Ctpyl6 protein, gene and application thereof related to plant drought resistance

By expressing the CtPYL6 protein and gene in plants, the drought resistance of ground squash was improved, solving the growth and development problems of ground squash under drought conditions and achieving significant enhancement of drought resistance and reduction of oxidative damage.

CN121591866BActive Publication Date: 2026-04-28INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INNER MONGOLIA AGRICULTURAL UNIVERSITY
Filing Date
2026-01-28
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

There is limited research on stress-resistance genes in ground cucumbers in existing technologies, which severely affects their growth and development under drought conditions, impacting agricultural production.

Method used

By expressing CtPYL6 protein and gene, the drought resistance of plants can be improved, including increasing CtPYL6 protein content or gene expression, enhancing germination rate, growth, antioxidant capacity and photosynthetic efficiency, reducing the accumulation of malondialdehyde, superoxide anion and hydrogen peroxide, and increasing the activity of antioxidant enzymes.

Benefits of technology

It significantly improved the drought resistance of plants, enhanced their growth and development under drought conditions, reduced oxidative damage, increased germination rate and photosynthetic efficiency, and enhanced antioxidant capacity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121591866B_ABST
    Figure CN121591866B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a CtPYL6 protein related to plant drought resistance, a gene and application thereof. The application provides a CtPYL6 protein related to plant drought resistance, wherein the amino acid sequence of the CtPYL6 protein is shown as SEQ ID NO. 1. The CtPYL6 protein provided by the application can improve the drought resistance of plants. The results of examples show that overexpression of the gene can improve the seed germination rate, the chlorophyll content of plants and the photosynthetic efficiency of plants. CtPYL6 Compared with wild type plants, overexpression of the gene can reduce the accumulation of malondialdehyde, superoxide anion and hydrogen peroxide, and significantly improve the activities of superoxide dismutase, catalase and peroxidase, thereby improving the drought resistance of plants. CtPYL6 The CtPYL6 protein provided by the application can obtain new germplasm with the drought resistance characteristics, and is of great significance for carrying out drought-resistant crop breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a CtPYL6 protein and gene related to plant drought resistance and its applications. Background Technology

[0002] Plants grow and develop in complex and ever-changing environments, often subjected to abiotic stresses. Drought is a major abiotic factor affecting and limiting plant growth and development, and can even lead to plant death, severely impacting agricultural production. Therefore, developing drought-resistant crop varieties has always been one of the main goals of agricultural science and technology research.

[0003] Ground stalk melon, also known as sand grandma or ground stalk flower, is a perennial, drought-tolerant, erect, semi-shrub belonging to the genus *Gnaphalium* in the family Asclepiadaceae. The whole plant can be used as forage, medicine, food, and industrial raw material. As a forage crop, it is beneficial for soil and water conservation and has significant economic and ecological value. Currently, there is limited research on stress-resistance genes in ground stalk melon. Summary of the Invention

[0004] The purpose of this invention is to provide a CtPYL6 protein, gene, and application related to plant drought resistance. The CtPYL6 protein can improve plant drought resistance and can be used to cultivate new drought-resistant plant germplasm.

[0005] This invention provides a CtPYL6 protein associated with plant drought resistance, the amino acid sequence of which is shown in SEQ ID NO.1.

[0006] This invention also provides encoding the CtPYL6 protein described in the above scheme. CtPYL6 Genes, the ones mentioned CtPYL6 The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0007] This invention also provides an overexpression CtPYL6 Biomaterials containing genes, said biomaterials comprising: CtPYL6 The recombinant expression vector of the gene contains the above. CtPYL6 Recombinant bacteria containing genes CtPYL6 One or more of the gene-transgenic cell lines;

[0008] The CtPYL6 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1.

[0009] This invention also provides the CtPYL6 protein described in the above-described scheme, and the aforementioned... CtPYL6 The application of genes or the aforementioned biological materials in regulating plant drought resistance.

[0010] As a preferred embodiment, the regulation includes: increasing the CtPYL6 protein content or increasing... CtPYL6 Increase gene expression levels to improve plant drought resistance.

[0011] As a preferred embodiment, the improvement of plant drought resistance includes at least one of the following: (1) increasing germination rate; (2) increasing plant growth; (3) increasing antioxidant capacity; and (4) maintaining photosynthetic efficiency.

[0012] As a preferred embodiment, the enhancement of antioxidant capacity includes at least one of the following: (1) reducing malondialdehyde accumulation; (2) reducing superoxide anion accumulation; (3) reducing hydrogen peroxide accumulation; and (4) enhancing antioxidant enzyme activity.

[0013] As a preferred embodiment, the antioxidant enzyme includes at least one of superoxide dismutase, catalase, and peroxidase.

