Carborane-containing compound and application thereof

Abstract

The invention relates to the fields of medicinal chemistry and pharmacotherapeutics, in particular to a carborane-containing compound and application thereof. The carborane-containing compound provided by the invention has a structure as shown in formula I. The compound provided by the invention has increased hydrophobicity and larger specific surface area of carborane, so that hydrophobic contact with a non-polar region of protein can be increased, the affinity of a drug to a hydrophobic region of a receptor binding site is improved, and the drug delivery efficiency is improved. The space volume of the polycyclic skeleton can improve the stability of the drug, and the compound provided by the invention can be used as a TEAD inhibitor for blocking the activity of TEAD and inhibiting the proliferation of tumor cells.

Description

Technical Field

[0001] This invention relates to the fields of medicinal chemistry and pharmacotherapeutic science, and in particular to a compound containing carborane and its uses. Background Technology

[0002] Cancer remains one of the most serious diseases threatening human health. The occurrence and development of tumors and cancer are often related to an imbalance between cell proliferation and apoptosis. The hippopotamus signaling pathway is an evolutionarily conserved signaling pathway that plays a crucial role in cell proliferation, organ size control, stem cell self-renewal, and tissue homeostasis. Abnormal regulation of the hippopotamus signaling pathway is closely linked to the occurrence and progression of solid tumors such as mesothelioma, meningioma, lung cancer, and liver cancer.

[0003] Transcriptional enhancer-associated domains (TEADs) are transcription factors and the final effectors of the hippocampal pathway. The transcriptional activity of the TEAD protein family is regulated by transcriptional coactivators such as YAP / TAZ. TEADs interact with DNA through their N-terminal DNA-binding domain (DBD). Because they lack an activation domain, TEADs must bind to cofactors such as YAP or parallel transcriptional coactivators with a PDZ-binding motif (TAZ) to form a transcriptionally active complex. In mammalian cells, the TEAD protein family has four subtypes: TEAD1, TEAD2, TEAD3, and TEAD4. Aberrant expression and enhanced activity of the TEAD protein family are closely associated with various malignant tumors. Regulating the hippocampal signaling pathway through drug molecules holds great therapeutic potential. Currently, two common strategies exist: one is to target the protein-protein interaction interface of TEAD and YAP with peptides or small molecules; the other is to develop small-molecule inhibitors of the palmitate-binding pocket of TEAD.

[0004] TEAD can undergo S-palmitoylation under physiological conditions to maintain protein stability and function. TEAD palmitoylation is a post-translational modification and a reversible reaction, involving the formation of a covalent bond between a conserved cysteine ​​sulfhydryl group and palmitic acid in the TEAD protein. Studies have shown that the affinity of unpalmitoylated TEAD protein for YAP protein is significantly reduced. Inhibiting TEAD palmitoylation can inhibit TEAD activity; therefore, targeting the palmitoylation pocket of TEAD is considered a therapeutic target for malignant tumors caused by TEAD-YAP / TAZ. Currently, small molecule inhibitors targeting the TEAD palmitoyl binding pocket have been reported, such as the nonsteroidal anti-inflammatory drugs flufenamic acid and niflumic acid.

[0005] The general structural formula of carborane is C2B. 10 H 12 Carboranes are three-dimensional compounds with a multi-electron, multi-center structure composed of CH and BH vertices. They are highly stable, completely delocalized three-dimensional aromatic compounds, with a spatial volume between that of a rotating benzene ring and adamantane. Carboranes exhibit strong hydrophobic interactions, hydrogen bonding via CH···X, and dihydrogen bonding via BH···HX. Summary of the Invention

[0006] In view of the shortcomings of the prior art described above, the object of the present invention is to provide a compound containing carborane and its uses, in order to solve the problems in the prior art.

[0007] To achieve the above and other related objectives, the present invention provides a compound containing carborane, its tautomers, stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts, wherein the carborane-containing compound has the structure shown in Formula I:

[0008]

[0009] R1 is selected from hydrogen atoms, alkyl groups, or haloalkyl groups;

[0010] R2 is selected from hydrogen atoms or halogens;

[0011] R3 is selected from hydrogen atoms, alkyl groups, or haloalkyl groups;

[0012] Ar is selected from benzene rings, substituted benzene rings, pyridine rings, quinoline rings, furan rings, pyrrole rings, thiophene rings, pyrazole rings, imidazole rings, oxazole rings, thiazole rings, pyrimidine rings, or indole rings;

[0013] X is selected from oxygen or nitrogen atoms.

[0014] Preferably, R1 and / or R3 in the compound are C1-C6 alkyl or C1-C6 haloalkyl; preferably, R1 and / or R3 are methyl.

[0015] The present invention also provides the use of the aforementioned compounds in the preparation of TEAD gene inhibitors, or in the preparation of medicaments for the treatment or prevention of diseases related to Hippo pathway dysfunction, or in the preparation of medicaments for the treatment or prevention of TEAD-related diseases.

[0016] The present invention also provides a pharmaceutical composition comprising the aforementioned compound and pharmaceutically acceptable excipients.

[0017] As described above, the compound containing carborane and its use according to the present invention have the following beneficial effects:

[0018] The compounds provided by this invention have a larger specific surface area due to the increased hydrophobicity of carborane, which can increase hydrophobic contact with nonpolar regions of proteins and improve the affinity of drugs for the hydrophobic regions of receptor binding sites. The spatial volume of the polycyclic skeleton will improve the stability of the drug. Furthermore, the compounds provided by this invention can be used as TEAD inhibitors to block TEAD activity and inhibit the proliferation of tumor cells. Attached Figure Description

[0019] Figure 1 The diagram shows the synthetic route of compound L1 in this invention.

[0020] Figure 2 The diagram shows the synthetic route of compound L2 in this invention.

[0021] Figure 3 The diagram shows the synthetic route of compound L3 in this invention.

[0022] Figure 4 The diagram shows the synthetic route of compound L4 in this invention.

[0023] Figure 5 The diagram shows the synthetic route of compound L5 in this invention.

[0024] Figure 6 The diagram shows the synthetic route of compound L6 in this invention.

[0025] Figure 7 The diagram shows the synthetic route of compound L7 in this invention.

[0026] Figure 8 The diagram shows the synthetic route of compound L8 in this invention.

[0027] Figure 9 The diagram shows the synthetic route of compound L9 in this invention.

[0028] Figure 10 The diagram shows the synthetic route of compound L10 in this invention.

[0029] Figure 11 The diagram shows the synthetic route of compound L11 in this invention.

[0030] Figure 12 The diagram shows the synthetic route of compound L12 in this invention.

[0031] Figure 13 The diagram shows the synthetic route of compound L13 in this invention.

[0032] Figure 14 The diagram shows the results of compound L5 inhibiting the expression of downstream target genes of TEAD in this invention. Detailed Implementation

[0033] This invention provides a compound containing carborane, its tautomers, stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts, wherein the carborane-containing compound has the structure shown in Formula I:

[0034]

[0035] in,

[0036] Represents carborane;

[0037] R1 is selected from hydrogen atoms, alkyl groups, or haloalkyl groups;

[0038] R2 is selected from hydrogen atoms or halogens;

[0039] R3 is selected from hydrogen atoms, alkyl groups, or haloalkyl groups;

[0040] Ar is selected from benzene rings, substituted benzene rings, pyridine rings, quinoline rings, furan rings, pyrrole rings, thiophene rings, pyrazole rings, imidazole rings, oxazole rings, thiazole rings, pyrimidine rings, or indole rings;

[0041] X is selected from oxygen or nitrogen atoms. The carborane is an icosahedral carborane.

[0042] In some specific embodiments, R1 and / or R3 in the compound are C1-C6 alkyl or C1-C6 haloalkyl; preferably, R1 and / or R3 are methyl.

[0043] In some specific embodiments, Ar in the compound is a haloalkyl-substituted benzene ring; preferably, Ar is a C1-C6 haloalkyl-substituted benzene ring; more preferably, Ar is a trifluoromethyl-substituted benzene ring.

