SiRNA and conjugate and application thereof

By constructing a Nectin-2 siRNA conjugate with the aptamer APT04 targeting PPP1CA, the targeting and safety issues of existing siRNA delivery systems in hepatocellular carcinoma were resolved. This resulted in safe and efficient Nectin-2 gene knockdown and immune activation, expanding the therapeutic strategies for liver cancer.

CN121574987APending Publication Date: 2026-02-27XIAMEN UNIV +1
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202511798687.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-02
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Existing siRNA delivery systems have insufficient targeting in the treatment of hepatocellular carcinoma, with off-target effects and potential immune risks. Furthermore, there is a lack of effective Nectin-2 targeted intervention methods. Existing vectors such as Lipofectamine, PEI, PLGA, and viral vectors have toxicity or immunogenicity issues, limiting the application of antibody-siRNA conjugates.

Method used

We designed and constructed an aptamer APT04 targeting PPP1CA and an siRNA conjugate targeting Nectin-2 to form the Nectin-2 AsiC system. This system enables the Nectin-2 to autonomously enter liver cancer cells without transfection agents, precisely knock down the immune checkpoint Nectin-2 gene, and enhance the tumor immune response.

Benefits of technology

It achieves safe and efficient siRNA delivery, significantly reduces Nectin-2 expression, enhances T cell activity, overcomes the toxicity and immune risks of traditional delivery systems, and expands new avenues for liver cancer treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574987A_ABST
    Figure CN121574987A_ABST
Patent Text Reader

Abstract

The invention relates to siRNA as well as a conjugate and application thereof, and belongs to the technical field of molecular biology and biological medicine. The siRNA comprises a positive-sense strand and an antisense strand. The conjugate comprises an aptamer and siRNA (small interfering Ribonucleic Acid). The siRNA and the conjugate provided by the invention are good in targeting property and high in safety, enter cancer cells (such as liver cancer cells) without the help of an exogenous transfection agent, and realize efficient knock-down of an immune checkpoint Nectin-2, so that the anti-tumor reaction of T cells is activated, and the siRNA and the conjugate are used for precise immunotherapy of tumors (such as liver cancer). The conjugate provided by the invention can be autonomously delivered to tumor cells without a transfection agent, quickly enters cytoplasm of the tumor cells without the help of lipidosome, polymer or viral vector, and generates a functional effect. The delivery strategy is high in safety, has unique practical value, and is different from a current mainstream delivery system in the RNA interference field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and biomedicine, specifically to an siRNA, its conjugates, and their applications. Background Technology

[0002] Hepatocellular carcinoma (HCC) is one of the most common types of primary liver cancer in clinical practice, with a high incidence and mortality rate worldwide, especially in China, where the burden of HCC is particularly heavy. Due to the insidious onset and rapid progression of HCC, more than 70% of patients are already in the middle or late stages at the time of diagnosis, which severely limits the applicability of radical treatments such as surgery. There is an urgent need for new targeted therapies and immunotherapies to improve survival rates.

[0003] In recent years, immune checkpoint inhibitors have become a significant breakthrough in the systemic treatment of HCC, especially antibody drugs targeting the PD-1 / PD-L1 pathway, which have entered first-line clinical practice. However, in practical applications, the efficacy rate of PD-1 / PD-L1 inhibitors is less than 30%, and a large number of patients still exhibit primary or acquired resistance, suggesting that other key immune escape mechanisms remain unaddressed.

[0004] Studies have found that the TIGIT / Nectin-2 signaling axis also plays an important negative regulatory role in the immune microenvironment of HCC. Nectin-2, the major ligand of TIGIT, is highly expressed in various tumor cells, including liver cancer, pancreatic cancer, and ovarian cancer. Nectin-2 binding to TIGIT can inhibit CD8+. + T cell dysfunction, inducing T cell exhaustion, and exacerbating tumor immune escape. Therefore, Nectin-2 is a promising new immunosuppressive target in current research and clinical development.

[0005] RNA interference (siRNA) technology is an important tool for current gene function research and therapeutic intervention. Small interfering RNAs (siRNAs) can achieve sequence-specific silencing of specific mRNAs, theoretically capable of targeting any gene. However, siRNAs suffer from problems such as easy degradation in vivo, short plasma half-life, and low cellular uptake efficiency, requiring efficient and safe delivery systems to achieve functional conversion. Existing delivery systems mainly include cationic liposomes, nanoparticles, or viral vectors, but most suffer from drawbacks such as high toxicity, unstable delivery efficiency, or high immunogenicity, limiting their clinical application.

[0006] Nucleic acid aptamers are a class of single-stranded oligonucleotides with specific spatial conformations that can bind to specific target proteins with high affinity and specificity. They also possess advantages such as small molecular weight, easy synthesis, and low immunogenicity. In recent years, aptamers have been widely used as drug molecules or delivery carriers, and are particularly suitable for the intracellular targeted delivery of siRNA, thus constructing a novel nucleic acid therapy system of "aptamer-siRNA conjugates".

[0007] PPP1CA is the catalytic subunit of protein phosphatase 1 and is found to be highly expressed in HCC tissues and cells. Publicly available patent CN107271670A indicates that PPP1CA can serve as a molecular marker for the diagnosis and prognostic assessment of liver cancer; its protein and mRNA levels are significantly higher in liver cancer patient tissues and serum than in healthy individuals, demonstrating good tumor specificity. Developing an aptamer that specifically recognizes PPP1CA could enable the construction of a liver cancer-specific siRNA delivery system, improving therapeutic targeting and safety.

[0008] However, to date, no research has publicly reported a therapeutic pathway that utilizes the PPP1CA aptamer as a delivery tool to deliver siRNA to HCC cells to knock down Nectin-2, thereby relieving immunosuppression and enhancing T cell killing.

[0009] Lipofectamine-based cationic liposomes possess excellent siRNA encapsulation capabilities, but their in vivo application suffers from high toxicity and strong immunogenicity. Polymer carriers such as PEI and PLGA can improve stability, but their preparation is complex and carries potential toxicity. Viral vectors such as adenoviruses, while exhibiting strong transduction capabilities, are prone to inducing immune responses due to carrying large amounts of exogenous antigens, limiting their clinical safety.

