SNP molecular marker, KASP primer, kit and method for detecting content character of panax notoginseng ginsenoside Rf

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker, a KASP primer, a kit and a method for detecting the content character of ginsenoside Rf in panax notoginseng, and elaborates the practical application of the kit in breeding of the content character of ginsenoside Rf in panax notoginseng. The SNP molecular marker involved in the invention is SNP-14241055, and the marker is located on the 12th chromosome (Chr12), and the specific position is the 14241055th basic group. In addition, the base mutation type of the SNP marker is G / A. According to the invention, a set of KASP (Kompeste Allele Specific PCR) primer combination is developed, and the combination can be used for accurately distinguishing pseudo-ginseng plant individuals with high ginsenoside Rf content and pseudo-ginseng plant individuals with low ginsenoside Rf content. By using the primer combination, the molecular-assisted marker breeding technology can be effectively applied to the breeding process of the panax notoginseng plant, the operation is simple and convenient, the cost is lower, the breeding period of a new variety is shortened, and the primer combination can be used for long-term breeding tracking and variety tracing. Therefore, the method disclosed by the invention is of great significance in accelerating precise breeding of the panax notoginseng with high ginsenoside Rf content.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics and breeding technology, and specifically relates to an SNP molecular marker, KASP primer, kit, and method for detecting the content of ginsenoside Rf in Panax notoginseng. Background Technology

[0002] Sanqi Panax notoginseng (Burk.) FHChen belongs to the genus Panax, family Araliaceae. Panax *Panax notoginseng*, a perennial herb mainly produced in Wenshan Prefecture, Yunnan Province, is also known as Tianqi powder or Jinbuhuan. It is a precious traditional Chinese medicine, with the root used medicinally. *Panax notoginseng* is rich in saponins, polysaccharides, and flavonoids. Ginsenosides are the most important active ingredient in *Panax notoginseng*, and the content and types of saponins are important indicators for evaluating its quality. Studies have found that saponin sugar chain degradation or C-17 side chain changes produce rare ginsenosides with higher bioavailability and significant pharmacological activities, such as anti-tumor, hepatoprotective, and nervous system protective effects. Ginsenoside Rf, a secondary saponin in *Panax notoginseng*, has received widespread attention in recent years. Research shows that ginsenoside Rf has various pharmacological activities, exerting anti-tumor effects through multiple mechanisms such as inhibiting tumor cell proliferation, inducing tumor cell apoptosis, and inhibiting tumor angiogenesis. In addition, ginsenoside Rf also has antioxidant, anti-inflammatory, and anti-fatigue pharmacological activities, playing a positive role in improving human health.

[0003] Despite years of artificial cultivation, Panax notoginseng retains a mixed genetic background with rich genetic diversity. As a cross-pollinated plant, Panax notoginseng exhibits high heterozygosity of single genes, a complex genetic basis, and a long growth period, making pure-line breeding extremely difficult. Currently, Panax notoginseng variety selection primarily relies on group mixed selection, which is the main breeding technology currently meeting the needs of Panax notoginseng variety selection. Quality breeding is the core measure for selecting superior varieties, but traditional breeding methods have limitations in efficiency and accuracy. The emergence and application of high-throughput sequencing and genome association analysis (GWAS) have opened up new avenues for the genetic improvement and variety selection of Panax notoginseng. High-throughput sequencing technology can comprehensively analyze the genetic information of Panax notoginseng, revealing its genetic diversity and providing strong support for precision breeding.

[0004] With the continuous advancement of omics technologies, the use of molecular markers in molecular genetic breeding of medicinal plants has significantly improved breeding efficiency and made it possible to target molecular breeding for enhancing the effective components of medicinal plants. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by variations in a single nucleotide at the genomic level, including base insertions and deletions, transversions, and transitions; it is the most common type of heritable variation. As a third-generation molecular marker, SNPs are widely used in molecular genetics, genome research, genetic breeding, and many other fields. Compared with other molecular markers, SNPs are widely distributed, genetically stable, and easy to genotype, making them very suitable for rapid interspecific identification. The content and types of saponins in Panax notoginseng are core objectives in Panax notoginseng variety selection. Therefore, utilizing known saponin biosynthesis genes and abundant Panax notoginseng germplasm resources, this study aims to identify SNPs significantly associated with ginsenoside content in Panax notoginseng, develop KASP molecular markers for assisted breeding, and achieve early molecular-assisted selection of target traits to improve breeding efficiency and accelerate the selection process for superior varieties. Summary of the Invention

[0005] To address the above-mentioned problems, the purpose of this invention is to provide an SNP molecular marker, KASP primers, kit, and method for detecting the content of ginsenoside Rf in Panax notoginseng.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A SNP molecular marker associated with the content of ginsenoside Rf in Panax notoginseng, wherein the SNP molecular marker is SNP-14241055, located at position 14241055 on chromosome Chr12 of Panax notoginseng, and the allele at this locus is G or A.