[0044] In some specific embodiments, the compound further includes any one of the following features:

[0045] 1) R1 is a hydrogen atom, R2 is a hydrogen atom, R3 is a hydrogen atom or a methyl group, and X is a nitrogen atom;

[0046] 2) R1 is a hydrogen atom, R2 is a chlorine atom, R3 is a hydrogen atom or a methyl atom, and X is a nitrogen atom or an oxygen atom;

[0047] 3) R1 is a methyl group, R2 is a chlorine atom, R3 is a hydrogen atom or a methyl group, and X is an oxygen atom.

[0048] In some specific embodiments, the compound is a compound with the following structure:

[0049]

[0050] In some specific embodiments, the compound may also be a compound with the following structure:

[0051]

[0052] In some specific embodiments, the compound may also be a compound with the following structure:

[0053] In some specific embodiments, the compound may also be a compound with the following structure:

[0054]

[0055]

[0056] In some specific embodiments, the compound may also be a compound with the following structure:

[0057]

[0058] In some specific embodiments, the compound may also be a compound with the following structure:

[0059]

[0060] The present invention also provides a method for preparing the aforementioned compound, wherein the preparation method comprises any one of the following methods:

[0061] Preparation method of compound L1

[0062] a1) p-Nitrophenylacetylene and B 10 H 12 The reaction of (CH3CN)2 yields compounds 1-2;

[0063] a2) Compound 1-2 reacts with H2 to give compound 1-3;

[0064] a3) Compounds 1-3 were reacted with 2-(4-bromoaniline)benzoate, t-BuONa, Pd2(dba)3, and XPhos to give compounds 1-4;

[0065] a4) Compounds 1-4 react with BBr3 to give compound L1;

[0066] Alternatively, the preparation method of compound L2.

[0067] b1) N-(2-chloro-4-iodophenyl)acetamide was reacted with Pd(PPh3)2Cl2, CuI, and trimethylethynylsilane to give compound 2-2;

[0068] b2) Compound 2-2 reacts with K2CO3 to obtain compound 2-3;

[0069] b3) Compounds 2-3 and B 10 H 12 The reaction of (CH3CN)2 yields compounds 2-4;

[0070] b4) Compound 2-4 reacts with concentrated hydrochloric acid to give compound 2-5;

[0071] b5) Compound 2-5 was reacted with 2-(4-bromoaniline)benzoate, t-BuONa, Pd2(dba)3, and XPhos to give compound 2-6;

[0072] b6) Compound 2-6 reacts with BBr3 to give compound L2;

[0073] Alternatively, the preparation method of compound L3.

[0074] c1) The reaction of p-fluoronitrobenzene with 2-chloro-4-iodophenol yields compound 3-3;

[0075] c2) Compound 3-3 was reacted with Pd(PPh3)2Cl2, CuI, and trimethylethynylsilane to give compound 3-4;

[0076] c3) Compound 3-4 reacts with K2CO3 to give compound 3-5;

[0077] c4) Compounds 3-5 and B 10 H 12 The reaction of (CH3CN)2 yields compounds 3-6;

[0078] c5) Compound 3-6 reacts with H2 to give compound 3-7;

[0079] c6) Compound 3-7 was reacted with 2-iodobenzoate, t-BuONa, Pd2(dba)3, and XPhos to give compound 3-8;

[0080] c7) Compounds 3-8 react with BBr3 to give compound L3;

[0081] Alternatively, the preparation method of compound L4.

[0082] d1) Compound 2-5 was reacted with 2-(4-bromoaniline)benzoate, t-BuONa, Pd2(dba)3, and XPhos to give compound 4-2;

[0083] d2) Compound 4-2 reacts with BBr3 to give compound L4;

[0084] Alternatively, the preparation method of compound L5.

[0085] e1) Compound 2-5 was reacted with tert-butanol ester of 2-(4-bromoaniline)benzoate to give compound 5-1;

[0086] e2) Compound 5-1 reacts with NaH and iodomethane to give compound 5-2;

[0087] e3) Compound 5-2 reacts with TFA to give compound L5;

[0088] Alternatively, the preparation method of compound L6.

[0089] f1) Compound 3-7 was reacted with tert-butanol ester of 2-(4-bromoaniline)benzoate to give compound 6-1;

[0090] f2) Compound 6-1 reacts with TFA to give compound L6;

[0091] Alternatively, the preparation method of compound L7.

[0092] Compound 1-3 was reacted with methyl 2-(4-iodoaniline)nicotinic acid to give compound 7-1;

[0093] g2) Compound 7-1 reacts with BBr3 to give compound L7;

[0094] Alternatively, the preparation method of compound L8.

[0095] h1) Compound 2-5 was reacted with methyl 2-(4-iodoaniline)nicotinic acid to give compound 8-1;

[0096] h2) Compound 8-1 reacts with BBr3 to give compound L8;

[0097] Alternatively, the preparation method of compound L9.

[0098] i1) Compound 3-7 was reacted with methyl 2-iodonicotinate to give compound 9-1;

[0099] i2) Compound 9-1 reacts with BBr3 to give compound L9;

[0100] Alternatively, the preparation method of compound L10.

[0101] j1) Compound 2-5 was reacted with tert-butanol 3-(4-iodoaniline)benzoate to give compound 10-1;

[0102] j2) Compound 10-1 was reacted with TFA to obtain compound L10;

[0103] Alternatively, the preparation method of compound L11.

[0104] Compound 2-5 was reacted with tert-butanol 2-((4-iodophenyl)-methylamine)benzoate to give compound 11-1;

[0105] Compound 11-1 (k2) reacts with TFA to give compound L11;

[0106] Alternatively, the preparation method of compound L12.

[0107] l1) Compound 2-5 was reacted with methyl 2-((4-iodoaniline)-5-trifluoromethylbenzoate to give compound 12-1;

[0108] Compound 12-1 reacts with BBr3 to give compound L12;

[0109] Alternatively, the preparation method of compound L13.

[0110] Compound 2-5 was reacted with methyl 2-((4-iodoaniline)-quinoline-3-carboxylate to give compound 13-1;

[0111] Compound 13-1 (m2) reacts with BBr3 to give compound L13.

[0112] In some specific embodiments, the preparation method further includes any of the following features:

[0113] A11) Based on the reaction volume of step a1), the molar ratio of p-nitrophenylacetylene to B10H12(CH3CN)2 is 1:1 to 1:1.5;

[0114] A21) Based on the reaction volume of step a3), the molar ratio of compounds 1-3 and 2-(4-bromoaniline)benzoate is 1:0.5-1:1;

[0115] B11) Based on the reaction volume of step b1), the molar ratio of N-(2-chloro-4-iodophenyl)acetamide to trimethylethynylsilane is 1:3.5-1:4.5;

[0116] B21) Based on the reaction volume of step b2), the molar ratio of compound 2-2 and K2CO3 is 1:1.5-1:2.5.

[0117] The present invention also provides the use of the aforementioned compounds in the preparation of TEAD gene inhibitors, or in the preparation of medicaments for the treatment or prevention of Hippo pathway dysfunction-related diseases, or in the preparation of medicaments for the treatment or prevention of TEAD-related diseases.

[0118] In some specific embodiments, the Hippo pathway dysfunction-related disease or TEAD-related disease is a tumor.

[0119] Furthermore, the tumor is selected from one or more of the following: skin cancer, head and neck cancer, lung cancer, liver cancer, stomach cancer, prostate cancer, esophageal cancer, cervical cancer, uterine cancer, pancreatic cancer, breast cancer, kidney cancer, ureteral cancer, bladder cancer, pharyngeal squamous cell carcinoma, basal cell carcinoma, melanoma, tongue cancer, pharyngeal squamous cell carcinoma, malignant lymphoma, laryngeal squamous cell carcinoma, lung squamous cell carcinoma, small cell carcinoma, esophageal squamous cell carcinoma, cervical cancer, and brain tumor.

[0120] The present invention also provides a pharmaceutical composition comprising the aforementioned compounds and pharmaceutically acceptable excipients. The pharmaceutical composition may be administered via systemic or local routes, selected from inner ear administration, ophthalmic administration, intravenous administration, intramuscular administration, subcutaneous administration, oral administration, local contact, intraperitoneal administration, and intralesional administration. The dosage form of the pharmaceutical composition or conjugate is one or more selected from injections, tablets, capsules, aerosols, eye drops, or nasal drops.