[0014] This invention also provides the CtPYL6 protein described in the above-described scheme, and the aforementioned... CtPYL6 The application of genes or the aforementioned biological materials in the cultivation of drought-resistant plants.

[0015] The present invention also provides a method for improving plant drought resistance, comprising: overexpressing in plants CtPYL6 Genes were used to obtain plants with enhanced drought resistance; CtPYL6 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1.

[0016] Beneficial Effects: This invention provides a CtPYL6 protein associated with plant drought resistance, the amino acid sequence of which is shown in SEQ ID NO.1. The CtPYL6 protein of this invention can improve plant drought resistance. Examples show that overexpression of this protein... CtPYL6 The gene does not affect plant growth but can improve seed germination rate, chlorophyll content, and maintain photosynthetic efficiency. Compared to wild-type plants, overexpression... CtPYL6 Following gene modification, the accumulation of malondialdehyde, superoxide anion, and hydrogen peroxide can be reduced, and the activities of superoxide dismutase, catalase, and peroxidase can be significantly increased, thereby improving plant drought resistance. The CtPYL6 protein described in this invention can provide new germplasm with drought-resistant properties, which is of great significance for the breeding of drought-resistant crops. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0018] Figure 1 ground melon CtPYL6 Subcellular localization map of genes;

[0019] Figure 2ground melon CtPYL6 Graph showing the results of gene self-activation activity;

[0020] Figure 3 ground melon CtPYL6 The results of functional verification of gene-overexpressing yeast are shown in the figure; where A and B represent the growth and concentration (OD) of overexpressing yeast and empty vector yeast on the culture medium under normal conditions. 600 Figures C and D show the growth and concentration of overexpressed yeast and empty vector yeast on the culture medium under drought stress. 600 Figure; specifically, A and C correspond to results on solid culture media, and B and D correspond to results on liquid culture media;

[0021] Figure 4 ground melon CtPYL6 Figure 1 shows the results of constructing the Arabidopsis thaliana vector for gene overexpression; where A is a schematic diagram of vector construction; B is a gel electrophoresis result, where 700bp is the gene size and 849bp is the PCR length using the gene forward primer and the vector reverse primer.

[0022] Figure 5 ground melon CtPYL6 Figure showing the results of gene overexpression analysis in Arabidopsis thaliana plants;

[0023] Figure 6 ground melon CtPYL6 Phenotypic analysis of Arabidopsis thaliana plants with overexpressing genes under stress;

[0024] Figure 7 ground melon CtPYL6 Germination of Arabidopsis thaliana seeds overexpressing the gene under drought stress; where A is the germination of the control group; B is the germination of the drought-stressed group; C is the germination rate of the control group; and D is the germination rate of the drought-stressed group.

[0025] Figure 8 ground melon CtPYL6 Figure showing the results of fresh weight and chlorophyll content analysis of Arabidopsis thaliana plants with overexpressing genes under stress;

[0026] Figure 9 ground melon CtPYL6 Figure showing the results of physiological index analysis of Arabidopsis thaliana plants with overexpressing genes under stress;

[0027] Figure 10 ground melon CtPYL6 Figure 1 shows the identification results of gene-silenced plants; where A represents the PCR identification results of the silenced fragment; and B represents the analysis results of the expression level of the silenced plants.

[0028] Figure 11 ground melon CtPYL6 Phenotypic analysis of gene-silenced plants under stress;

[0029] Figure 12 ground melon CtPYL6 Figure showing the results of fresh weight and chlorophyll content analysis of gene-silenced plants under stress.

[0030] Figure 13 ground melon CtPYL6 Figure showing the results of physiological index analysis of gene-silenced plants under stress;

[0031] In the picture This indicates that the data shows a significant difference. p <0.01. Detailed Implementation

[0032] This invention provides a CtPYL6 protein associated with plant drought resistance. The amino acid sequence of the CtPYL6 protein is shown in SEQ ID NO.1: MPSDHQNSFLLLQRINTPSPAAACKRSQQQQHHQRATSSTTTPTNLPLLTSTQVPDPVAWYHTHPVGPNQCYSAVIQEISAPVSTVWSVVRRFDNPQAYKHFVKSCHVILGDGKVGTLREVHVISGLPAASSTERLEILDEERHVLSFSVVGGDHRLSNYRSVTTLHHASSSDVGGGNRTVVVESYVVDIPAGNTKEETCVFVDTIVKCNLQSLSKIAEDIARRNVSSVIKT. The CtPYL6 protein can enhance plant antioxidant capacity, maintain photosynthetic efficiency, effectively reduce the accumulation of ROS (reactive oxygen species) under drought stress, thereby mitigating oxidative damage, improving plant drought tolerance, and increasing plant biomass.