[0007] Further preferred, the ginsenoside Rf content of Panax notoginseng plants with genotype AA at the SNP-14241055 locus is significantly higher than that of plants with genotype GG or GA.

[0008] This invention also provides a set of KASP genotyping primer pairs for detecting the SNP molecular markers, the primer pairs comprising: Upstream primer SNP-F: 5'-GAAGGTGACCAAGTTCATGCTGTGGGCATAAGATGGGGTGG-3'; Upstream primer SNP-H: 5'-GAAGGTCGGAGTCAACGGATTGTGGGCATAAGATGGGGTGA-3'; Downstream primer SNP-R: 5'-CCCCTGAATTTCCTCCTCATTTACA-3'.

[0009] The present invention also provides a kit for assisted breeding of ginsenoside Rf content in Panax notoginseng, comprising the aforementioned KASP genotyping primer pair.

[0010] This invention also provides a KASP genotyping method for detecting the content of ginsenoside Rf in Panax notoginseng, comprising the following steps: S1. Obtain the genomic DNA of the Panax notoginseng sample to be tested; S2. Using the DNA obtained in step S1 as a template, perform PCR amplification using the KASP genotyping primer pair described above. S3. Detect the fluorescence signal of the PCR amplification product to determine the genotype of the SNP molecular marker site; S4. Based on the genotype, determine the potential content of ginsenoside Rf in the Panax notoginseng sample.

[0011] More preferably, in step S4, if the genotype is AA, the Panax notoginseng sample is judged to have the potential for high anthropogenic saponin Rf content; if the genotype is GG or GA, the Panax notoginseng sample is judged to have the potential for low anthropogenic saponin Rf content.

[0012] More preferably, the PCR amplification reaction procedure in step S2 includes: first, a hot start at 95°C for 10 minutes; then, 10 cycles of landing PCR, each cycle including denaturation at 95°C for 20 seconds, and an annealing / extension step of 45 seconds starting at 61°C and decreasing by 0.6°C per cycle; finally, 40 cycles of conventional PCR, each cycle including denaturation at 95°C for 20 seconds and annealing / extension at 55°C for 40 seconds.

[0013] More preferably, the PCR amplification reaction system in step S2 is 2 μL, comprising: 1 μL of 2× KASPMaster Mix, 1 μL of template DNA at a concentration of 5-50 ng / μL, and the upstream primers F and H and the downstream primer R.

[0014] More preferably, in step S1, the genomic DNA is extracted using the CTAB method.

[0015] The present invention has the following beneficial effects: Firstly, the SNPs significantly associated with ginsenoside Rf content in Panax notoginseng provided in this invention were obtained through association analysis of 209 natural Panax notoginseng populations. SNP loci were used as genotype data, and ginsenoside Rf content was used as phenotypic data. Genome-wide association analysis (GWAS) was performed using EMMAX software with a mixed linear model (MLM). The SNP molecular marker SNP-14241055, located at base 14241055 on chromosome 12, provides technical support for marker-assisted breeding of the ginsenoside Rf content trait in Panax notoginseng.

[0016] Secondly, the KASP primer combination developed in this invention can directly and specifically distinguish and detect the G or A bases at the mutation site of SNP-14241055. When using this KASP primer combination to identify the levels of ginsenoside Rf, the two genotypes can be clearly separated. In molecular marker SNP-14241055, the dot near the Y-axis indicates the AA allelic variant site, with the genotype being AA, and the ginsenoside Rf content of Panax notoginseng with this genotype is relatively high. The dot near the X-axis indicates the GG allelic variant site, with the genotype being GG, and the ginsenoside Rf content of Panax notoginseng with this genotype is relatively low. The KASP primer combination developed in this invention has good application value, enabling pre-selection and molecular-assisted breeding of the ginsenoside Rf content trait in Panax notoginseng. It can accurately identify Panax notoginseng plants with high ginsenoside Rf content in the early stages of breeding, thereby avoiding elimination when undesirable traits are discovered later, greatly saving time and resources. It has important theoretical and practical guiding significance for the genetic improvement process of breeding for ginsenoside Rf content in Panax notoginseng and improving the efficiency of breeding selection. Attached Figure Description

[0017] Figure 1 Manhattan and QQ-plots of GWAS results for ginsenoside Rf in Panax notoginseng; Figure 2 A statistical graph showing the allelic variation and phenotypic significance of ginsenoside Rf content in Panax notoginseng; Figure 3 Genotyping results of different Panax notoginseng samples using KASP-specific primers. Detailed Implementation

[0018] The following description, in conjunction with specific embodiments of the present invention, provides further details. It should be noted that these descriptions are intended to aid in understanding the invention but do not constitute a limitation thereof. Furthermore, the technical features described in the various embodiments of the invention below can be combined with each other as long as they do not conflict with each other.