[0010] Antibody-siRNA conjugates are a delivery method developed in recent years, utilizing the recognition ability of antibodies to target specific tumor antigens to achieve siRNA delivery. However, due to factors such as the large molecular weight, complex structure, weak penetration ability, and high production cost of antibodies, their application is limited, and it is difficult to achieve rapid modification and industrial-scale replication.

[0011] Aptamers, as nucleic acid-based targeted recognition tools, have advantages such as easy synthesis, strong penetration, and low immunogenicity, and are increasingly being used for targeted delivery of siRNA. Currently, there are reports in the literature on using aptamers to target biomarkers such as PSMA and MUC1 to construct AsiC systems for the treatment of prostate cancer, breast cancer, etc., but in HCC, there are no published studies on mature aptamer-based delivery of siRNA targeting immune checkpoints.

[0012] Chinese patent application CN107271670A reported the high expression of PPP1CA in HCC and used it as a diagnostic and prognostic biomarker. However, the patent did not involve the use of PPP1CA as an aptamer delivery target, nor did it combine it with RNA interference technology, nor did it mention any treatment strategies related to Nectin-2 as an immune checkpoint target.

[0013] Therefore, existing technologies generally suffer from the following defects and shortcomings: (1) The delivery system has insufficient targeting and significant off-target effects, which affect the safety and effectiveness of treatment; (2) Most rely on exogenous chemical or viral systems, posing a potential immune risk; (3) Nectin-2 has not been effectively utilized as a target for siRNA intervention, and there is a lack of relevant research in HCC; (4) Although PPP1CA has been identified as a marker, its application in targeted delivery is still lacking.

[0014] Therefore, there is still an urgent need for a product that can knock down the Nectin-2 gene efficiently, with good targeting and high safety. Summary of the Invention

[0015] To address the aforementioned issues, this invention provides an siRNA that exhibits excellent efficiency in knocking down the Nectin-2 gene and good targeting. This siRNA can be used to prevent or treat diseases associated with Nectin-2 overexpression, such as liver cancer, pancreatic cancer, ovarian cancer, prostate cancer, colorectal cancer, endometrial tumors, gastric cancer, head and neck tumors, breast cancer, testicular cancer, or cervical cancer. Furthermore, this invention is the first to conjugate a PPP1CA-targeting aptamer (APT04) with a Nectin-2-targeting siRNA, constructing a conjugate that forms an innovative liver cancer immunotherapy system with specific recognition, stable structure, and autonomous delivery capabilities. This achieves a novel treatment strategy that allows the system to autonomously enter liver cancer cells without transfection agents, precisely knock down immune checkpoints, and enhance tumor immune responses, overcoming the shortcomings of existing technologies in terms of targeting, stability, and functionality.

[0016] This invention specifically addresses the following technical challenges: (1) Currently, RNAi therapy generally lacks efficient and safe targeted delivery systems; (2) Most immunotherapies for liver cancer only focus on the PD-1 / PD-L1 pathway and fail to address other immune escape mechanisms; (3) The role of Nectin-2 as a key immune checkpoint in HCC has been confirmed, but there is no effective siRNA-targeted intervention method. (4) Although PPP1CA is considered a biomarker for liver cancer, it has not yet been used as a target in delivery systems.

[0017] The Nectin-2 AsiC system constructed in this invention not only has high specificity and structural stability, but also overcomes the problem that traditional siRNA delivery relies on transfection reagents or nanocarriers. While improving gene silencing efficiency, it significantly enhances T cell-mediated immune responses, providing an integrated strategy of "targeted delivery + immune activation" for liver cancer treatment.

[0018] To address the aforementioned problems, the present invention provides the following technical solution.

[0019] In a first aspect, the present invention provides a siRNA.

[0020] An siRNA comprising a sense strand and an antisense strand; wherein the sense strand and the antisense strand are selected from one of the following groups (1) to (3): (1) The siRNA comprises a sense strand 1 and an antisense strand 1, wherein the sense strand 1 contains a modified or unmodified nucleotide sequence as shown in SEQ ID NO: 1 (5'-GACCUGUGAUGUACGAAGCAACCCA-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO: 1; and the length of the sense strand 1 does not exceed 30 nucleotides; The antisense strand 1 comprises: a modified or unmodified nucleotide sequence as shown in SEQ ID NO:2 (5'-UGGGUUGCUUCGUACAUCACAGGUCAG-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:2; and the length of the antisense strand 1 does not exceed 30 nucleotides; (2) The siRNA comprises a sense strand 2 and an antisense strand 2, wherein the sense strand 2 contains a modified or unmodified nucleotide sequence as shown in SEQ ID NO:3 (5'-CGGCUAUGAUGACAACUGGUACCTT-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:3; and the length of the sense strand 2 does not exceed 30 nucleotides; The antisense strand 2 comprises: a modified or unmodified nucleotide sequence as shown in SEQ ID NO:4 (5'-AAGGUACCAGUUGUCAUCAUAGCCGGA-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:4; and the length of the antisense strand 2 does not exceed 30 nucleotides; (3) The siRNA comprises a sense strand 3 and an antisense strand 3, wherein the sense strand 3 contains a modified or unmodified nucleotide sequence as shown in SEQ ID NO:5 (5'-CGUCACUAUCAUCAGCCGAUACUCC-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:5; and the length of the sense strand 3 does not exceed 30 nucleotides; The antisense strand 3 comprises: a modified or unmodified nucleotide sequence as shown in SEQ ID NO:6 (5'-GGAGUAUCGGCUGAUGAUAGUGACGGU-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:6; and the length of the antisense strand 3 does not exceed 30 nucleotides.

[0021] In some preferred embodiments, the sense and antisense strands are selected from group (1) above. The siRNAs in group (1) have superior Nectin-2 gene knockdown efficiency, can significantly induce T cell activation, and significantly enhance CD8. + The proportion of T cells can significantly increase the apoptosis rate of tumor cells.

[0022] In some embodiments, the modifications in any of the above groups include at least one of 3'dTdT and 2'-O-Me modifications.

[0023] In some embodiments, the siRNA is used to reduce the expression of Nectin-2 (the sequence of Nectin-2 is the NM_001042724.2 sequence in the NCBI database).

[0024] Secondly, the present invention provides a coupling material.