[0033] This invention also provides encoding the CtPYL6 protein described in the above scheme. CtPYL6 Genes, the ones mentioned CtPYL6The nucleotide sequence of the gene is shown in SEQ ID NO.2: 5'--3'.

[0034] This invention also provides an overexpression CtPYL6 Biomaterials containing genes, said biomaterials comprising: CtPYL6 The recombinant expression vector of the gene contains the above. CtPYL6 Recombinant bacteria containing genes CtPYL6 One or more of the gene-transgenic cell lines;

[0035] The CtPYL6 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1.

[0036] As one embodiment, the base vector of the recombinant expression vector includes the pYES2 vector; as another embodiment, the base bacteria of the recombinant bacteria includes Agrobacterium, and in a specific embodiment of the present invention, the base bacteria of the recombinant bacteria is Agrobacterium GV3103.

[0037] This invention also provides the CtPYL6 protein described in the above-described scheme, and the aforementioned... CtPYL6 The application of genes or the aforementioned biological materials in regulating plant drought resistance.

[0038] As one implementation method, the regulation includes: increasing the CtPYL6 protein content or increasing... CtPYL6 This invention increases gene expression levels to improve plant drought resistance. It involves overexpressing genes in plants. CtPYL6 The gene, under drought stress, significantly improves plant germination rate and growth compared to the wild type, and also enhances antioxidant capacity, maintains photosynthetic efficiency, reduces oxidative damage, and improves drought tolerance. Simultaneously, this invention constructs a knockout gene... CtPYL6 The study investigated the gene strains and found that silencing the gene reduced the plant's drought stress tolerance by affecting the activity of antioxidant enzyme systems and the degree of oxidative damage.

[0039] In one embodiment, improving plant drought resistance includes at least one of the following: (1) increasing germination rate; (2) increasing plant growth; (3) increasing antioxidant capacity; and (4) maintaining photosynthetic efficiency. In one embodiment, maintaining photosynthetic efficiency includes increasing plant chlorophyll content.

[0040] As one implementation method, the improvement of antioxidant capacity includes at least one of the following: (1) reducing malondialdehyde accumulation; (2) reducing superoxide anion accumulation; (3) reducing hydrogen peroxide accumulation; and (4) increasing antioxidant enzyme activity.

[0041] In one embodiment, the antioxidant enzyme includes at least one of superoxide dismutase, catalase, and peroxidase. CtPYL6 can improve plant antioxidant capacity, maintain photosynthetic efficiency, and effectively reduce ROS accumulation under drought stress, thereby mitigating oxidative damage and enhancing plant drought tolerance.

[0042] This invention also provides the CtPYL6 protein described in the above-described scheme, and the aforementioned... CtPYL6 The application of genes or the aforementioned biological materials in the cultivation of drought-resistant plants.

[0043] The present invention also provides a method for improving plant drought resistance, comprising: overexpressing in plants CtPYL6 Genes were used to obtain plants with enhanced drought resistance; CtPYL6 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1.

[0044] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1 CtPYL6 Subcellular localization and self-activation activity

[0046] (1) CtPYL6 Subcellular localization

[0047] Build CtPYL6 The fusion expression vector with green fluorescent protein (GFP) was prepared by the following steps: ① Using the genomic DNA of *Citrus aurantium* as a template, PCR amplification was performed using the primers CtPYL6-eGFP-F (SEQ ID NO.5) and CtPYL6-eGFP-R (SEQ ID NO.6) listed in Table 1 to obtain a fusion expression vector containing... CtPYL6 The target segment of the gene.

[0048] Table 1 Primer sequence information

[0049]

[0050] ② The PCAMBIA1300-35S-eGFP vector (purchased from Beijing Coollife Technology Co., Ltd., product number: VT119, denoted as 35S:eGFP) was double-digested with restriction endonucleases KpnI and XbaI, and the linearized PCAMBIA1300-eGFP vector was recovered.

[0051] ③The ingredients described in step ① CtPYL6 The target fragment of the gene and the linearized PCAMBIA1300-35S-eGFP vector described in step ② were subjected to homologous recombination to obtain a recombinant vector, denoted as 35S:CtPYL6-eGFP.

[0052] ④ The recombinant vector described in step ③ is transferred into Agrobacterium GV3103 to obtain recombinant Agrobacterium bacterial suspension.

[0053] ⑤ Use a resuspension to measure the OD of the recombinant Agrobacterium tumefaciens culture obtained in step ④. 600 The value was adjusted to 0.8 to obtain the inoculum; the resuspension consisted of the following components at the following concentrations: MgCl2·6H2O 2.033 g / L, 2-(N-morpholine)ethanesulfonic acid (MES) 2.132 g / L and acetylsyl syringone 200 µM.