[0121] The excipients include various excipients and diluents, which are not essential active ingredients and do not cause excessive toxicity after application. The excipients contain sterile water or physiological saline, stabilizers, excipients, antioxidants (ascorbic acid, etc.), buffers (phosphate, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.), or binders. The excipients also contain other low molecular weight peptides, serum albumin, glycine, glutamine, asparagine, arginine, polysaccharides, monosaccharides, mannitol, or sorbitol. When used in an aqueous solution for injection, the excipients are selected from physiological saline, isotonic glucose solution, D-sorbitol isotonic solution, D-mannose isotonic solution, D-mannitol or sugar alcohol isotonic solution. The aqueous solution for injection contains a solubilizer. The solubilizer is selected from alcohols (ethanol), polyols (propylene glycol or PEG), and / or nonionic surfactants (Tween 80 or HCO-50).

[0122] In the pharmaceutical composition provided by this invention, the aforementioned compound is a single active ingredient, or it can be combined with one or more other active components useful for disease treatment to form a combined formulation. The active components are various other drugs used for disease treatment.

[0123] The content of the active ingredient in the pharmaceutical composition is a safe and effective amount, which should be adjustable by those skilled in the art. For example, the dosage of the aforementioned compound or the active ingredient of the aforementioned pharmaceutical composition depends on the patient's weight, the type of application, the condition and severity of the disease. For example, the dosage of the aforementioned compound or the aforementioned pharmaceutical composition as the active ingredient is 1-1000 mg / kg / day, 1-3 mg / kg / day, 3-5 mg / kg / day, 5-10 mg / kg / day, 10-20 mg / kg / day, 20-30 mg / kg / day, 30-40 mg / kg / day, 40-60 mg / kg / day, 60-80 mg / kg / day, 80-100 mg / kg / day, 100-200 mg / kg / day, 200-500 mg / kg / day, or greater than 500 mg / kg / day.

[0124] The present invention also provides a method for treating tumors, the method comprising administering an effective dose of the aforementioned compound or the aforementioned pharmaceutical composition to a tumor patient.

[0125] In some specific embodiments, the dosage is 1-1000 mg / kg / day. Specifically, the dosage is 1-3 mg / kg / day, 3-5 mg / kg / day, 5-10 mg / kg / day, 10-20 mg / kg / day, 20-30 mg / kg / day, 30-40 mg / kg / day, 40-60 mg / kg / day, 60-80 mg / kg / day, 80-100 mg / kg / day, 100-200 mg / kg / day, 200-500 mg / kg / day, or 500-1000 mg / kg / day.

[0126] In some specific embodiments, the object of the method can be a mammal; preferably, the object of the method is a human.

[0127] In this invention, the term "pharmaceutically acceptable salt" generally refers to any salt that is physiologically tolerable when used in a suitable manner for treatment (particularly when applied or used in humans and / or mammals). This generally means that it is non-toxic, particularly as a result of an anti-ion. These physiologically acceptable salts can be formed with cations or bases, and in the context of this invention, particularly when administered to humans and / or mammals, they should be understood as salts formed from at least one compound provided according to this invention, typically an acid (deprotonated), such as an anion, and at least one physiologically tolerable cation (preferably an inorganic cation). Specifically, in the context of this invention, this may include salts formed with alkali metals and alkaline earth metals, as well as salts formed with ammonium cations (NH4+), specifically including, but not limited to, salts formed with (mono) or (di) sodium, (mono) or (di) potassium, magnesium, or calcium. These physiologically acceptable salts can also be formed with anions or acids, and in the context of this invention, particularly when administered to humans and / or mammals, they should be understood as salts formed from at least one compound provided according to this invention, typically protonated (e.g., on nitrogen), such as a cation, and at least one physiologically tolerable anion. In the context of this invention, this specifically includes salts formed from physiologically tolerable acids, i.e., salts formed from specific active compounds with physiologically tolerable organic or inorganic acids, including but not limited to those with hydrochloric acid, hydrobromic acid, hydroiodic acid; sulfuric acid, persulfate, pyrosulfonic acid; phosphoric acid, nitric acid; methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, trifluoromethanesulfonic acid; formic acid, acetic acid, acetoacetic acid, trifluoroacetic acid, pyruvic acid, propionic acid, butyric acid, valeric acid, hexanoic acid, heptanoic acid, undecanoic acid, lauric acid; benzoic acid, salicylic acid, 2- (4-Hydroxybenzoyl)benzoic acid, camphoric acid, cinnamic acid, cyclopentanepropionic acid, digluconic acid, 3-hydroxy-2-naphthylcarboxylic acid, nicotinic acid, pectic acid, 3-phenylpropionic acid, picric acid, terpentine; 2-hydroxyethanesulfonic acid, aminosulfonic acid, dodecyl sulfate, 2-naphthalenesulfonic acid, naphthalenedisulfonic acid, camphorsulfonic acid; citric acid, tartaric acid, stearic acid, lactic acid, oxalic acid, malonic acid, succinic acid, malic acid, citric acid, alginic acid, maleic acid, fumaric acid, D-gluconic acid, mandelic acid, ascorbic acid, aspartic acid, and salts formed from sulfosalicylic acid.

[0128] In this invention, the term "treatment" refers to any of the following: (1) alleviating one or more biological manifestations of a disease; (2) interfering with one or more points in the biological cascade that triggers the disease; or (3) slowing the development of one or more biological manifestations of a disease.

[0129] In this invention, the term "prevention" refers to reducing the risk of developing a disease.

[0130] In this invention, the term "patient" refers to any animal that has received or is about to receive treatment, preferably a mammal, and most preferably a human. Mammals include, but are not limited to, cattle, horses, sheep, pigs, cats, dogs, mice, rats, rabbits, guinea pigs, monkeys, and humans.

[0131] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0132] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0133] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0134] Example 1: Preparation of compound L1

[0135] The preparation method of compound L1 is as follows: Figure 1 As shown, the details are as follows:

[0136] Step 1: In a dry, round-bottom flask containing a magnetic flask, dissolve 1-1 p-nitrophenylacetylene (3.0 g, 20.4 mmol) in 40 mL of toluene. Add B... 10 H 12 (CH3CN)2 (5.00 g, 24.5 mmol) and AgNO3 (0.34 g, 2.0 mmol) were added to the solution. The reaction mixture was heated to 100 °C and stirred for 4 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was concentrated under reduced pressure and purified by column chromatography (PE:EA = 30:1) to give compounds 1-2 as yellow solids (2.65 g, 49%). 1H NMR (500MHz, CDCl3) δ8.13 (d, J = 9.0 Hz, 2H), 7.61 (d, J = 9.0 Hz, 2H), 3.96 (s, 1H), 3.00–1.50 (br, 10H).

[0137] Step 2: In a dry 100 mL round-bottom flask containing a magnetic stir bar, compound 1-2 (2.65 g, 10.0 mmol) was dissolved in anhydrous methanol (30 mL). Palladium on carbon (0.6 g) containing 55% water and anhydrous zinc chloride (1.25 g, 9.2 mmol) were added, and hydrogen gas was continuously introduced. The mixture was stirred at room temperature for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was concentrated under reduced pressure and purified by column chromatography (PE:EA = 10:1) to obtain compound 1-3, which was a white solid (2.2 g, 94%). 1 H NMR (500MHz, CDCl3) δ8.13 (d, J = 9.0 Hz, 2H), 7.61 (d, J = 9.0 Hz, 2H), 3.96 (s, 1H), 3.00–1.50 (br, 10H).

[0138] Step 3: In a dry 50 mL round-bottom flask equipped with a magnetic stir bar, compounds 1-3 (235 mg, 1.0 mmol) and 2-(4-bromoaniline) benzoate (195 mg, 0.64 mmol) were dissolved in anhydrous toluene (10 mL), and t-BuONa (96.0 mg, 1.0 mmol), Pd2(dba)3 (55 mg, 0.06 mmol), and XPhos (48 mg, 0.1 mmol) were added. The mixture was stirred at 100 °C for 12 hours, and the reaction was monitored by TLC. After the reaction was completed, the mixture was concentrated under reduced pressure and purified by column chromatography (PE:EA = 30:1). Compounds 1-4 were obtained as a white solid (225 mg, 49%). 1 H NMR (500MHz, CDCl3) δ9.39(s,1H),7.96(dd,J=8.0,1.5Hz,1H),7.34(d,J=9.0Hz,2H),7.31(td,J=9.0,1.5Hz,1H),7.19(d,J=9.0Hz,2H),7.14(d,J =8.0Hz,1H),7.10(d,J=8.5Hz,2H),6.87(d,J=8.5Hz,2H),6.72(td,J=1.0 ,8.0Hz,1H),5.79(s,1H),3.91(s,3H),3.86(s,1H),3.00–1.50(br,10H).