[0025] A conjugate comprising an aptamer and siRNA, wherein the siRNA is the siRNA described in the first aspect, and the aptamer is conjugated to the siRNA described in the first aspect.

[0026] In some embodiments, the conjugate is used to reduce the expression of Nectin-2.

[0027] In some embodiments, the aptamer includes an aptamer that targets PPP1CA.

[0028] In some embodiments, the aptamer comprises a modified or unmodified nucleotide sequence as shown in SEQ ID NO:7 (ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGTGGGTATATTTCACGGTAGCACGCATAGG) or a nucleotide sequence having more than 95% identity with SEQ ID NO:7.

[0029] In some embodiments, the aptor is coupled to at least one of the ends of the justice chain 5', the justice chain 3', the antisense chain 5', and the antisense chain 3'.

[0030] In some embodiments, the aptamer is coupled to siRNA via a linker sequence.

[0031] In some embodiments, the linker sequence includes UUU.

[0032] In some embodiments, the coupling comprises at least one group of the following (i) to (iii) groups, modified or unmodified: (i) SEQ ID NO:8 (ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGTGGGTATATTTCACGGTAGCACGCATAGGUUUGACCUGUGAUGUACGAAGCAACCCA) and SEQ ID NO:2; (ii) SEQ ID NO:9 (ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGGGTATATTTCACGGTAGCACGCATAGGUUUCGGCUAUGAUGACAACUGGUACCTT) and SEQ ID NO:4; (iii) SEQ ID NO: 10 (ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGGGTATATTTCACGGTAGCACGCATAGGUUUCGUCACUAUCAUCAGCCGAUACUCC) and SEQ ID NO: 6.

[0033] In some embodiments, the modification of the aptamer or coupling includes 2'-O-Me modification.

[0034] Thirdly, the present invention provides a composition.

[0035] A composition comprising the siRNA described in the first aspect or the conjugate described in the second aspect.

[0036] In some embodiments, the composition further includes a pharmaceutically acceptable carrier.

[0037] Fourthly, the present invention provides a DNA molecule.

[0038] A DNA molecule encoding the siRNA described in the first aspect or the conjugate described in the second aspect.

[0039] Fifthly, the present invention provides a recombinant expression vector.

[0040] A recombinant expression vector, characterized in that it comprises the siRNA described in the first aspect, the conjugate described in the second aspect, or the DNA molecule described in the third aspect.

[0041] In a sixth aspect, the present invention provides a recombinant cell.

[0042] A recombinant cell that expresses the siRNA described in the first aspect, the conjugate described in the third aspect, or the DNA molecule described in the fourth aspect.

[0043] In some embodiments, the recombinant cells comprise the recombinant expression vector described in the fifth aspect.

[0044] In a seventh aspect, the present invention provides an application of the aforementioned siRNA, conjugate, composition, DNA molecule, recombinant expression vector, or recombinant cell.

[0045] The use of the siRNA described in the first aspect, the conjugate described in the second aspect, the composition described in the third aspect, the DNA molecule described in the fourth aspect, the recombinant expression vector described in the fifth aspect, or the recombinant cell described in the sixth aspect in the preparation of a drug; In some embodiments, the drug is used to reduce the expression of Nectin-2.

[0046] In some embodiments, the drug is used to prevent or treat cancer.

[0047] In some embodiments, the cancer includes hepatocytes, pancreatic cells, ovarian cells, prostate cancer, colorectal cancer, endometrioma, gastric cancer, head and neck tumors, breast cancer, testicular cancer, or cervical cancer.

[0048] Eighthly, the present invention provides a reagent kit or a drug.

[0049] A kit or drug comprising the siRNA described in the first aspect, the conjugate described in the second aspect, the composition described in the third aspect, the DNA molecule described in the fourth aspect, the recombinant expression vector described in the fifth aspect, or the recombinant cell described in the sixth aspect.

[0050] In some embodiments, the drug is used to reduce the expression of Nectin-2.

[0051] In some embodiments, the drug is used to prevent or treat cancer.

[0052] In some embodiments, the cancer includes liver cancer, pancreatic cancer, ovarian cancer, prostate cancer, colorectal cancer, endometrial tumor, gastric cancer, head and neck tumor, breast cancer, testicular cancer, or cervical cancer.

[0053] In a ninth aspect, the present invention provides a method for inhibiting the expression of the Nectin-2 gene.

[0054] A method for inhibiting Nectin-2 gene expression, comprising contacting cells in vitro with an effective amount of the siRNA described in the first aspect, the conjugate described in the second aspect, or the composition described in the third aspect.

[0055] In some embodiments, the cells include liver cancer cells, pancreatic cancer cells, ovarian cancer cells, prostate cancer cells, colorectal cancer cells, endometrial tumor cells, gastric cancer cells, head and neck tumor cells, breast cancer cells, testicular cancer cells, or cervical cancer cells.

[0056] Beneficial effects Compared with the prior art, a certain embodiment of the present invention has at least one of the following beneficial technical effects: (1) Novel anti-hepatocellular carcinoma concept: Nectin-2 has not been effectively utilized as a target for siRNA intervention, and there is a lack of relevant research in hepatocellular carcinoma. The siRNA and its conjugates provided by this invention can be autonomously delivered, accurately identify hepatocellular carcinoma cells and effectively knock down the immune checkpoint Nectin-2 gene, thereby inhibiting tumor immune escape, improving the efficiency of immunotherapy and expanding new avenues for the treatment of hepatocellular carcinoma.

[0057] (2) Achieving safe and efficient delivery without transfection agents: Lipofectamine-based cationic liposomes have good siRNA encapsulation capabilities, but they suffer from high toxicity and strong immunogenicity when used in vivo. Polymer carriers such as PEI and PLGA can improve stability, but their preparation is complex and they have potential toxicity. Viral vectors such as adenovirus have strong transduction capabilities, but they carry a large number of exogenous antigens, which can easily induce immune responses, limiting their safety in clinical applications. Antibody-siRNA conjugates are a delivery method developed in recent years, which utilizes the ability of antibodies to recognize specific tumor antigens to achieve targeted delivery of siRNA. However, due to the large molecular weight, complex structure, weak penetration ability, and high production cost of antibodies, their application is limited, and it is difficult to achieve rapid modification and industrial replication. The conjugate provided by this invention can be autonomously delivered to tumor cells without transfection agents. It can rapidly enter the cytoplasm of tumor cells and produce functional effects without the aid of liposomes, polymers, or viral vectors, overcoming the immune risks brought about by the use of exogenous chemical or viral systems in existing technologies. This delivery strategy is highly secure and has unique practical value, distinguishing it from the mainstream delivery systems in the current RNA interference field.