[0054] ⑥ Mark the leaves with numbers, and use a 1mL syringe to inject the infection solution and the nuclear localization marker mCherry (concentration of OD) from the back of the leaf using pressure. 600=0.8) was injected into tobacco leaves at a volume ratio of 1:1, then the leaves were sprayed with water, covered with a plastic bag, and placed in the dark overnight. On the second day, the plastic bag was opened, and the leaves were observed under a laser confocal microscope; an empty vector (35S:eGFP) was set up as a control group. The results are shown below. Figure 1 From left to right: green fluorescent protein, cell nuclear localization signal, merged image and bright field image, scale bar is 20 μm.

[0055] The results showed that the fluorescence signal of the CtPYL6-GFP fusion protein appeared only in the cell nucleus, while the fluorescence signal of the empty vector control appeared in both the cytoplasm and the cell nucleus, indicating that the CtPYL6 protein is located in the cell nucleus.

[0056] (2) To further verify whether CtPYL6 has self-activation, a yeast self-activation experiment was conducted, and the steps are as follows:

[0057] ① Construct the CtPYL6-pGBKT7 recombinant plasmid. The construction method is similar to that of the recombinant vector 35S:CtPYL6-eGFP in step (1). The difference is that the primers used to amplify the target fragment are CtPYL6-BDF (SEQ ID NO.7) and CtPYL6-BDR (SEQ ID NO.8) in Table 1. The PCAMBIA1300-eGFP vector is replaced with the pGBKT7 vector (purchased from Beijing Coolerbot Technology Co., Ltd., product number: VT006). The restriction endonucleases are EcoRI and BamHI. The CtPYL6-pGBKT7 recombinant plasmid is constructed and is denoted as pGBKT7-CtPYL6. ② Group setup: A. Positive control group: pGBKT7-p53+pGADT7-T; B. Negative control group: pGBKT7-Lam+pGADT7-T; C. Experimental group: pGBKT7-CtPYL6+pGADT7. These three groups of plasmids were co-transformed into yeast Y2Hgold, and then cultured on leucine- and tryptophan-deficient media (denoted as SD-Leu-Trp) and histidine-, leucine-, and tryptophan-deficient media (denoted as SD-His-Leu-Trp). The SD-Leu-Trp medium was purchased from Beijing Coolplay Technology Co., Ltd., product number: PM2222; the SD-His-Leu-Trp medium was purchased from Beijing Coolplay Technology Co., Ltd., product number: PM2151; all plasmids used were purchased from Beijing Coolplay Technology Co., Ltd.

[0058] Test results are shown Figure 2In this study, pGBKT7-p53+pGADT7-T represented the positive control; pGBKT7-Lam+pGADT7-T was the negative control; and pGBKT7-CtPYL6+pGADT7 represented the self-activation test of CtPYL6, indicating self-activation as in the positive control and its absence as in the negative control. The results showed that all combinations grew normally on SD-Leu-Trp medium; however, only yeast cells containing the pGBKT7-p53+pGADT7-T recombinant plasmid were able to grow on SD-His-Leu-Trp medium, indicating that CtPYL6 lacks self-activation activity.

[0059] Example 2: Overexpression of CtPYL6 enhances yeast resistance to drought stress.

[0060] The effects of CtPYL6 protein on yeast growth and stress resistance were analyzed in yeast containing the CtPYL6 overexpression vector (pYES2-CtPYL6). The steps are as follows:

[0061] ① Construct a CtPYL6 overexpression vector. The construction method is similar to that of the recombinant vector 35S:CtPYL6-eGFP in step (1) of Example 1. The difference is that the primers used to amplify the target fragment are pYES2-CtPYL6-F (SEQ ID NO.3) and pYES2-CtPYL6-R (SEQ ID NO.4) in Table 1. The PCAMBIA1300-eGFP vector is replaced with the pYES2 vector (purchased from Beijing Cooler Master Technology Co., Ltd., product number: VT064). The restriction endonucleases are BamHI and EcoRI.

[0062] ② Take 100µL of INVSC1 competent cells thawed on ice (purchased from Beijing Cooler Labs Technology Co., Ltd., product number: CC303), add 2~5µg of pre-cooled target plasmid (pYES2-CtPYL6 or pYES2), 10µL of carrier DNA, and 500µL of PEG / LiAc in sequence, and mix by pipetting several times. Incubate at 30℃ for 30min and then at 42℃ for 15min.

[0063] ③ Centrifuge at 10,000 rpm for 30 seconds, discard the supernatant, resuspend in 400 µL of ddH2O, centrifuge for 30 seconds, and discard the supernatant.