[0019] Example 1 Nucleotide mutation sites (SNPs) related to the content of ginsenoside Rf in Panax notoginseng were obtained. (1) DNA extraction and high-throughput sequencing: We collected 209 Panax notoginseng natural population materials, extracted genomic DNA using the CTAB method, and performed 10X whole-genome resequencing.

[0020] (2) Determination of ginsenoside Rf content: After drying at 50℃, the sample was pulverized using a pulverizer and passed through a No. 4 sieve. 0.6 g of the sample was accurately weighed using an analytical balance and placed in a 50 ml Erlenmeyer flask. 50 ml of methanol was added, and the flask was weighed. The flask was sealed with sealing film, sonicated for 30 min, and then allowed to stand for 20 h. The sealing film was then removed, and the sample was weighed again. The weight lost due to evaporation was replenished with methanol, and the mixture was shaken well. The solution was filtered through a 0.22 μm microporous membrane to obtain 1 ml of the sample solution. Ginsenoside Rf was quantitatively analyzed using high-performance liquid chromatography (HPLC) with the external standard method. The chromatographic column was an Agilent ZORBAX SB-AQ (3.5µm, 4.6×150mm). The mobile phase consisted of ultrapure water (A) and acetonitrile (B), with the following gradient elution program: 0–20 min, 20%B; 20–55 min, 36%B; 55–60 min, 40%B; 60–70 min, 36–45%B; 70–79 min, 45–60%B; 79–80 min, 80%B; 80–81 min, 80%B; 81.5–83 min, 20%B. The flow rate was 0.5 mL / min, the column temperature was 30℃, and the injection volume was 10 µL. The detection wavelength was 203 nm. The compounds were identified based on their retention time, and quantification was performed using the external standard method, with peak area as the quantification basis.

[0021] (3) Genome-wide association analysis (GWAS) Using SNP loci as genotypic data and ginsenoside Rf content as phenotypic data, genome-wide association studies (GWAS) were performed using EMMAX software with a mixed linear model (MLM). The Manhattan plot and QQ-plot were obtained as shown below. Figure 1Using -log10(P)>6 as a threshold, the X-axis of the Manhattan plot represents each SNP on all chromosomes, and the Y-axis represents the P-value of each SNP. Different colors represent the 12 chromosomes of Panax notoginseng. SNPs above the horizontal line are selected as candidate significant SNP sites. The QQplot can infer the rationality of the model and the location of SNP sites by comparing the positions of predicted and observed values. Among them, the SNP molecular marker SNP-14241055, which is significantly associated with ginsenoside Rf, is located at base 14241055 on chromosome Chr12. By comparing with the Panax notoginseng reference genome, the sequence allelic variation of SNPs was extracted, and combined with the ginsenoside Rf content of the population material for joint analysis, SNP-14241055 has three genotypes: GG, AA, and GA. After t-test, it was found that the AA genotype has a higher ginsenoside Rf content and is the dominant genotype. Figure 2 ).

[0022] The gene sequence containing 100 bp before and after the SNP-14241055 site is shown in SEQ ID NO.1: TCATATATAACTAGATGGGGACTTAGGGTTTTATGATTTGGGAGAAATTGTGGCTGGCATTTTCGAAGTATTTTTTAAGGGTGGGCATAAGATGGGGTG[G / A]CAAGCCATTTGATGTGTGTAAATGAGGAGGAAATTCAGGGGTAGATTCTAAGGGGTATTCTACAAGTTCTATGGATTTGTAGTTAGAGATTTTGTCTTG (SEQ ID NO:1) Example 2 Development of SNP-labeled KASP-specific primers Using NCBI Primer The BLAST function was used to design three primers based on the sequence SEQ ID NO.1: upstream primer SNP-F, upstream primer SNP-H, and downstream primer SNP-R. SNP-F and SNP-H contain FAM and HEX fluorescent linker sequences (underlined), respectively, as shown below: SNP-F: 5'- GAAGGTGACCAAGTTCATGCT GTGGGCATAAGATGGGGTGG-3'; SNP-H: 5'- GAAGGTCGGAGTCAACGGATT GTGGGCATAAGATGGGGTGA-3'; SNP-R: 5'-CCCCTGAATTTCCTCCTCATTTACA-3'.

[0023] Example 3 Genotyping of SNP loci in different Panax notoginseng samples and its application The authenticity of SNP-14241055 in the natural population of Panax notoginseng was verified using the high-throughput genotyping system GeneMatrix (GM). Genomic DNA was extracted from 94 randomly selected Panax notoginseng single plants. Using the genomic DNA as a template, PCR amplification was performed using the SNP marker KASP-specific primers developed in Example 2.