[0058] (3) Achieving safe and efficient knockout without transfection agents: The siRNA and conjugates provided by this invention have good targeting and high safety. They can enter cancer cells (such as liver cancer cells) without the aid of exogenous transfection agents and retain gene silencing function, thereby specifically inhibiting the expression of Nectin-2 in tumor cells, achieving efficient knockdown of the immune checkpoint Nectin-2, thereby activating T cell anti-tumor response, and can be used for precise immunotherapy of tumors (such as liver cancer), with unexpectedly excellent technical effects.

[0059] (4) Effective knockdown of the expression of immune checkpoint Nectin-2: The siRNA sequence si-1 is the optimal interference fragment designed, synthesized and screened by the applicant. The siRNA chimeric in AsiC targets Nectin-2. According to Western blot verification, it can significantly reduce the expression level of the target protein without affecting cell viability, and has a significant silencing effect (interference efficiency >50%). It targets a specific coding region of Nectin-2 mRNA and is stable and efficient in mouse HCC cells.

[0060] (5) Originality of the mechanism of action: Unlike traditional liposome or virus-dependent systems, AsiC can rely on APT04 to recognize and bind to PPP1CA on the surface of liver cancer cells and be taken up by cells through endocytosis. FAM fluorescence tracing experiment showed that it can be internalized by Hepa1-6 cells without transfection agent, and the positive rate of flow cytometry detection exceeded 50%.

[0061] (6) Enhancing T cell immune killing function: The siRNA and conjugates provided in this invention achieve tumor immune regulation through Nectin-2 knockdown. The siRNA in the conjugates provided in this invention targets Nectin-2, and by downregulating its expression, it can significantly enhance the activity of T cells in the co-culture system, such as CD8. + The increased proportion of T cells and the promotion of tumor cell apoptosis are clear and reproducible, providing functional validation support for this invention.

[0062] (7) The novelty and functionality of the APT04 aptamer: The APT04 provided by this invention was independently screened by the applicant and targets the PPP1CA protein on the surface of liver cancer cells. Combined with the experimentally verified functionality (KD value of about 96.1 nM), it not only ensures the specific delivery efficiency of AsiC, but also provides a highly selective target vector for siRNA therapy.

[0063] (8) This invention employs a modular structural design: First, the 3' end of the aptamer APT04 is linked to the 5' end of the siRNA sense strand via a linker to form the Nectin-2 AsiC sense strand; simultaneously, the corresponding siRNA antisense strand is synthesized. Then, both are annealed to form a stable double-stranded nucleic acid structure, i.e., the complete Nectin-2 AsiC molecule. The modular structural design strategy adopted in this invention is applicable to changing different aptamers and siRNA sequences, facilitating expansion to other targets and tumor types. It possesses good technical platform versatility and modification potential. This structural design simplifies the RNA interference construction process while achieving targeted delivery and gene silencing functions.

[0064] (9) Excellent stability: The Nectin-2 AsiC molecule has structural stability. As verified by agarose gel electrophoresis, it can still maintain an intact band after incubation at 37°C for 72 hours in a physiological simulation environment containing 10% FBS, indicating that it has good in vitro stability and is suitable for further cell experiments.

[0065] (10) Excellent Nectin-2 knockdown effect: After entering the cell, Nectin-2 AsiC can release siRNA into the cytoplasm, which then specifically cleaves the mRNA of Nectin-2, significantly reducing its protein expression level. In this invention, Western blot analysis showed that the expression level of Nectin-2 in the Nectin-2 AsiC self-delivery treatment group was significantly lower than that in the control group, verifying its interference effect.

[0066] (11) It has industrial application prospects: the constructed AsiC has a simple structure and mature synthesis process, and can be standardized through commercial oligonucleotide synthesis platforms; at the same time, its nucleic acid properties are easy to modify and label, which facilitates subsequent in vivo tracking, clinical delivery and pharmacokinetic evaluation, providing a feasible new path for RNAi targeted immunotherapy of solid tumors such as liver cancer. Attached Figure Description

[0067] Figure 1 A is a schematic diagram of the structure of the AsiC conjugate of the present invention. The sense strand of the AsiC conjugate is connected to a linker, and then to APT04 (APT04 is a PPP1CA aptamer) to obtain the AsiC sense strand. The sense strand in the AsiC sense strand pairs and binds with the antisense strand to obtain the AsiC conjugate.

[0068] Figure 1B shows the agarose gel electrophoresis images of the AsiC conjugates before and after purification in Example 1. "Unpurified AsiC" represents the AsiC conjugate in the unpurified AsiC solution, "Purified AsiC" represents the purified AsiC conjugate, "AsiC sense" represents the AsiC sense strand, and "AsiC antisense" represents the AsiC antisense strand.

[0069] Figure 1 C is the test result diagram of the thermal stability experiment in Experiment Example 1.

[0070] Figure 2 The graph shows the statistical results of AsiC in vitro delivery efficiency in different groups in Experiment Example 2, where "Untreated" represents the control group.

[0071] Figure 3 Figure A shows the results of Nectin-2 protein expression level detection in different groups in Experiment 3.

[0072] Figure 3 B is a graph showing the results of Nectin-2 protein expression level detection in different groups in Experiment 3.

[0073] Figure 4 A shows the flow cytometry results for different groups in Experiment 4.

[0074] Figure 4 B is a statistical graph showing the total apoptosis rate results of different groups in Experiment 4.

[0075] Figure 3 A, Figure 3 B Figure 4 A and Figure 4 In B, "-Cationic lipid" indicates the autonomous delivery group, and "+Cationiclipid" indicates the liposome group.

[0076] Figure 4 A and Figure 4 In section B, "Non-co-culture" indicates the single-culture group; "co-culture" indicates the co-culture group; and "Total cell apoptosis rate" indicates the total cell apoptosis rate.