[0064] ④ Resuspend the culture in 50 µL of ddH2O, plate it onto an SD / -Ura plate, screen for positive clones, and then inoculate it into 15 mL of SD / -Ura Broth yeast auxotrophic liquid medium. Incubate overnight at 30°C with a shaker. The SD / -Ura plates were purchased from Beijing Cooler Master Technology Co., Ltd., product number: PM2272; the SD / -Ura Broth yeast auxotrophic liquid medium was purchased from Beijing Cooler Master Technology Co., Ltd., product number: PM2271.

[0065] ⑤ Centrifuge at 1,500g for 5 minutes at 4℃ and remove the supernatant.

[0066] ⑥ Resuspend the cell pellet in 50 mL of SG / -Ura liquid medium and incubate in a shaker at 30 °C.

[0067] ⑦ After adjusting OD600 to 1 and serially diluting 10-fold, yeast growth was assessed on SD / -Ura Broth yeast-deficient solid medium containing different concentrations of drought stress (0 mM, designated as control and 60 mM PEG3350). The results are shown in [Figure number missing]. Figure 3 and Table 2, where Figure 3 In the figure, A and B represent the growth and concentration (OD) of overexpressed yeast and empty vector yeast on the culture medium under normal conditions. 600 Figures C and D show the growth and concentration of overexpressed yeast and empty vector yeast on the culture medium under drought stress. 600 Figure; specifically, A and C correspond to results on solid culture medium, and B and D correspond to results on liquid culture medium.

[0068] The results showed that CtPYL6 overexpression had no significant effect on yeast growth. Figure 3 (A). Yeast cells overexpressing CtPYL6 exhibited significant resistance in medium containing 60 mM PEG3350, especially at a 100-fold dilution. Figure 3 (C). Furthermore, under liquid culture conditions, survival rate measurements of yeast transformed with CtPYL6 revealed that, under normal conditions without 60 mM PEG3350, the growth trends of the two yeast strains were essentially the same. Figure 3 (B) Under drought stress, the survival rate of the CtPYL6 overexpressing yeast strain was consistently higher than that of the control group. Specifically, under a stress level of 60 mM PEG3350, after 9 h of stress treatment, the survival rate of the CtPYL6 overexpressing yeast strain was significantly higher than that of the empty vector control strain (B). Figure 3 (D). These results indicate that the CtPYL6 protein enhances the yeast's ability to resist drought stress.

[0069] Table 2. Functional validation data of yeast overexpression of CtPYL6 gene from *Cucumis melo*.

[0070]

[0071] Example 3: CtPYL6 gene heterologous transformation of Arabidopsis thaliana and screening of positive plants

[0072] The CtPYL6 plant expression vector (i.e., 35S:CtPYL6-eGFP) was constructed using the method described in Example 2, as shown in the schematic diagram of the vector construction. Figure 4 As shown in Figure A, Arabidopsis thaliana (Columbia type) was transformed using an inflorescence immersion method mediated by Agrobacterium GV3103. T0 generation transgenic plants were screened on 1 / 2 MS medium containing 50 mg / L HYG (hygromycin). T1 and T2 generations were screened consecutively using the same method to obtain homozygous transgenic lines.

[0073] To verify the transgenic plants, genomic DNA was extracted from homozygous CtPYL6 transgenic Arabidopsis and wild-type Arabidopsis in this embodiment. PCR amplification was performed using CtPYL6-specific primers (CtPYL6-eGFP-F (SEQ ID NO.5) and p1300-R (SEQ ID NO.11) in Table 1). The PCR reaction system was as follows: 2×TransStart® FastPfu Fly ReactionMix 25 μL, TransStart® FastPfu Fly DNA Polymerase 1 μL, forward and reverse primers 1 μL each, cDNA 1 μL, ddH2O 21 μL; the reaction program was: 98℃ for 1 min; 98℃ for 10 s, 60℃ for 5 s, 72℃ for 10 s, 30 cycles; 72℃ for 1 min, and stored at 4℃.

[0074] The results are as follows Figure 4 As shown in Figure B, + indicates amplification products using the CtPYL6 plant expression vector as a template; OE1~6 represent CtPYL6 transgenic lines and WT wild-type Arabidopsis thaliana. All were identified as positive plants.

[0075] Simultaneously, total RNA was extracted from Arabidopsis transgenic homozygous lines that were positive for HYG screening and molecular identification. The expression level of the CtPYL6 gene was detected by qRT-PCR using primers CtPYL6-qPCR-F (SEQ ID NO. 9) and CtPYL6-qPCR-R (SEQ ID NO. 10) listed in Table 1. The primers for the internal control gene were Atactin-F (SEQ ID NO. 14) and Atactin-R (SEQ ID NO. 15) listed in Table 1. The qRT-PCR reaction system was as follows: 12.5 μL of TB Green Premix Ex Taq II FastqPCR (2X), 1 μL each of forward and reverse primers, 1 μL of cDNA, and 9.5 μL of ddH2O. The reaction program was: 25℃ for 10 min; 95℃ for 30 s; 95℃ for 5 s, 60℃ for 10 s, 40 cycles; 95℃ for 15 s; 60℃ for 1 min, 95℃.

