.

[0035] P2. Extraction and purification of the tandem DNA sequence SEQ ID NO.1: After fermentation, the fermentation broth was centrifuged at 4℃ and 4000 rpm for 30 minutes, the supernatant was discarded, and the wet cells were collected and purified using pre-cooled 20mM Tris-HCl buffer (pH 10). 8.0) Resuspended to an OD600 of approximately 15, and homogenized using a high-pressure homogenizer at 1100 bar with a feed rate controlled at 12 L / h to obtain a broken liquid. The broken liquid was centrifuged at 4°C and 5000 rpm for 30 minutes, the precipitate was discarded, and approximately 25 L of supernatant was collected. Sodium hydroxide (total concentration 8 g / L), SDS (total concentration 10 g / L), and EDTA (total concentration 2 g / L) were added sequentially to the supernatant, and the mixture was stirred thoroughly to dissolve. Then, potassium acetate (total concentration 295 g / L) and glacial acetic acid (total concentration 126 g / L) were added, and the mixture was quickly mixed and placed in an ice bath for 30 minutes. The mixture was then centrifuged at 4°C and 5000 rpm for 30 minutes, the precipitate was discarded, and the supernatant was collected. The supernatant was concentrated to approximately 2 L using a tangential flow ultrafiltration system (100 kDa, molecular weight cutoff). The concentrate was then clarified by filtration through a 0.45 μm depth filter using a Sephacryl S-500 HR column containing 2.5 M ammonium sulfate and 0.1 M... Equilibrate and elute with Tris and 0.01M disodium edetate (pH 7.5), and collect the target peak fraction based on the UV260 signal (threshold 50 mAu). Load the molecular sieve collection solution onto a hydroxyapatite column, wash with a buffer containing 1.5M ammonium sulfate and 0.3M sodium chloride, and elute the target plasmid DNA with 0.5M phosphate buffer (pH 6.8), collecting the DNA based on the UV260 signal. Dilute the affinity chromatography eluent and load it onto a Q Sepharose Fast Flow column. Elute with a gradient buffer containing 0.2-1.0M NaCl, collect the main peak fraction, and obtain a high-purity tandem DNA sequence.

[0036] P3. Enzyme digestion and heat treatment: The anion exchange chromatography eluent was diluted 5 times with pure water, and restriction endonuclease HindIII was added (5U of enzyme per 1μg DNA). The reaction was carried out at 37℃ for 2 hours. After enzyme digestion, the mixture was loaded again onto another Q Sepharose Fast Flow chromatography column (equilibration buffer: 0.2M NaCl, 0.1M Tris, 0.01M EDTA, pH 7.5). Gradient elution was performed using 0.2-1.0M NaCl. Elution peaks within the target molecular weight range were collected according to the UV260 spectrum to obtain crude recombinant salmon PDRN (SEQ ID NO.1) solution. The collected crude recombinant salmon PDRN solution was concentrated using a tangential flow ultrafiltration system (10kDa molecular weight cutoff). Restriction endonuclease EcoRI (5U of enzyme per 1μg DNA) was added to the concentrated solution, and the reaction was continued at 37℃ for 3 hours. Subsequently, the reaction temperature was increased to 70℃ and maintained for 1 hour.

[0037] P4. Separation of the final product: The mixture after enzymatic digestion and heat treatment is sterilely filtered through a 0.22μm filter membrane to obtain a colorless and transparent liquid, which is a recombinant salmon PDRN composition.

[0038] Performance testing

[0039] The performance of a recombinant salmon PDRN composition prepared in Example 2 was tested.

[0040] 1. Sequence composition analysis: High-throughput sequencing of a recombinant salmon PDRN composition showed that more than 98% of the clearly aligned reads could be mapped to the 17 reference sequences shown in SEQ ID NO.2 to SEQ ID NO.18, confirming that the DNA fragments in the composition originated from this set of specific functional sequences.

[0041] 2. Physicochemical properties: A recombinant salmon PDRN composition is a colorless and transparent liquid with a purity greater than 95% as determined by HPLC. Dynamic light scattering (DLS) and agarose gel electrophoresis analysis showed that its main molecular weight distribution ranges from 150 to 300 kDa.

[0042] 3. Evaluation of anti-aging efficacy of skin: Human skin fibroblasts (HS27) were seeded into 96-well plates and cultured overnight. The experimental group was cultured with fresh medium containing 20 μg / mL of the recombinant salmon PDRN composition described in Example 2. The positive control group used the same concentration of commercially available salmon-derived PDRN, and the blank control group used the same volume of medium. After 48 hours of culture, the cell supernatant was collected, and its content was detected using a human type I procollagen (Pro-Collagen I) ELISA kit.

[0043] Experimental results: The content of type I procollagen in the cell supernatant of the experimental group was (152.3 ± 10.5) ng / mL, which was not statistically different from that of the positive control group (148.7 ± 9.8) ng / mL (p>0.05), and was significantly higher than that of the blank control group (100.0 ± 8.2) ng / mL (p<0.01). This result indicates that the recombinant salmon PDRN composition prepared in Example 2 has bioactivity comparable to that of natural PDRN in promoting collagen synthesis, and can be used to prepare cosmetics or medical devices for skin repair, anti-aging or anti-inflammation.

[0044] The above are all preferred embodiments of this application, and are not intended to limit the scope of protection of this application. Therefore, all equivalent changes made in accordance with the structure, shape and principle of this application should be covered within the scope of protection of this application.

Claims

1. A DNA sequence for the preparation of recombinant salmon PDRN, characterized in that, It contains the nucleotide sequence shown in SEQ ID NO.

1.

2. An expression vector comprising the DNA sequence for preparing recombinant salmon PDRN as described in claim 1.

3. An engineered bacterium carrying the expression vector of claim 2.

4. A method for preparing a recombinant salmon PDRN composition, characterized in that, Fermentation production using an engineered bacterium as described in claim 3, comprising the steps of restriction endonuclease digestion and heat treatment of tandem DNA containing the sequence shown in SEQ ID NO.

1.

5. The method for preparing a recombinant salmon PDRN composition according to claim 4, characterized in that: The restriction endonuclease used for the enzyme digestion is selected from at least one of KpnI, EcoRI, HindIII, and BamHI, and the heat treatment temperature is 50-80℃.

6. A recombinant salmon PDRN composition, characterized in that: The recombinant salmon PDRN composition was prepared by the method described in claim 4.

7. The recombinant salmon PDRN composition according to claim 6, characterized in that: The molecular weight range of the recombinant salmon PDRN composition is 50-500 kDa.

8. The use of a recombinant salmon PDRN composition, characterized in that: The recombinant salmon PDRN composition of claim 6 is used to prepare cosmetics or medical devices for skin repair, anti-aging, or anti-inflammatory purposes.

Citation Information

Patent Citations

  • Preparation method and use of fixed-length recombinant polynucleotide / polydeoxyribonucleotide

    CN113913420A

  • Preparation method of polydeoxyribonucleotide

    CN119592554A

Cited By

  • Modified strain and application thereof in PDRN production

    CN121896143A