[0077] Terminology definition: In this invention, "room temperature" refers to the ambient temperature, which can be 20℃-30℃; in some embodiments, it is 22℃-28℃; in some embodiments, it is 24℃-26℃; and in some embodiments, it is 25℃.

[0078] In the foregoing description of this invention, all figures disclosed herein, whether or not the words “approximately” or “about” are used, are approximate values. Based on the disclosed figures, the value of each figure may vary by less than ±10% or by a difference that is considered reasonable by those skilled in the art, such as ±1%, ±2%, ±3%, ±4%, or ±5%.

[0079] The terms “optional,” “optional,” or “optionally” mean that the event or situation described below may, but is not necessarily, occur. For example, “optional surfactant” means that the surfactant may or may not be present.

[0080] The term “and / or” should be understood to mean any one of the options or any combination of two or more of the options.

[0081] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0082] Small interfering RNA (siRNA): This is a short, double-stranded oligonucleotide of double-stranded RNA that interferes with gene expression in a cell after the molecule is introduced into the cell. For example, it targets and binds to complementary nucleotide sequences in single-stranded target RNA molecules. siRNA molecules are chemically synthesized or otherwise constructed using techniques known to those skilled in the art. Such techniques are described in U.S. Patent Nos. 5,898,031, 6,107,094, 6,506,559, 7,056,704, RE46,873E, and 9,642,873B2, and European Patent Nos. 1214945 and 1230375, all of which are incorporated herein by reference in their entirety. As is customary in the art, when an siRNA molecule is identified by a specific nucleotide sequence, that sequence refers to the sense strand of the double-stranded molecule. One or more ribonucleotides constituting the molecule can be chemically modified using techniques known in the art. In addition to modification at the level of one or more individual nucleotides, the backbone of the oligonucleotide can also be modified. Other modifications include coupling small molecules (e.g., sugar molecules), amino acids, peptides, cholesterol, and other macromolecules to the siRNA molecule.

[0083] The term "identity," used herein to describe an amino acid or nucleic acid sequence relative to a reference sequence, can be determined using the formula described by Karlin and Altschul (Proc. Natl. Acad. Sci. USA 87:2264-2268, 1990, modified as in Proc. Natl. Acad. Sci. USA 90:5873-5877, 1993). This formula is incorporated into the Basic Local Alignment Search Tool (BLAST) procedure by Altschul et al. (J.Mol. Biol. 215: 403-410, 1990). The percentage of sequence identity can be determined using the most recent version of BLAST as of the date of submission of this application.

[0084] The term "over 95% identity" refers to sequence identity with each reference sequence of at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

[0085] In this invention, unless otherwise specified, the term "sense strand" refers to one of the two single strands of siRNA, which has a nucleotide sequence that is partially or completely identical to the nucleotide sequence of the siRNA's action site in the target mRNA; the term "antisense strand" refers to the other single strand of siRNA, which has a nucleotide sequence that is partially or completely complementary to the nucleotide sequence of the siRNA's action site in the target mRNA. This invention mentions that the sense strand of siRNA can form a partially or completely complementary double-stranded structure with the corresponding antisense strand.

[0086] "3'dTdT modification" refers to the chemical modification of nucleic acid molecules (especially oligonucleotides, such as siRNA, antisense oligonucleotides, etc.) by linking two consecutive deoxythymidine (dT) nucleotides at the 3' end (3' end) of the nucleic acid chain.

[0087] "2'-O-Me modification" refers to the chemical modification of nucleic acid molecules (especially oligonucleotides, such as siRNA, antisense oligonucleotides, etc.) in which the 2' hydroxyl group (-OH) of the ribose ring in the nucleotide is replaced by a methoxy group (-OCH3) to form 2'-O-methylribonucleotide.

[0088] "FAM modification" is a common fluorescent labeling modification used in nucleic acid molecules (such as oligonucleotides, primers, probes, etc.), mainly for detection and tracing in molecular biology experiments. FAM is an abbreviation for 6-carboxyfluorescein, a fluorescent dye. FAM usually binds to the 5' end, 3' end, or internal nucleotides of the nucleic acid chain through chemical linkers (such as amino links) to form a stable covalent link.

[0089] The claims and description of this invention retain the U in the RNA nucleotide sequence in accordance with the principle of "accurate description of the actual molecular structure", while the appended sequence listing replaces the U in the RNA nucleotide sequence with T in accordance with the format specifications. Detailed Implementation

[0090] To enable those skilled in the art to better understand the technical solutions of the present invention, some non-limiting embodiments are further disclosed below to provide a more detailed description of the present invention.

[0091] All reagents used in this invention can be purchased commercially or prepared by the methods described in this invention.

[0092] Experimental methods not specified in the examples are generally performed using methods known in the art.

[0093] Example 1: Structural composition and construction principle of AsiC couplings The Nectin-2 AsiC coupling compound of this invention comprises three parts: (1) A nucleic acid aptamer APT04 that can recognize liver cancer cells with high affinity; (2) A small interfering RNA sequence si-1 with the function of targeting and silencing the Nectin-2 gene; (3) A linker region (UUU sequence fragment) connecting APT04 and the positive strand of siRNA is used to ensure molecular conformation and functional stability.

[0094] To obtain the Nectin-2 AsiC conjugate, this invention investigated multiple sequences. The aptamers used in this invention are shown in Table 1, the small interfering RNAs investigated are shown in Table 2, and the aptamer-siRNA conjugates investigated are shown in Table 3.

[0095] Table 1: Aptamers

[0096] Table 2: Small interfering RNA

[0097] Table 3: Aptamer-siRNA Conjugates

[0098] The APT04 was obtained by the applicant through extensive screening. It can bind to the PPP1CA protein, which is highly expressed on the surface of liver cancer cells, with a high affinity. Its equilibrium dissociation constant KD is about 96.1 nM, and it has good tumor targeting.

[0099] The siRNA sequence si-1 is the optimal interference fragment designed, synthesized and screened by the applicant. It has a significant silencing effect (interference efficiency >50%), targets a specific coding region of Nectin-2 mRNA, and exhibits stable and efficient performance in mouse HCC cells.

[0100] This invention employs a modular structural design (detailed synthesis process is shown in Experimental Example 1). First, the 3' end of the aptamer APT04 is linked to the 5' end of the siRNA sense strand via a linker to form the AsiC sense strand; simultaneously, the corresponding siRNA antisense strand is synthesized. Both are then annealed to form a stable double-stranded nucleic acid structure, as shown in Table 3 for the different complete aptamer-siRNA conjugates.