[0139] Step 4: In a dry 25 mL round-bottom flask containing a magnetic stir bar, dissolve L-4 (0.15 g, 0.33 mmol) in DCM (5 mL), and slowly add BBr3 (2 M, 0.5 mL) while in an ice bath. Stir at room temperature for 12 hours, and monitor the reaction by TLC. After the reaction is complete, quench the reaction with an appropriate amount of water, adjust the pH to neutral with sodium bicarbonate, extract with dichloromethane, dry the organic phase with anhydrous sodium sulfate, concentrate under reduced pressure, and purify by column chromatography (DCM:MeOH = 75:1). Product L1 is obtained as a white solid (0.13 g, 90%). 1 H NMR (500MHz, DMSO-d6) δ12.98(s,1H),9.53(s,1H),8.48(s,1H),7.88(d,J=8.0Hz,1H),7.39(d,J=8.5Hz,2H),7.35(t,J=8.0Hz,1H),7 .18(d,J=8.5Hz,2H),7.13(d,J=8.5Hz,2H),7.07(d,J=9.0Hz,1H),6.96(d,J=9.0Hz,2H),6.71(t,J=7.5Hz,1H),3.00–1.50(br,10H).

[0140] Example 2: Preparation of compound L2

[0141] The preparation method of compound L2 is as follows Figure 2 As shown, the details are as follows:

[0142] Step 1: In a dry 250 mL round-bottom flask equipped with a magnetic stir bar, N-(2-chloro-4-iodophenyl)acetamide (10.0 g, 33.8 mmol), Pd(PPh3)2Cl2 (1.08 g, 1.70 mmol), and CuI (0.28 g, 3.6 mmol) were dissolved in anhydrous Et3N (40 mL) and THF (60 mL). Then, trimethylethynylsilane (18.5 mL, 131.2 mmol) was added to the solution. The reaction mixture was heated to 50 °C and stirred for 6 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was concentrated under reduced pressure and purified by column chromatography (PE:EA = 10:1) to give a white solid 2-2 (8.6 g, 96%). 1 H NMR (500MHz, CDCl3) δ 8.36 (d, J = 8.0 Hz, 1H), 7.66 (s, 1H), 7.48 (d, J = 2.0 Hz, 1H), 7.36 (dd, J = 10.0, 2.0 Hz, 1H), 2.24 (s, 3H), 0.24 (s, 9H).

[0143] Step 2: In a dry 250 mL round-bottom flask equipped with a magnetic stir bar, compound 2-2 (8.4 g, 31.6 mmol) was dissolved in methanol (80 mL). K₂CO₃ (8.7 g, 63.2 mmol) was added to the solution. The reaction mixture was stirred at room temperature for 3 h. The solvent was removed under reduced pressure, and the solution was purified by column chromatography (PE:EA = 20:1) to give a white solid 2-3 (5.94 g, 97%). 1 H NMR (500MHz, CDCl3) δ8.39 (d, J = 8.5 Hz, 1H), 7.66 (s, 1H), 7.50 (d, J = 2.0 Hz, 1H), 7.39 (dd, J = 8.5, 1.5 Hz, 1H), 3.07 (s, 1H), 2.25 (s, 3H).

[0144] Step 3: The synthesis method of compound 2-4 is similar to that of compound 1-2. Compound 2-3 is selected as the raw material to obtain a white solid with a yield of 51%. 1 H NMR(500MHz, CDCl3)δ8.38(d,J=9.0Hz,1H),7.63(s,1H),7.52(d,J=2.5Hz,1H ),7.37(dd,J=8.5,2.5Hz,1H),3.91(s,1H),2.26(s,3H),3.00–1.50(br,10H).

[0145] Step 4: In a dry 250 mL round-bottom flask with a magnetic swivel, compound 2-4 (5.20 g, 16.7 mmol) was dissolved in methanol (30 mL), and concentrated hydrochloric acid (30 mL) was added. The reaction mixture was heated to 100 °C and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was concentrated under reduced pressure, and the pH was adjusted to neutral with sodium bicarbonate. The product was then extracted with DCM, dried over anhydrous sodium sulfate, and purified by column chromatography (PE:EA = 10:1) to obtain compound 2-5, which was a white solid (3.87 g, 86%). 1 H NMR (500MHz, CDCl3) δ7.38 (d, J = 2.5 Hz, 1H), 7.19 (dd, J = 8.5, 2.5 Hz, 1H), 6.65 (d, J = 8.5 Hz, 1H), 3.82 (s, 1H), 2.26 (s, 3H), 3.00–1.50 (br, 10H).

[0146] Step 5: The synthesis method of compounds 2-6 is similar to that of compounds 1-4. Compounds 2-5 are selected as raw materials to obtain yellow solids with a yield of 49%. 1H NMR (500MHz, CDCl3) δ9.46 (s, 1H), 7.97 (dd, J = 8.0, 1.5Hz, 1H), 7.47 (d, J = 2. 0Hz,1H),7.33(td,J=8.5,1.5Hz,1H),7.25(d,J=2.5Hz,1H),7.23(m,2H),7. 20(d,J=6.5Hz,1H),7.15(d,J=9.0Hz,2H),6.99(d,J=8.5Hz,1H),6.75(td,J =8.0,1.0Hz,1H),6.20(s,1H),3.91(s,1H),3.84(s,3H),3.0–1.5(br,10H).

[0147] Step 6: The synthesis method of compound L2 is similar to that of compound L1. Compounds 2-6 are selected as raw materials to obtain a yellow solid with a yield of 80%. 1 H NMR(500MHz,DMSO-d6)δ9.61(s,1H),7.91(d,J=5.5Hz,2H),7.57(s,1H),7.35(t,J=8.0Hz,2H),7.21(d, J=7.0Hz,4H),7.15(d,J=7.5Hz,1H),7.05(d,J=8.5Hz,1H),6.75(s,1H),5.68(s,1H),3.0–1.5(br,10H).

[0148] Example 3: Preparation of compound L3

[0149] The preparation method of compound L3 is as follows: Figure 3 As shown, the details are as follows:

[0150] Step 1: In a dry 250 mL round-bottom flask with a magnetic swivel, potassium carbonate (4.08 g, 29.50 mmol) was added to a solution of p-fluoronitrobenzene (2.77 g, 19.65 mmol) and 2-chloro-4-iodophenol (5.00 g, 19.65 mmol) in DMSO (80 mL), and the mixture was stirred overnight at room temperature. The reaction was monitored by TLC. After the reaction was complete, the product was extracted with ethyl acetate, dried over anhydrous sodium sulfate, and purified by column chromatography (PE:EA = 50:1) to give compound 3-3 as a yellow solid (6.13 g, 83%). 1 H NMR (500MHz, CDCl3) δ8.22 (d, J = 9.5 Hz, 2H), 7.85 (d, J = 2.0 Hz, 1H), 7.65 (dd, J = 8.5, 2.0 Hz, 1H), 6.97 (d, J = 9.0 Hz, 2H), 6.90 (d, J = 8.5 Hz, 1H).

[0151] Step 2: The synthesis method of compound 3-4 is similar to that of compound 2-2. Compound 3-3 was selected as the raw material to obtain a yellow oily substance with a yield of 96%. 1 H NMR 1H NMR (500MHz, CDCl3) δ8.21 (d, J = 9.0 Hz, 2H), 7.62 (d, J = 2.0 Hz, 1H), 7.41 (dd, J = 8.0, 2.0 Hz, 1H), 7.06 (d, J = 8.5 Hz, 1H), 6.95 (d, J = 9.0 Hz, 2H), 0.26 (s, 9H).