[0076] Test results as follows Figure 5 As shown in Table 3, the overexpressing plants were significantly different from the WT plants (p < 0.01). This indicates that the overexpressing plants were positive for successful heterologous transformation of the CtPYL6 gene, providing reliable experimental material for subsequent functional analysis.

[0077] Table 3. Expression levels of the CtPYL6 gene overexpressed in Arabidopsis plants.

[0078]

[0079] Example 4: CtPYL6 overexpression enhances drought tolerance in Arabidopsis thaliana.

[0080] Mature T3 generation seeds and wild-type (WT) Arabidopsis seeds were collected, air-dried, and vernalized at 4℃ for 2 days (in a 4℃ incubator). After vernalization, the seeds were treated with 70% ethanol for 10 min and then with anhydrous ethanol for 20 min to sterilize their surface. The sterilized Arabidopsis seeds were sown on 1 / 2 MS solid medium (10cm × 10cm square plates) and randomly divided into two groups. One group was subjected to drought stress with 30mM PEG3350 (drought stress group); the other group was subjected to drought stress without PEG3350 (control group). Both groups of seeds were placed in a growth chamber at 24℃, with 16 h of light, 8 h of darkness, and 70% relative humidity for germination testing. Each group was tested in triplicate, and the germination rate was recorded every 24 h. The results are shown below. Figure 7 As shown in Table 4.

[0081] Transgenic Arabidopsis thaliana seedlings with consistent growth and WT wild-type seedlings were selected, and watering was stopped for 14 days to simulate drought stress and observe their growth under drought stress. Results are shown below. Figure 6 The results showed that under normal growth conditions, there were no significant differences in growth status and phenotype between wild-type and overexpression lines. However, after drought stress treatment, the growth of both wild-type and overexpression lines was significantly inhibited, manifested as stunted growth and yellowing of leaves due to dehydration, although the overexpression lines experienced less inhibition. Under drought stress, although 30 mM PEG3350 treatment inhibited the germination rate of Arabidopsis seeds and prolonged their germination time, the germination rate of transgenic plant seeds was significantly higher than that of wild-type plants. These results indicate that CtPYL6 overexpression significantly enhanced the plant's resistance to drought stress. This suggests that CtPYL6 plays an important role in the drought stress response.

[0082] Table 4 Germination of Arabidopsis seeds overexpressing the CtPYL6 gene.

[0083]

[0084] Example 5: CtPYL6 enhanced the physiological indicators and antioxidant capacity of transgenic Arabidopsis thaliana.

[0085] To comprehensively evaluate the role of CtPYL6 in drought tolerance in Arabidopsis thaliana, this example subjected CtPYL6 transgenic lines planted in nutrient soil to drought stress treatment, as follows:

[0086] Mature T3 generation seeds and wild-type (WT) Arabidopsis seeds were collected, air-dried, and vernalized at 4℃. Before sowing onto 1 / 2 MS solid medium, the seeds were surface-sterilized by treatment with 70% ethanol for 10 min followed by anhydrous ethanol for 20 min. The sterilized seeds were sown in 1 / 2 MS medium and transferred to a growth chamber at 24℃, with 16 h of light, 8 h of darkness, and 70% relative humidity. At four true leaves, the seeds were transplanted into a 1:3 (v / v) mixture of potting soil and vermiculite. Fourteen days after transplanting, the seeds were subjected to drought stress and watering was stopped for 14 days. After 14 days of cultivation, the seedlings were observed, fresh weight was recorded, and chlorophyll content was measured. The results are shown below. Figure 8 As shown in Table 5.

[0087] Drought stress typically leads to excessive accumulation of reactive oxygen species (ROS) in plants, causing severe oxidative damage. Meanwhile, the contents of superoxide anion (H2O2) and hydrogen peroxide (O2) in Arabidopsis leaves were measured using a kit from Beijing Solarbio Science & Technology Co., Ltd. 2-The contents of malondialdehyde (MDA), catalase (CAT) activity, superoxide dismutase (SOD) activity, and peroxidase (POD) activity were measured, and the results are as follows: Figure 9 And as shown in Table 6

[0088] The results showed that under normal conditions, there were no significant changes in leaf fresh weight and chlorophyll content between wild-type and overexpression lines, while the fresh weight and chlorophyll content of the overexpression lines were significantly higher than those of the wild-type lines after stress. Figure 8 Drought stress significantly increased the levels of malondialdehyde (MDA), superoxide anion, and hydrogen peroxide in Arabidopsis leaves. Compared with wild-type plants, the overexpression lines showed significantly lower accumulations of MDA, superoxide anion, and hydrogen peroxide. Figure 9 Drought stress significantly increased the activities of superoxide dismutase, catalase, and peroxidase in both wild-type and overexpression lines. The activities of these antioxidant enzymes were significantly higher in the overexpression lines compared to the wild-type. Figure 9 ).