[0024] After diluting the sample DNA 5 times, transfer it to a 100 μL PCR sample plate. Add 2 positive controls and 2 negative control NTCs to each sample plate.

[0025] The KASP reaction system consisted of 2 μL, including 1 μL of 2×Master Mix, 1 μL of 20 ng / μL sample DNA, and 0.01 μL of KASP primer mixture, comprising 0.002 μL of upstream primer 1 (100 μM), 0.002 μL of upstream primer 2 (100 μM), and 0.006 μL of universal primer (100 μM). An equal volume of double-distilled water was used instead of sample DNA in the negative control reaction. The DNA sample plate, primer mixture, and KASPmaster Mix were placed in the corresponding positions on the Arrayer. The 384*1 pipetting protocol was selected, and the DNA and primer mixture were added to the 384-well microplate via the MatrixArrayer. The device automatically constructed the reaction system and heat-sealed the reaction plate.

[0026] The PCR amplification program requires four stages: Stage 1 denaturation at 95°C for 10 min; Stage 2 denaturation at 95°C for 20 s followed by annealing at 61°C for 45 s, for a total of 10 cycles (each cycle decreasing by 0.6°C); Stage 3 denaturation at 95°C for 20 s followed by annealing at 55°C for 40 s, for a total of 40 cycles.

[0027] After PCR amplification, remove the reaction plate and allow it to cool to room temperature. If there is water on the surface, wipe it clean. Place the plate in a scanner for fluorescence scanning. Use a Matrix Scanner to read the fluorescence signal values ​​and perform genotyping and clustering of the samples. In the molecular marker SNP-14241055, samples showing blue near the Y-axis are alleles linked to the HEX fluorescent tag sequence, i.e., carrying the AA allele, with genotype AA. This genotype of Panax notoginseng has a relatively high content of ginsenoside Rf. Samples showing red near the X-axis are alleles linked to the FAM fluorescent tag sequence, i.e., carrying the GG allele, with genotype GG. This genotype of Panax notoginseng has a relatively low content of ginsenoside Rf. Figure 3 ).

[0028] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker related to the content of ginsenoside Rf in Panax notoginseng, characterized in that, The SNP molecular marker is SNP-14241055, located at position 14241055 on chromosome 7Chr12, and the allele at this locus is G or A.

2. The SNP molecular marker according to claim 1, characterized in that, The ginsenoside Rf content of Panax notoginseng plants with genotype AA at the SNP-14241055 locus was significantly higher than that of plants with genotypes GG or GA.

3. A set of KASP genotyping primer pairs for detecting the SNP molecular marker of claim 1, characterized in that, The primer pair comprises: Upstream primer SNP-F: 5'-GAAGGTGACCAAGTTCATGCTGTGGGCATAAGATGGGGTGG-3'; Upstream primer SNP-H: 5'-GAAGGTCGGAGTCAACGGATTGTGGGCATAAGATGGGGTGA-3'; Downstream primer SNP-R: 5'-CCCCTGAATTTCCTCCTCATTTACA-3'.

4. A kit for assisted breeding of Panax notoginseng with ginsenoside Rf content, characterized in that, It includes the KASP genotyping primer pair as described in claim 3.

5. A KASP genotyping method for detecting the content of ginsenoside Rf in Panax notoginseng, characterized in that, Includes the following steps: S1. Obtain the genomic DNA of the Panax notoginseng sample to be tested; S2. Using the DNA obtained in step S1 as a template, perform PCR amplification using the KASP genotyping primer pair described in claim 3. S3. Detect the fluorescence signal of the PCR amplification product to determine the genotype of the SNP molecular marker site; S4. Based on the genotype, determine the potential content of ginsenoside Rf in the Panax notoginseng sample.

6. The method according to claim 5, characterized in that, In step S4, if the genotype is AA, the Panax notoginseng sample is judged to have the potential for high anthropogenic saponin Rf content; if the genotype is GG or GA, the Panax notoginseng sample is judged to have the potential for low anthropogenic saponin Rf content.

7. The method according to claim 5, characterized in that, The PCR amplification reaction procedure in step S2 includes: first, a hot start at 95°C for 10 minutes; then, 10 cycles of landing PCR, each cycle including denaturation at 95°C for 20 seconds, and an annealing / extension step of 45 seconds starting at 61°C and decreasing by 0.6°C per cycle; finally, 40 cycles of conventional PCR, each cycle including denaturation at 95°C for 20 seconds and annealing / extension at 55°C for 40 seconds.

8. The method according to claim 5, characterized in that, The PCR amplification reaction system in step S2 is 2 μL, containing: 1 μL of 2× KASP Master Mix, 1 μL of template DNA with a concentration of 5-50 ng / μL, and the upstream primers F and H and the downstream primer R as described in claim 3.

9. The method according to claim 5, characterized in that, In step S1, the genomic DNA is extracted using the CTAB method.

Images