[0152] Step 3: The synthesis method of compound 3-5 is similar to that of compound 2-3. Compound 3-4 is selected as the raw material to obtain a yellow solid with a yield of 95%. 1 H NMR (500MHz, CDCl3) δ8.22 (d, J = 9.0 Hz, 2H), 7.64 (d, J = 2.0 Hz, 1H), 7.45 (dd, J = 8.5, 2.0 Hz, 1H), 7.01 (d, J = 8.5 Hz, 1H), 6.98 (d, J = 9.5 Hz, 2H), 3.16 (s, 1H).

[0153] Step 4: The synthesis method of compounds 3-6 is similar to that of compounds 1-2. Compound 3-5 is selected as the raw material to obtain a white solid with a yield of 94%. 1 H NMR (500MHz, CDCl3) δ8.23(d,J=9.0Hz,2H),7.65(d,J=2.5Hz,1H),7.46(dd,J=8.5,2.5 Hz,1H),7.09(d,J=8.5Hz,1H),7.00(d,J=9.0Hz,2H),3.98(s,1H),3.00–1.50(br,10H).

[0154] Step 5: The synthesis method of compounds 3-7 is similar to that of compounds 1-3. Compound 3-6 was selected as the raw material to obtain a white solid with a yield of 94%. 1 H NMR (500MHz, CDCl3) δ7.46 (s, 1H), 7.15 (d, J = 8.5Hz, 1H), 6.77 (d, J = 8.5Hz, 1H), 6.60 (m, 3H), 3.80 (s, 1H), 3.00–1.50 (br, 10H).

[0155] Step 6: The synthesis method of compounds 3-8 is similar to that of compounds 1-4. Compounds 3-7 and 2-iodobenzoate are selected as raw materials to obtain a white solid with a yield of 52%. 1H NMR(500MHz, CDCl3)δ9.45(s,1H),7.97(dd,J=8.0,1.5Hz,1H),7.58(d,J=2.5Hz,1H),7.32(m,2H),7.25(m,2H),7.16(d,J=8.0 Hz,1H),7.00(d,J=9.0Hz,2H),6.82(d,J=9.0Hz,1H),6.75(td,J=8.0,1.0Hz,1H),3.91(s,3H),3.91(s,1H)3.0–1.5(br,10H).

[0156] Step 7: The synthesis method of compound L3 is similar to that of compound L1. Compounds 3-8 are selected as raw materials to obtain a yellow solid with a yield of 82%. 1 H NMR (500MHz, DMSO-d6) δ9.64(s,1H),7.92(d,J=7.5Hz,1H),7.78(s,1H),7.52(d,J=8.0Hz,1H),7.37(t,J=7.5Hz,1H),7.30(d,J=8. 0Hz,2H),7.17(d,J=8.5Hz,1H),7.07(d,J=8.5Hz,2H),6.95(d,J=8.5Hz,1H),6.77(t,J=7.5Hz,1H),5.80(s,1H)3.0–1.5(br,10H).

[0157] Example 4: Preparation of compound L4

[0158] The preparation method of compound L4 is as follows: Figure 4 As shown, the details are as follows:

[0159] Step 1: The synthesis method of compound 4-2 is similar to that of compounds 1-4. Compound 4-1 was selected as the raw material to obtain a yellow solid with a yield of 49%. 1 H NMR (500MHz, CDCl3) δ9.46 (s, 1H), 7.97 (dd, J = 8.0, 1.5Hz, 1H), 7.47 (d, J = 2. 0Hz,1H),7.33(td,J=8.5,1.5Hz,1H),7.25(d,J=2.5Hz,1H),7.23(m,2H),7. 20(d,J=6.5Hz,1H),7.15(d,J=9.0Hz,2H),6.99(d,J=8.5Hz,1H),6.75(td,J =8.0,1.0Hz,1H),6.20(s,1H),3.91(s,1H),3.84(s,3H),3.0–1.5(br,10H).

[0160] Step 2: The synthesis method of compound L4 is similar to that of compound L1. Compound 4-2 was selected as the raw material to obtain a yellow solid with a yield of 80%. 1 H NMR(500MHz,DMSO-d6)δ9.61(s,1H),7.91(d,J=5.5Hz,2H),7.57(s,1H),7.35(t,J=8.0Hz,2H),7.21(d, J=7.0Hz,4H),7.15(d,J=7.5Hz,1H),7.05(d,J=8.5Hz,1H),6.75(s,1H),5.68(s,1H),3.0–1.5(br,10H).

[0161] Example 5: Preparation of compound L5

[0162] The preparation method of compound L5 is as follows: Figure 5 As shown, the details are as follows:

[0163] Step 1: The synthesis method of compound 5-1 is similar to that of compound 1-4. Compound 2-5 and tert-butanol 2-(4-bromoaniline)benzoate were selected as raw materials to obtain a yellow solid with a yield of 53%. 1 H NMR (500MHz, CDCl3) δ9.55(s,1H),7.93(dd,J=8.0,1.5Hz,1H),7.47(d,J=2.5Hz,1H),7.30(m,1H),7.25(d,J=9.0Hz,2H),7.21(dd,J= 9.0, 2.0Hz, 2H), 7.14 (d, J = 9.0Hz, 2H), 6.97 (d, J = 9.0Hz, 1H), 6.73 (m, 1H), 6.19 (s, 1H), 3.84 (s, 1H), 3.0–1.5 (br, 10H), 1.61 (s, 9H).

[0164] Step 2: In a dry 25 mL round-bottom flask equipped with a magnetic stir bar, 5-1 (0.2 g, 0.40 mmol) was dissolved in anhydrous THF (10 mL), and 60% NaH (69 mg, 1.72 mmol) and methyl iodoform (183 mg, 1.29 mmol) were added. The mixture was stirred at room temperature for 12 hours, and the reaction was monitored by TLC. After the reaction was completed, the solution was concentrated under reduced pressure and purified by column chromatography (PE:EA = 30:1). Compound 5-2 was obtained as a white solid (0.1 g, 49%). 1H NMR (500MHz, CDCl3) δ9.37 (s, 1H), 7.88 (dd, J = 8.0, 1.0Hz, 1H), 7.70 (d, J = 2. 5Hz,1H),7.52(dd,J=8.5,2.5Hz,1H),7.25(s,1H),7.23(td,J=8.5,1.0Hz,1 H),7.12(d,J=9.0Hz,2H),7.04(d,J=8.5Hz,1H),6.72(d,J=9.0Hz,2H),6.64 (t,J=8.0Hz,1H),3.29(s,3H),1.78(s,3H),1.60(s,9H),3.0–1.5(br,10H).

[0165] Step 3: In a dry 25 mL round-bottom flask equipped with a magnetic stir bar, compound 5-2 (150 mg, 0.29 mmol) was dissolved in DCM (5 mL), and TFA (3 mL) was slowly added while in an ice bath. The mixture was stirred at room temperature for 12 hours, and the reaction was monitored by TLC. After the reaction was complete, the solvent was evaporated, and the pH was adjusted to neutral with sodium bicarbonate. The organic phase was extracted with DCM, concentrated under reduced pressure, and purified by column chromatography (DCM:MeOH = 75:1). Product L5 was obtained as a white solid (74 mg, 86%). 1 H NMR (500MHz, DMSO-d6) δ9.46 (s, 1H), 7.86 (dd, J = 8.0, 1.5Hz, 1H), 7.73 (d, J = 2. 0Hz,1H),7.71(dd,J=9.0,2.0Hz,1H),7.45(d,J=8.5Hz,1H),7.31(td,J=8.5,1. 5Hz,1H),7.11(d,J=9.0Hz,2H),6.97(d,J=8.5Hz,1H),6.73(d,J=8.5Hz,2H),6 .68(t,J=7.5Hz,1H),3.34(s,1H),3.25(s,3H),1.81(s,3H),3.0–1.5(br,10H).

[0166] Example 6: Preparation of compound L6

[0167] The preparation method of compound L6 is as follows: Figure 6 As shown, the details are as follows:

[0168] Step 1: The synthesis method of compound 6-1 is similar to that of compound 1-4. Compound 3-7 and tert-butanol 2-(4-bromoaniline)benzoate were selected as raw materials to obtain a yellow solid with a yield of 47%. 1H NMR (500MHz, CDCl3) δ12.97(s,1H),9.52(s,1H),7.90(dd,J=8.0,1.0Hz,1H),7.76(d,J=2.0Hz,1H),7.50(dd,J=9.0,2.5Hz,1H),7.33(t,J=15.0 Hz,1H),7.14(m,6H),7.04(d,J=9.0Hz,1H),7.00(d,J=9.0Hz,2H),6.84( d,J=9.0Hz,1H),6.69(t,J=15.0Hz,1H),5.79(s,1H),3.0–1.5(br,10H).