[0089] These results indicate that CtPYL6 effectively reduces the accumulation of ROS under drought stress by enhancing antioxidant capacity and maintaining photosynthetic efficiency, thereby mitigating oxidative damage and improving plant drought tolerance.

[0090] Table 5. Analysis of fresh weight and chlorophyll content of Arabidopsis thaliana plants overexpressing the CtPYL6 gene under stress.

[0091]

[0092] Table 6. Analysis of relevant physiological indicators of Arabidopsis plants overexpressing the CtPYL6 gene under stress.

[0093]

[0094] Example 6 Construction of CtPYL6 silencing vector

[0095] In *Citrus aurantiacus* containing the CtPYL6 silencing vector (pTRV2-CtPYL6), the effects of CtPYL6 protein on the growth and stress resistance of *Citrus aurantiacus* were analyzed. The steps are as follows:

[0096] The CtPYL6 silencing vector was constructed using a method similar to that of the recombinant vector 35S:CtPYL6-eGFP described above. The difference was that the primers used to amplify the target fragment were pTRV2-CtPYL6-F (SEQ ID NO.12) and pTRV2-CtPYL6-R (SEQ ID NO.13) listed in Table 1. The PCAMBIA1300-eGFP vector was replaced with the pTRV2 vector (purchased from Beijing Huayueyang VECT75602), and the restriction endonucleases were XbaⅠ and KpnⅠ.

[0097] TRV vector systems typically contain two plasmids: pTRV1 (helper vector, providing replication and movement proteins) and pTRV2 (vector backbone, used for inserting the target gene fragment). The target gene fragment needs to be cloned into pTRV2, working together with pTRV1 to achieve silencing. Fragment selection: A 300bp specific fragment of the target gene is selected (SEQ ID NO.16: 5'-TAAAGTAGGCACCCTACGCGAAGTTCACGTCATCTCAGGTCTTCCTGCCGCTAGTAGCACGGAGCGGCTAGAGATCCTAGACGAGGAGCGTCACGTACTAAGCTTCAGCGTTGTCGGTGGAGACCATAGGCTGTCAAATTATCGGTCCGTTACTACTTTACACCACGCTTCATCGTCAGACGTCGGCGGCGGAAATAGGACGGTGGTTGTGGAATCGTACGTTGTGGACATACCAGCTGGGAACACTAAGGAAGAGACCTGCGTGTTCGTCGACACAATTGTTAAATGTAACCTTCAATC-3'). The ligation product was transformed into E. coli, positive clones were screened by resistance plates, and after sequencing verification, the recombinant pTRV2 plasmid was extracted, while the pTRV1 plasmid was prepared at the same time.

[0098] The TRV2 plasmid was double-digested with restriction endonucleases KpnI and Xba1. The vector was ligated using a homologous recombination kit and transformed into competent *E. coli* cells. After antibiotic selection, positive single colonies were picked and detected by PCR using vector primers. The PCR amplification product of the successfully ligated TRV2-CtPYL6 recombinant plasmid containing the insert fragment was 300 bp in length. Figure 10 In the middle A, where +: TRV2-CtPYL6 recombinant plasmid; pTRV:CtPYL6: silent plant; WT: wild-type ground squash).

[0099] Agrobacterium GV3101 carrying TRV1 and TRV2-CtPYL6 was cultured overnight at 28°C with shaking at 180 rpm in LB medium containing kanamycin (50 μg / mL) and rifampin (25 μg / mL). The bacterial cells were collected by centrifugation, resuspended in an invasion dye solution (containing 10 mmol / L MgCl2, 10 mmol / L MES, and 200 μmol / L acetylsyleugenone), and the OD600 was adjusted to approximately 1.0. The cells were then incubated in the dark for 4–6 h in preparation for injection infection.

[0100] Equal volumes of pTRV1 Agrobacterium resuspension and pTRV2-CtPYL6 Agrobacterium resuspension were thoroughly mixed for injection infection. Ground elm seedlings cultured to the cotyledon stage in a light incubator were used as the infection material. A disposable 1mL needleless syringe was used to inject the bacterial solution into the apical meristem of the seedlings. Before injection, slight wounds could be created before injecting the bacterial solution into the apical meristem. Infected plants were then cultured in a light incubator at 22℃, 50% humidity, and a photoperiod of L:D-16h:8h. The expression level of CtPYL6 was detected by RT-qPCR using primers CtPYL6-qPCR-F (SEQ ID NO. 9) and CtPYL6-qPCR-R (SEQ ID NO. 10) from Table 1. The primers for the internal reference gene were Atactin-F (SEQ ID NO. 14) and Atactin-R (SEQ ID NO. 15) from Table 1. The reaction system and procedure were the same as in Example 3. The results are as follows: Figure 10 As shown in Table B and Table 7, the line with the silenced CtPYL6 gene was successfully constructed.