[0101] Subsequent investigations revealed that NC, si-3, other siRNAs, and their aptamer-siRNA conjugates were far less effective at knocking out Nectin-2 than Con AsiC and Nectin-2 AsiC, and will not be discussed in detail here.

[0102] Experimental Example 1: Coupling, Detection, and Stability Study of AsiC Couplings The specific preparation methods of the aptamer-siRNA conjugates Con AsiC, Nectin-2 AsiC, FAM-Con AsiC, and FAM-Nectin-2 AsiC in Table 3 are as follows: a. AsiC coupling (1) In a clean bench, mix AsiC sense and AsiC antisensee in an eight-tube bundle at a ratio of 2 times the molar excess of the short chain. Use 1×DEPC-DPBS (Thermo Fisher Scientific) as the diluent, and each tube should not exceed 60 μL.

[0103] (2) After the liquid is added, gently swirl it and then leave it momentarily.

[0104] (3) Place the mixture in a PCR instrument and set the program: heat at 95°C for 10 min, then anneal at 60°C for 7 min. Cool the mixture to room temperature (25°C) at a rate of 0.1°C / s.

[0105] (4) After cooling to room temperature for 30 min, remove the product, centrifuge briefly, collect the supernatant to obtain the unpurified AsiC solution, and store it at room temperature overnight. The AsiC conjugate sequence and its structural fragments are shown in Tables 1-3. In the immunofluorescence and AsiC in vitro delivery efficiency verification experiments, AsiC was labeled with FAM.

[0106] b. AsiC purification In the experiment, Hieff NGS® Smarter DNA Clean Beads (50 bp or more) were used to purify the annealed AsiC double strands. The steps are as follows: (1) Remove the magnetic beads from the refrigerator and allow them to equilibrate to room temperature for at least 30 minutes.

[0107] (2) Transfer the AsiC samples that have been annealed and coupled in the eight-tube bundle to the new tube according to the experimental group.

[0108] (3) Prepare 80% ethanol (anhydrous ethanol mixed with DEPC-ddH2O).

[0109] (4) Invert the magnetic beads thoroughly to ensure even mixing.

[0110] (5) Add 2.2 times the volume of magnetic beads to the unpurified AsiC solution obtained in “a. AsiC coupling” and incubate at room temperature for 8 min.

[0111] (6) After a short centrifugation, the sample is placed in a magnetic separator and left to stand for 5-10 minutes until the solution is clear. The supernatant is then slowly removed from the opposite side of the magnetic beads.

[0112] (7) The centrifuge tubes were kept in the magnetic rack, and a certain volume of freshly prepared 80% ethanol was added to completely cover the magnetic beads. After 30 seconds, the supernatant was immediately removed.

[0113] (8) Repeat step 7 for a total of 2 rinses.

[0114] (9) Keep the centrifuge tubes fixed in the magnetic rack, completely remove the liquid adhering to the tube wall, open the tube cap and dry at room temperature for about 5-6 minutes until the surface of the magnetic beads is free of moisture and just begins to crack.

[0115] (10) Remove the centrifuge tube from the magnetic rack, add 21 μL DEPC-ddH2O, gently blow and mix, and let stand at room temperature for 8 min.

[0116] (11) Briefly centrifuge the sample and place it back in the magnetic rack. Time for about 5 minutes until the solution is clear, and accurately aspirate 20 μL of supernatant into a new centrifuge tube.

[0117] (12) Add 5 μL of 5×DEPC-DPBS to obtain the purified Con AsiC, Nectin-2 AsiC, FAM-Con AsiC and FAM-Nectin-2 AsiC conjugates, and label them.

[0118] (13) The nucleic acid concentration of AsiC conjugates (Con AsiC, Nectin-2 AsiC, FAM-Con AsiC, FAM-Nectin-2 AsiC) was detected by an ultra-micro spectrophotometer.

[0119] c. Agarose gel electrophoresis (1) Prepare a clean conical flask, a glue tank and a suitable comb, and weigh an appropriate amount of agarose into the conical flask.

[0120] (2) Dilute agarose with 1×TAE buffer and heat to prepare 2% agarose gel.

[0121] (3) After the slightly boiling agarose solution is naturally cooled to a suitable temperature, add nucleic acid fluorescent dye with a final concentration of 0.01%, mix well, pour into a gel, and let it stand to solidify.

[0122] (4) Place the gel in the electrophoresis tank, add TAE to immerse it, remove the comb and add the sample.

[0123] (5) Electrophoresis was performed at a constant voltage of 110 V for approximately 90 minutes. Electrophoresis was stopped promptly when bromophenol blue migrated to the appropriate position on the gel, and images were recorded.

[0124] d. Thermal stability experiment The stability of the aptamer-siRNA conjugate was investigated in 1×DEPC-DPBS (diethyl pyrocarbonate-treated calcium-magnesium phosphate buffer) and 10% fetal bovine serum (FBS). The conjugates were incubated at 37°C for 0 h, 12 h, 24 h, 48 h, and 72 h. Samples were taken at each time point, and RNase inhibitors and protein denaturants were added. The mixture was then incubated at 65°C for 10 min to remove serum proteins and RNase, thus stopping degradation. The content of the aptamer-siRNA conjugate was detected using a 2% agarose gel electrophoresis. Results are shown below. Figure 1 C.

[0125] Results: After renaturation treatment, APT04-siRNA sense-strand and anti-sense strand were coupled ( Figure 1 A), the results of the coupled and purified control group (Con Asic) and experimental group (Nectin-2 Asic) were detected using 2% agarose gel electrophoresis, as shown in Figure 1. Figure 1As shown in Figure B, both Con Asic and Nectin-2 Asic can form a single band after coupling; thermal stability experiments of the coupling show that the coupling can remain undegraded within 24 hours in 10% FBS. Figure 1 C).

[0126] Conclusion: The Con Asic conjugate and Nectin-2 Asic conjugate obtained in this invention have good stability and purity, and can be used for subsequent experiments.