[0169] Step 2: The synthesis method of compound L6 is similar to that of compound L5. Compound 6-1 was selected as the raw material to obtain a yellow solid with a yield of 81%. 1 H NMR (500MHz, DMSO-d6) δ12.97(s,1H),9.52(s,1H),7.90(dd,J=8.0,1.0Hz,1H),7.76(d,J=2.0Hz,1H),7.50(dd,J=9.0,2.5Hz,1H),7.33(t,J=7. 5Hz,1H),7.14(m,6H),7.04(d,J=9.0Hz,1H),7.00(d,J=9.0Hz,2H),6.84 (d,J=9.0Hz,1H),6.69(t,J=7.5Hz,1H),5.79(s,1H),3.0–1.5(br,10H).

[0170] Example 7: Preparation of compound L7

[0171] The preparation method of compound L7 is as follows: Figure 7 As shown, the details are as follows:

[0172] Step 1: The synthesis method of compound 7-1 is similar to that of compound 1-4. Compound 1-3 and methyl 2-(4-iodoaniline)nicotinic acid were selected as raw materials to obtain a yellow solid with a yield of 51%. 1H NMR (500MHz, CDCl3) δ10.12(s,1H),8.36(dd,J=4.5,1.5Hz,1H),8.24(dd,J=8.0,1.5Hz,1H),7.62(d,J=8.5Hz,2H),7.32(d,J=9.0Hz,2 H),7.11(d,J=7.5Hz,2H),6.85(d,J=8.5Hz,2H),6.72(dd,J=7.5,4.5Hz,1H),5.78(s,1H),3.94(s,1H),3.85(s,1H),3.0–1.5(br,10H).

[0173] Step 2: The synthesis method of compound L7 is similar to that of compound L1. Compound 7-1 was selected as the raw material to obtain a yellow solid with a yield of 85%. 1 H NMR (500MHz, DMSO-d6) δ10.34(s,1H),8.39(s,1H),8.35(dd,J=5.0,2.0Hz,1H),8.23(dd,J=7.5,2.5Hz,1H),7.62(d,J=8.5Hz,2H) ,7.37(d,J=9.0Hz,2H),7.10(d,J=9.0Hz,2H),6.92(d,J=8.5Hz,2H),6.82(dd,J=7.5,4.5Hz,1H),5.59(s,1H),3.0–1.5(br,10H).

[0174] Example 8: Preparation of compound L8

[0175] The preparation method of compound L8 is as follows: Figure 8 As shown, the details are as follows:

[0176] Step 1: The synthesis method of compound 8-1 is similar to that of compound 1-4. Compound 2-5 and methyl 2-(4-iodoaniline)nicotinic acid were selected as raw materials to obtain a yellow solid with a yield of 51%. 1 H NMR (500MHz, CDCl3) δ10.19(s,1H),8.37(dd,J=5.0,1.5Hz,1H),8.25(dd,J=7.5,1.5Hz,1H),7.70(d,J=8.5Hz,2H),7.46(d,J=2.0Hz,1H),7.17(dd,J =9.0,2.0Hz,1H),7.15(d,J=9.0Hz,2H),6.97(d,J=8.5Hz,1H),6.73(dd,J= 8.0,5.0Hz,1H),6.19(s,1H),3.94(s,1H),3.84(s,1H),3.0–1.5(br,10H).

[0177] Step 2: The synthesis method of compound L8 is similar to that of compound L1. Compound 8-1 was selected as the raw material to obtain a yellow solid with a yield of 79%. 1 H NMR (500MHz, DMSO-d6) δ10.39(s,1H),8.37(dd,J=5.0,2.0Hz,1H),8.24(dd,J=8.0,2.0Hz,1H),7.84(s,1H),7.68(d,J=8.5Hz,2H),7.53(d,J=2. 5Hz,1H),7.32(dd,J=8.0,2.0Hz,1H),7.16(d,J=9.0Hz,2H),6.95(d,J=9.0Hz,1H),6.84(dd,J=7.5,4.5Hz,1H),5.68(s,1H),3.0–1.5(br,10H).

[0178] Example 9: Preparation of compound L9

[0179] The preparation method of compound L9 is as follows: Figure 9 As shown, the details are as follows:

[0180] Step 1: The synthesis method of compound 9-1 is similar to that of compound 1-4. Compound 3-7 and methyl 2-iodonicotinate were selected as raw materials to obtain a yellow solid with a yield of 51%. 1 H NMR (500MHz, CDCl3) δ10.20(s,1H),8.37(dd,J=4.5,2.0Hz,1H),8.25(dd,J=8.0,2.0Hz,1H),7.72(d,J=9.0Hz,2H),7.57(d,J=2.5Hz,1H),7.26 (dd,J=9.0,2.5Hz,1H),7.01(d,J=9.0Hz,2H),6.80(d,J=9.0Hz,1H),6.74(dd,J=8.0,5.0Hz,1H),3.94(s,1H),3.90(s,1H),3.0–1.5(br,10H).

[0181] Step 2: The synthesis method of compound L9 is similar to that of compound L1. Compound 9-1 was selected as the raw material to obtain a yellow solid with a yield of 83%. 1H NMR (500MHz, DMSO-d6) δ10.46(s,1H),8.38(d,J=3.0Hz,1H),8.26(d,J=7.5Hz,1H),7.79(s,1H),7.77(s, 2H),7.52(d,J=8.5Hz,1H),7.07(d,J=8.5Hz,2H),6.88(d,J=9.0Hz,2H),5.81(s,1H),3.0–1.5(br,10H).

[0182] Example 10: Preparation of compound L10

[0183] The preparation method of compound L10 is as follows: Figure 10 As shown, the details are as follows:

[0184] Step 1: The synthesis method of compound 10-1 is similar to that of compound 1-4. Compound 2-5 and tert-butanol 3-(4-iodoaniline)benzoate were selected as raw materials to obtain a yellow solid with a yield of 50%. 1 H NMR (500MHz, CDCl3) δ7.66(s,1H),7.53(d,J=7.5Hz,1H),7.30(t,J=7.5Hz,1H),7.53(d,J=2.0Hz,1H),7.20(m, 2H),7.10(s,4H),6.90(d,J=8.5Hz,1H),6.14(s,1H),5.79(s,1H),3.83(s,1H),1.59(s,1H),3.0–1.5(br,10H).

[0185] Step 2: The synthesis method of compound L10 is similar to that of compound L5. Compound 10-1 was selected as the raw material to obtain a yellow solid with a yield of 88%. 1 H NMR (500MHz, DMSO-d6) δ12.83(s,1H),8.35(s,1H),7.75(s,1H),7.65(s,1H),7.53(d,J=2.0Hz,1H),7.37(d,J=7.5Hz,1H),7.33(t,J=6.0Hz, 1H),7.32(d,J=7.5Hz,1H),7.25(d,J=8.0Hz,1H),7.13(d,J=3.0Hz,4H),6.91(d,J=9.0Hz,1H),5.74(s,1H),5.65(s,1H),3.0–1.5(br,10H).

[0186] Example 11: Preparation of compound L11

[0187] The preparation method of compound L11 is as follows: Figure 11 As shown, the details are as follows:

[0188] Step 1: The synthesis method of compound 11-1 is similar to that of compound 1-4. Compound 2-5 and tert-butanol 2-((4-iodophenyl)-methylamine)benzoate were selected as raw materials to obtain a yellow solid with a yield of 81%. 1 H NMR (500MHz, CDCl3) δ7.76 (dd, J=8.0, 1.5Hz, 1H), 7.53 (td, J=8.0, 1.5Hz, 1H), 7.42(d,J=2.5Hz,1H),7.29(t,J=7.5Hz,1H),7.26(d,J=7.0Hz,1H),7.10(dd,J =9.0,2.5Hz,1H),6.97(d,J=9.0Hz,2H),6.68(d,J=9.0Hz,1H),6.60(d,J=9.0H z,2H),6.03(s,1H),3.81(s,1H),3.31(s,3H),1.33(s,9H),3.0–1.5(br,10H).