[0101] Table 7. Analysis of CtPYL6 gene expression levels in *Cucumis melo* var. *mongolica* plants with silenced gene.

[0102]

[0103] Example 7: Silencing CtPYL6 reduced the resistance of ground-shoot melon to drought stress.

[0104] The physiological indicators and antioxidant capacity of *Citrus aurantiacus* after CtPYL6 silencing were investigated according to the operation in Example 5. The results are as follows: Figure 11 , Figure 12 As shown in Tables 8 and 9. In the TRV-mediated silencing experiment of the CtPYL6 gene in *Cucumis melo*, under normal control conditions, there was no significant difference in growth phenotype between wild-type (WT), empty vector TRV-infected plants, and pTRV2-CtPYL6 plants; however, after drought stress treatment, the growth of pTRV2-CtPYL6 plants was more significantly inhibited, exhibiting more severe wilting symptoms. Figure 11 Physiological analysis further showed that the fresh weight and chlorophyll content of pTRV2-CtPYL6 plants under drought stress were significantly lower than those of WT and TRV plants. Figure 12 ), malondialdehyde (MDA), superoxide anion (O2) 2- Oxidative damage indicators such as hydrogen peroxide (H2O2) were significantly elevated, while the antioxidant enzyme activities of catalase (CAT), peroxidase (POD), and superoxide dismutase (SOD) were significantly reduced. Figure 13 ).

[0105] In summary, the CtPYL6 gene plays a crucial role in regulating plant drought stress tolerance. Its silencing, by affecting the activity of antioxidant enzyme systems and the degree of oxidative damage, leads to a decrease in plant drought stress tolerance. Overexpression in plants... CtPYL6 Genes can enhance plant drought resistance, providing new molecular resources for cultivating new drought-resistant plant germplasm.

[0106] Table 8. Analysis of fresh weight and chlorophyll content of *Cucumis melo* CtPYL6 gene-silenced plants under stress.

[0107]

[0108] Table 9. Analysis of relevant physiological indicators of CtPYL6 gene-silenced plants of *Cucumis melo* under stress.

[0109]

[0110] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A CtPYL6 protein associated with plant drought resistance, characterized in that, The amino acid sequence of the CtPYL6 protein is shown in SEQ ID NO.

1.

2. The CtPYL6 gene encoding the CtPYL6 protein of claim 1, characterized in that, The nucleotide sequence of the CtPYL6 gene is shown in SEQ ID NO.

2.

3. A biomaterial overexpressing the CtPYL6 gene, characterized in that, The biological material includes: a recombinant expression vector containing the CtPYL6 gene and / or recombinant bacteria containing the CtPYL6 gene; The amino acid sequence of the protein encoded by the CtPYL6 gene is shown in SEQ ID NO.

1.

4. The application of the CtPYL6 protein of claim 1, the CtPYL6 gene of claim 2, or the biomaterial of claim 3 in regulating plant drought resistance; The regulation is as follows: increasing the content of CtPYL6 protein or increasing the expression level of CtPYL6 gene to improve plant drought resistance; The plant in question is Arabidopsis thaliana or Trichosanthes kirilowii.

5. The application according to claim 4, characterized in that, The improvement of plant drought resistance includes at least one of the following: (1) increasing germination rate; (2) increasing plant growth; (3) increasing antioxidant capacity; and (4) maintaining photosynthetic efficiency.

6. The application according to claim 5, characterized in that, The improvement of antioxidant capacity includes at least one of the following: (1) reducing malondialdehyde accumulation; (2) reducing superoxide anion accumulation; (3) reducing hydrogen peroxide accumulation; and (4) increasing antioxidant enzyme activity.

7. The application according to claim 6, characterized in that, The antioxidant enzyme is superoxide dismutase and / or peroxidase.

8. The application according to claim 6, characterized in that, The antioxidant enzyme is catalase.

9. The application of the CtPYL6 protein of claim 1, the CtPYL6 gene of claim 2, or the biomaterial of claim 3 in the cultivation of drought-resistant plants; wherein the plant is Arabidopsis thaliana or Cucurbita spp.

10. A method for improving plant drought resistance, characterized in that, include: Overexpression of the CtPYL6 gene in plants yields plants with enhanced drought resistance; the amino acid sequence of the protein encoded by the CtPYL6 gene is shown in SEQ ID NO.1; the plant is Arabidopsis thaliana or Cucurbita spp.