[0127] Experimental Example 2: AsiC In Vitro Delivery Efficiency Detection FAM-Con AsiC and FAM-Nectin-2 AsiC conjugates: The AsiC conjugates (FAM-Con AsiC and FAM-Nectin-2 AsiC) obtained in Example 1 were directly added to adherent Hepa1-6 cells and incubated for 48 hours without transfection reagents. Cells were collected, washed three times with PBS, and resuspended in PBS. FAM fluorescence signals were detected by flow cytometry to assess the efficiency of AsiC conjugate entry into cells.

[0128] Control group: A control group without AsiC conjugate treatment was set up (except for the treatment without AsiC conjugate, the other operations were the same as those for FAM-Con Asic conjugate).

[0129] All experiments were repeated at least three times. Experimental data were analyzed using GraphPad Prism 9 software. Results are expressed as mean ± standard deviation. Statistical analysis was performed using independent samples t-tests, and significance was marked with *. p <0.05, ** p <0.01, *** p <0.001.

[0130] Result: As Figure 2 As shown, after aptamer conjugation, the efficiency of FAM-Con Asic conjugate and FAM-Nectin-2 AsiC conjugate entering cells was significantly higher than that of the control group.

[0131] Conclusion: Nucleic acid aptamers targeting PPP1CA can deliver siRNA to target cells without the need for transfection reagents.

[0132] Experimental Example 3: Nectin-2 Knockdown Experiment Si-1, Si-2, and AsiC conjugate transfection was divided into liposome-based and autonomous delivery groups: (1) Liposome group: The purified Con Asic, purified Nectin-2 Asic, si-1, and si-2 were mixed with the transfection reagent (Lipo6000) in Opti-MEM and transfected into Hepa1-6 cells. After incubation at 37°C for 6 hours, the complete culture medium was replaced.

[0133] (2) Autonomous delivery group: The purified Con Asic, purified Nectin-2 Asic, si-1 and si-2 were directly added to the culture medium of Hepa1-6 cells (mouse liver cancer cell line, ATCC), incubated at 37°C for 6 hours, and then 10% FBS was added and cultured for another 72 hours.

[0134] The above knockout experiments used the same molar amount of drug (based on siRNA) and the same number of Hepa1-6 cells. The knockdown effect was assessed by detecting the expression level of Nectin-2 protein using Western blot.

[0135] All experiments were repeated at least three times. Experimental data were analyzed using GraphPad Prism 9 software. Results are expressed as mean ± standard deviation. Statistical analysis was performed using independent samples t-tests, and significance was marked with *. p <0.05, ** p <0.01, *** p <0.001.

[0136] Result: As Figure 3 A and Figure 3 As shown in B, Con Asic and Nectin-2 Asic were placed in a transfection-free environment (where no transfection reagent was used). Figure 3 A (left side), or there is transfection reagent ( Figure 3 The knockdown efficiency of si-1 on Nectin-2 in Hepa1-6 cells was tested under the intermediate condition (A), with si-1 as the control. The results are as follows: Figure 3 As shown in A and 3B, under conditions without transfection reagents, Nectin-2 Asic can significantly knock down Nectin-2 in Hepa1-6 cells, and its knockdown effect is comparable to that of si-1 in the liposome group.

[0137] in conclusion: (1) Nectin-2 Asic can effectively knock down specific genes in target cells without the need for transfection reagents, providing a basis for subsequent cell and animal experiments.

[0138] (2) The Nectin-2 Asic provided by the present invention can effectively knock down a specific gene (Nectin-2) in target cells without the addition of transfection reagents. This avoids the use of transfection reagents, is closer to the physiological environment in vivo, avoids the toxicity or stress response of transfection reagents to normal cells, and reduces costs, thus having unexpected technical effects.

[0139] Experiment 4: Co-culture experiment of tumor cells and T cells Hepa1-6 cells (mouse liver cancer cells) from different groups in Experiment 3, 72 hours after Nectin-2 gene knockdown, were respectively divided into groups of 4×10⁻⁶ cells. 5 Each cell was seeded into a 6-well plate and co-cultured with CTLL-2 cells (mouse T lymphocytes) at a ratio of 5:1 as the co-culture group. A separate Hepa1-6 cell culture group (i.e., not co-cultured with CTLL-2 cells, as a negative control) was also set up.

[0140] After 48 hours of co-culture, cells were collected for subsequent apoptosis detection and flow cytometry analysis to evaluate the effect of AsiC conjugate knockdown of Nectin-2 on T cell activity.

[0141] Results: The results are as follows Figure 4 A and Figure 4 As shown in B, without the transfection reagent (autologous delivery group), knocking down Nectin-2 with Con AsiC or Nectin-2 AsiC significantly promoted the apoptosis of Hepa1-6 cells by T lymphocytes (P<0.001). This apoptosis-inducing effect was comparable to that of transfecting Hepa1-6 cells with si-1 or si-2 alone (P<0.001). However, in the transfection reagent group, knocking down Nectin-2 AsiC did not significantly promote the apoptosis of Hepa1-6 cells.

[0142] in conclusion: (1) The above results show that Con AsiC and Nectin-2 AsiC can be targeted and delivered to tumor cells without relying on transfection reagents, and have a significant knockdown effect on Nectin-2 in tumor cells and induce apoptosis. This avoids the use of transfection reagents, is closer to the physiological environment in vivo, avoids the toxicity or stress response of transfection reagents to normal cells, and can reduce costs, with unexpected technical effects.

[0143] (2) Compared with Con AsiC, the Nectin-2 AsiC provided by the present invention has a better Nectin-2 knockout efficiency in the co-culture group without the addition of transfection reagent, indicating that the Nectin-2 AsiC provided by the present invention has a better Nectin-2 knockout efficiency in close to the physiological environment in vivo.

[0144] The method of this invention has been described through preferred embodiments. Those skilled in the art will readily be able to modify or appropriately alter and combine the methods and applications described herein within the scope, spirit, and context of this invention to implement and apply the technology of this invention. Those skilled in the art can refer to the content herein to appropriately improve process parameters. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included within the scope of this invention.