[0189] Step 2: The synthesis method of compound L11 is similar to that of compound L5. Compound 11-1 was selected as the raw material to obtain a yellow solid with a yield of 86%. 1 H NMR(500MHz,DMSO-d6)δ12.78(s,1H),7.78(dd,J=7.5,1.5Hz,1H),7.60(m,2H),7.48(d,J=3.0Hz,1 H),7.33(m,2H),7.25(dd,J=9.0,2.0Hz,2H),6.99(d,J=9.0Hz,2H),5.64(s,1H),3.0–1.5(br,10H).

[0190] Example 12: Preparation of compound L12

[0191] The preparation method of compound L12 is as follows: Figure 12 As shown, the details are as follows:

[0192] Step 1: The synthesis method of compound 12-1 is similar to that of compound 1-4. Compound 2-5 and methyl 2-((4-iodoaniline)-5-trifluoromethylbenzoate were selected as raw materials to obtain a yellow solid with a yield of 53%. 1H NMR(500MHz,DMSO-d6)δ9.73(s,1H),8.24(s,1H),7.49(m,2H),7.25(m,3H),7.19(d,J=8.5Hz,2H),7. 14(d,J=8.5Hz,1H),7.06(d,J=9.0Hz,1H),6.24(s,1H),3.95(s,3H),3.85(s,1H),3.0–1.5(br,10H).

[0193] Step 2: The synthesis method of compound L12 is similar to that of compound L1. Compound 12-1 is selected as the raw material to obtain a yellow solid with a yield of 80%. 1 H NMR (500MHz, DMSO-d6) δ9.89 (s, 1H), 8.12 (d, J = 1.5Hz, 1H), 7.63 (dd, 9.0, 2.0Hz, 1H), 7.57 (d, 2.5Hz, 1H), 7.36 (dd, 9.0 ,2.0Hz,1H),7.24(dd,J=20.0,8.5Hz,4H),7.14(d,J=9.0Hz,1H),7.11(d,J=9.0Hz,1H),5.71(s,1H),3.0–1.5(br,10H).

[0194] Example 13: Preparation of compound L13

[0195] The preparation method of compound L13 is as follows: Figure 13 As shown, the details are as follows:

[0196] Step 1: The synthesis method of compound 13-1 is similar to that of compound 1-4. Compound 2-5 and methyl 2-((4-iodoaniline)-quinoline-3-carboxylic acid were selected as raw materials to obtain a green solid with a yield of 53%. 1 H NMR(500MHz,DMSO-d6)δ8.93(s,1H),7.94(d,8.0Hz,3H),7.70(m,2H),7.54(s,1H),7.35 (m,2H),7.21(d,J=8.0Hz,2H),7.00(m,1H),5.69(s,1H),3.98(s,3H),3.0–1.5(br,10H).

[0197] Step 2: The synthesis method of compound L13 is similar to that of compound L1. Compound 13-1 was selected as the raw material to obtain a yellow solid with a yield of 80%. 1H NMR(500MHz,DMSO-d6)δ10.78(s,1H),8.93(s,1H),7.97(d,8.5Hz,2H),7.93(d,8.0Hz,1H),7.88(s,1H),7.71(m,2H ),7.55(d,J=2.5Hz,1H),7.34(m,2H),7.22(d,J=8.5Hz,2H),7.00(d,J=8.5Hz,1H),5.70(s,1H),3.0–1.5(br,10H).

[0198] Example 14: Effect of the compound on the in vitro inhibition of TEAD transcriptional activity

[0199] Experimental Methods: This embodiment uses a luciferase reporter gene system to detect TEAD transcriptional activity. Luciferase reporter gene assay is a reporter system that uses luciferin as a substrate to detect the activity of firefly luciferase. During the oxidation of luciferin catalyzed by luciferase, bioluminescence is emitted, which can be measured using a fluorescence spectrometer. The reporter plasmids used are pGL-8xGTIIC-LUC and pGL-GAL4-LUC. The pGL-8xGTIIC-LUC plasmid contains the TEAD binding sequence (containing four sets of TEAD binding sequences: 2xGTIIC:TGGAATGTGTGGAATG) and the luciferase gene (LUC). When TEAD binds to pGL-8xGTIIC-LUC, it can initiate the transcription and expression of luciferase; therefore, it can be used to detect the transcriptional repression of all TEAD subtypes by compounds. The pGL-5*UAS-LUC plasmid contains multiple GAL4 binding sites (UAS) and a luciferase gene, enabling highly sensitive detection of GAL4 activation levels. Therefore, when different TEAD isoforms and fusion proteins of the GAL4 DNA-binding domain bind to pGL-5*UAS-LUC, luciferase expression can be initiated, allowing for the detection of transcriptional repression effects of compounds on a single isoform.

[0200] HEK293T cells were seeded in 24-well plates. One day later, they were transfected with plasmids pGL-8xGTIIC-LUC, p-CMV-YAP, and plvx-mCherry. After 12 hours, the cells were treated with 10 μM of the compound for another 24 hours. Cells were lysed, and the activity value of 8xGTIIC-LUC and the fluorescence value of the internal control plasmid plvx-mCherry were measured using a multi-mode microplate reader. The final value was expressed as the ratio of the 8xGTIIC-LUC activity value to the plvx-mCherry fluorescence intensity. Each experiment was repeated three times. For the transcriptional activity assay of different TEAD subtypes, the plasmids transfected in 293T cells were: pGL-5*UAS-LUC, pCMV-YAP, plvx-mCherry, and plvx-GAL4-TEAD1 / plvx-GAL4-TEAD2 / plvx-GAL4-TEAD3 / plvx-GAL4-TEAD4. Other procedures were as described above.

[0201] The results of the above experiments are shown in Table 1. Compound L1-L13 has a certain inhibitory effect on the transcriptional activity of TEADs and different subtypes of TEADs.

[0202] Table 1: Inhibitory activity of compounds L1-L13 against TEAD subtypes

[0203]

[0204] Example 15: Inhibitory activity of compound L1-L13 against tumor cell proliferation

[0205] To further investigate whether compound L1-L13 inhibits the proliferation of prostate cancer cell lines, the following prostate cancer cell lines were selected in this study: DU145, PC3, 22RV1, LNCAP, and C4-2. Cells were seeded in 96-well plates (3000 cells / well). After cell attachment, different concentrations of the compound were added for treatment. After 72 hours, 10% CCK8 was added to each well, and the absorbance at 450 nm was measured using a microplate. Each experiment was repeated at least three times.

[0206] The experimental results are shown in Table 2. Compounds L1-L13 have a certain degree of inhibitory effect on the proliferation of different prostate cancer cell lines. Among them, L5 has the best inhibitory effect on proliferation.

[0207] Table 2: Inhibitory activity of the compounds of this invention against the proliferation of different prostate cell lines

[0208]

[0209] Example 16: Compound L1-L13 inhibits the expression of downstream target genes of TEAD.

[0210] To further investigate whether compounds L1-L13 could inhibit the expression of downstream target genes of TEAD, this study selected L5, which showed better inhibitory activity on proliferation, and examined the effect of this compound on the expression of downstream genes of TEAD in prostate cancer cell lines PC3 and DU145. Cells were seeded in 6-well plates, and after cell adhesion, different concentrations of the compound were added for 24 h. mRNA was extracted from the cells using the TRIZOL method, and cDNA was obtained by reverse transcription. The expression of classic downstream genes of TEAD (CCN1, ANKRD1, CTGF) was detected by quantitative PCR. The experimental results were expressed as the ratio of the target gene to the internal reference gene (GAPDH), with three replicates for each experiment. The qPCR primers are shown in Table 3.

[0211] Table 2: qPCR Primer Sequences

[0212] CCN1-F AGCCTCGCATCCTATACAACC CCN1-R TTCTTTCACAAGGCGGCACTC CTGF-F CTTGCGAAGCTGACCTGGAAGA CTGF-R CCGTCGGTACATACTCCACAGA ANKRD1-F CGACTCCTGATTATGTATGGCGC ANKRD1-R GCTTTGGTTCCATTCTGCCAGTG GAPDH-F GTCTCCTCTGACTTCAACAGCG GAPDH-R ACCACCCTGTTGCTGTAGCCAA

[0213] The results of the above experiment are as follows Figure 1 As shown, compared with the untreated group, small molecule treatment significantly reduced the expression levels of TEAD target genes, and the difference was statistically significant (P<0.0001).

[0214] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A compound containing carborane, its tautomers, stereoisomers, hydrates, solvates, or pharmaceutically acceptable salts, characterized in that, The compound containing carborane has the structure shown in Formula I: R1 is selected from hydrogen atoms, alkyl groups, or haloalkyl groups; R2 is selected from hydrogen atoms or halogens; R3 is selected from hydrogen atoms, alkyl groups, or haloalkyl groups; Ar is selected from benzene rings, substituted benzene rings, pyridine rings, quinoline rings, furan rings, pyrrole rings, thiophene rings, pyrazole rings, imidazole rings, oxazole rings, thiazole rings, pyrimidine rings, or indole rings; X is selected from oxygen or nitrogen atoms.

2. The compound according to claim 1, characterized in that, In the compound, R1 and / or R3 are C1-C6 alkyl or C1-C6 haloalkyl; preferably, R1 and / or R3 are methyl.

3. The compound according to claim 1, characterized in that, In the compound, Ar is a haloalkyl-substituted benzene ring; preferably, Ar is a C1-C6 haloalkyl-substituted benzene ring; more preferably, Ar is a trifluoromethyl-substituted benzene ring.

4. The compound according to claim 1, characterized in that, The compound also includes any of the following features: 1) R1 is a hydrogen atom, R2 is a hydrogen atom, R3 is a hydrogen atom or a methyl group, and X is a nitrogen atom; 2) R1 is a hydrogen atom, R2 is a chlorine atom, R3 is a hydrogen atom or a methyl atom, and X is a nitrogen atom or an oxygen atom; 3) R1 is a methyl group, R2 is a chlorine atom, R3 is a hydrogen atom or a methyl group, and X is an oxygen atom.

5. The compound according to claim 1, characterized in that, The compound has the following structure:

6. The method for preparing the compound according to claim 5, characterized in that, The preparation method includes any one of the following methods: preparation method of compound L1 a1) p-Nitrophenylacetylene and B 10 H 12 The reaction of (CH3CN)2 yields compounds 1-2; a2) Compound 1-2 reacts with H2 to give compound 1-3; a3) Compounds 1-3 were reacted with 2-(4-bromoaniline)benzoate, t-BuONa, Pd2(dba)3, and XPhos to give compounds 1-4; a4) Compounds 1-4 react with BBr3 to give compound L1; Alternatively, the preparation method of compound L2. b1) N-(2-chloro-4-iodophenyl)acetamide reacts with Pd(PPh3)2Cl2, CuI, and trimethylethynylsilane to give compound 2-2; b2) Compound 2-2 reacts with K2CO3 to give compound 2-3; b3) Compounds 2-3 and B 10 H 12 The reaction of (CH3CN)2 yields compounds 2-4; b4) Compound 2-4 reacts with concentrated hydrochloric acid to give compound 2-5; b5) Compound 2-5 was reacted with 2-(4-bromoaniline)benzoate, t-BuONa, Pd2(dba)3, and XPhos to give compound 2-6; b6) Compound 2-6 reacts with BBr3 to give compound L2; Alternatively, the preparation method of compound L3. c1) The reaction of p-fluoronitrobenzene with 2-chloro-4-iodophenol yields compound 3-3; c2) Compound 3-3 was reacted with Pd(PPh3)2Cl2, CuI, and trimethylethynylsilane to give compound 3-4; c3) Compound 3-4 reacts with K2CO3 to give compound 3-5; c4) Compounds 3-5 and B 10 H 12 The reaction of (CH3CN)2 yields compounds 3-6; c5) Compound 3-6 reacts with H2 to give compound 3-7; c6) Compound 3-7 was reacted with 2-iodobenzoate, t-BuONa, Pd2(dba)3, and XPhos to give compound 3-8; c7) Compounds 3-8 react with BBr3 to give compound L3; Alternatively, the preparation method of compound L4. d1) Compound 2-5 was reacted with 2-(4-bromoaniline)benzoate, t-BuONa, Pd2(dba)3, and XPhos to give compound 4-2; d2) Compound 4-2 reacts with BBr3 to give compound L4; Alternatively, the preparation method of compound L5. e1) Compound 2-5 was reacted with tert-butanol ester of 2-(4-bromoaniline)benzoate to give compound 5-1; e2) Compound 5-1 reacts with NaH and iodomethane to give compound 5-2; e3) Compound 5-2 reacts with TFA to give compound L5; Alternatively, the preparation method of compound L6. f1) Compound 3-7 was reacted with tert-butanol ester of 2-(4-bromoaniline)benzoate to give compound 6-1; f2) Compound 6-1 reacts with TFA to give compound L6; Alternatively, the preparation method of compound L7. Compound 1-3 was reacted with methyl 2-(4-iodoaniline)nicotinic acid to give compound 7-1; g2) Compound 7-1 reacts with BBr3 to give compound L7; Alternatively, the preparation method of compound L8. h1) Compound 2-5 was reacted with methyl 2-(4-iodoaniline)nicotinic acid to give compound 8-1; h2) Compound 8-1 reacts with BBr3 to give compound L8; Alternatively, the preparation method of compound L9. i1) Compound 3-7 was reacted with methyl 2-iodonicotinate to give compound 9-1; i2) Compound 9-1 reacts with BBr3 to give compound L9; Alternatively, the preparation method of compound L10. j1) Compound 2-5 was reacted with tert-butanol 3-(4-iodoaniline)benzoate to give compound 10-1; j2) Compound 10-1 was reacted with TFA to obtain compound L10; Alternatively, the preparation method of compound L11. Compound 2-5 was reacted with tert-butanol 2-((4-iodophenyl)-methylamine)benzoate to give compound 11-1; Compound 11-1 (k2) reacts with TFA to give compound L11; Alternatively, the preparation method of compound L12. l1) Compound 2-5 was reacted with methyl 2-((4-iodoaniline)-5-trifluoromethylbenzoate to give compound 12-1; Compound 12-1 reacts with BBr3 to give compound L12; Alternatively, the preparation method of compound L13. Compound 2-5 was reacted with methyl 2-((4-iodoaniline)-quinoline-3-carboxylic acid to give compound 13-1; Compound 13-1 (m2) reacts with BBr3 to give compound L13.

7. The preparation method according to claim 6, characterized in that, The preparation method further includes any of the following features: A11) Based on the reaction volume of step a1), p-nitrophenylacetylene and B 10 H 12 The molar ratio of (CH3CN)2 is 1:1 to 1:1.5; A21) Based on the reaction volume of step a3), the molar ratio of compounds 1-3 and 2-(4-bromoaniline)benzoate is 1:0.5-1:1; B11) Based on the reaction volume of step b1), the molar ratio of N-(2-chloro-4-iodophenyl)acetamide to trimethylethynylsilane is 1:3.5-1:4.5; B21) Based on the reaction volume of step b2), the molar ratio of compound 2-2 and K2CO3 is 1:1.5-1:2.

5.

8. Use of the compound according to any one of claims 1-5 in the preparation of TEAD gene inhibitors, or in the preparation of medicaments for the treatment or prevention of Hippo pathway dysfunction-related diseases, or in the preparation of medicaments for the treatment or prevention of TEAD-related diseases.

9. The use according to claim 8, characterized in that, The Hippo pathway dysfunction-related disease or TEAD-related disease is a tumor; preferably, the tumor is selected from one or more of the following: skin cancer, head and neck cancer, lung cancer, liver cancer, stomach cancer, prostate cancer, esophageal cancer, cervical cancer, uterine cancer, pancreatic cancer, breast cancer, kidney cancer, ureteral cancer, bladder cancer, pharyngeal squamous cell carcinoma, basal cell carcinoma, melanoma, tongue cancer, pharyngeal squamous cell carcinoma, malignant lymphoma, laryngeal squamous cell carcinoma, lung squamous cell carcinoma, small cell carcinoma, esophageal squamous cell carcinoma, cervical cancer, and brain tumor.

10. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the compound of any one of claims 1-5 and pharmaceutically acceptable excipients.

Images