Claims

1. A siRNA, characterized in that, This includes a justice chain and an antisense chain; the justice chain and antisense chain are selected from one of the following groups (1) to (3): (1) The siRNA comprises a sense strand 1 and an antisense strand 1, wherein the sense strand 1 contains a modified or unmodified nucleotide sequence as shown in SEQ ID NO:1 (5'-GACCUGUGAUGUACGAAGCAACCCA-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:1; and the length of the sense strand 1 does not exceed 30 nucleotides; The antisense strand 1 comprises: a modified or unmodified nucleotide sequence as shown in SEQ ID NO:2 (5'-UGGGUUGCUUCGUACAUCACAGGUCAG-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:2; and the length of the antisense strand 1 does not exceed 30 nucleotides; (2) The siRNA comprises a sense strand 2 and an antisense strand 2, wherein the sense strand 2 contains a modified or unmodified nucleotide sequence as shown in SEQ ID NO:3 (5'-CGGCUAUGAUGACAACUGGUACCTT-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:3; and the length of the sense strand 2 does not exceed 30 nucleotides; The antisense strand 2 comprises: a modified or unmodified nucleotide sequence as shown in SEQ ID NO:4 (5'-AAGGUACCAGUUGUCAUCAUAGCCGGA-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:4; and the length of the antisense strand 2 does not exceed 30 nucleotides; (3) The siRNA comprises a sense strand 3 and an antisense strand 3, wherein the sense strand 3 contains a modified or unmodified nucleotide sequence as shown in SEQ ID NO:5 (5'-CGUCACUAUCAUCAGCCGAUACUCC-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:5; and the length of the sense strand 3 does not exceed 30 nucleotides; The antisense strand 3 comprises: a modified or unmodified nucleotide sequence as shown in SEQ ID NO:6 (5'-GGAGUAUCGGCUGAUGAUAGUGACGGU-3') or a nucleotide sequence having more than 95% identity with the modified or unmodified SEQ ID NO:6; and the length of the antisense strand 3 does not exceed 30 nucleotides; Optionally, the modifications in any of the above groups include at least one of 3'dTdT and 2'-O-Me modifications; Optionally, the siRNA is used to reduce the expression of Nectin-2.

2. A conjugate, characterized in that, The conjugate includes an aptamer and siRNA, wherein the siRNA is the siRNA of claim 1, and the aptamer is conjugated to the siRNA of claim 1; Optionally, the conjugate is used to reduce the expression of Nectin-2; Optionally, the aptamer includes an aptamer targeting PPP1CA; Optionally, the aptamer comprises a modified or unmodified nucleotide sequence as shown in SEQ ID NO:7 (ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGTGGGTATATTTCACGGTAGCACGCATAGG) or a nucleotide sequence having more than 95% identity with SEQ ID NO:

7. Optionally, the aptamer is coupled to at least one of the ends of the justice chain 5', the justice chain 3', the antisense chain 5', and the antisense chain 3'. Optionally, the aptamer is coupled to siRNA via a linker sequence; Optionally, the linker sequence includes UUU; Optionally, the coupling includes at least one group of the following (i) to (iii) groups, modified or unmodified: (i) SEQ ID NO:8 (ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGTGGGTATATTTCACGGTAGCACGCATAGGUUUGACCUGUGAUGUACGAAGCAACCCA) and SEQ ID NO:2; (ii) SEQ ID NO:9 (ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGGGTATATTTCACGGTAGCACGCATAGGUUUCGGCUAUGAUGACAACUGGUACCTT) and SEQ ID NO:4; (iii) SEQ ID NO: 10 (ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGGGTATATTTCACGGTAGCACGCATAGGUUUCGUCACUAUCAUCAGCCGAUACUCC) and SEQ ID NO:

6.

3. A composition, characterized in that, Includes the siRNA of claim 1 or the conjugate of claim 2; Optionally, the composition may further include a pharmaceutically acceptable carrier.

4. A DNA molecule, characterized in that, The DNA molecule encodes the siRNA of claim 1 or the conjugate of claim 2.

5. A recombinant expression vector, characterized in that, It comprises the siRNA of claim 1, the conjugate of claim 2, or the DNA molecule of claim 4.

6. A recombinant cell, characterized in that, The recombinant cells express the siRNA of claim 1, the conjugate of claim 2, or the DNA molecule of claim 4.

7. The recombinant cell according to claim 6, wherein the recombinant cell comprises the recombinant expression vector according to claim 5.

8. The use of the siRNA of claim 1, the conjugate of claim 2, the composition of claim 3, the DNA molecule of claim 4, the recombinant expression vector of claim 5, or the recombinant cell of any one of claims 6-7 in the preparation of a drug; Optionally, the drug is used to reduce the expression of Nectin-2; Optionally, the drug is used for the prevention or treatment of cancer; Optionally, the cancers include liver cancer, pancreatic cancer, ovarian cancer, prostate cancer, colorectal cancer, endometrial tumor, stomach cancer, head and neck tumors, breast cancer, testicular cancer, or cervical cancer.

9. A reagent kit or drug, characterized in that, Includes the siRNA of claim 1, the conjugate of claim 2, the composition of claim 3, the DNA molecule of claim 4, the recombinant expression vector of claim 5, and the recombinant cell of any one of claims 6-7; Optionally, the drug is used to reduce the expression of Nectin-2; Optionally, the drug is used for the prevention or treatment of cancer; Optionally, the cancers include liver cancer, pancreatic cancer, ovarian cancer, prostate cancer, colorectal cancer, endometrial tumor, stomach cancer, head and neck tumors, breast cancer, testicular cancer, or cervical cancer.

10. A method for inhibiting Nectin-2 gene expression, characterized in that, This includes contacting cells in vitro with an effective amount of the siRNA of claim 1, the conjugate of any one of claims 2-4, or the composition of claim 5; Optionally, the cells include liver cancer cells, pancreatic cancer cells, ovarian cancer cells, prostate cancer cells, colorectal cancer cells, endometrial tumor cells, gastric cancer cells, head and neck tumor cells, breast cancer cells, testicular cancer cells, or cervical cancer cells.

Citation Information

Patent Citations

  • Marker of PPP1CA for liver cancer diagnosis as well as prognosis detection and application thereof

    CN107271670A

  • Method and medicament for inhibiting the expression of a defined gene

    EP1214945A2

  • Inhibiting gene expression with dsrna

    EP1230375A1

  • Oligoribonucleotides for cleaving RNA

    US5898031A

  • Oligoribonucleotides and ribonucleases for cleaving RNA

    US6107094A