Self-assembled ferritin nanoparticle recombinant protein and application thereof in preparation of cat infectious peritonitis virus vaccine

Abstract

The invention provides a self-assembled ferritin nanoparticle recombinant protein and application thereof in preparation of cat infectious peritonitis virus vaccines, and belongs to the technical field of nano vaccines. The self-assembly ferritin nanoparticle recombinant protein is formed by self-assembly of ST-N-Fel protein, HCV E2-SC protein and IFN gamma-SC protein. According to the invention, the N protein of FIPV is displayed on the surface of the self-assembled ferritin nanoparticle, an immunopotentiator capable of enhancing cellular immunity and a targeting factor are added to optimize the recombinant protein of the self-assembled ferritin nanoparticle, and IFN gamma-SC and HCV E2-SC can be efficiently coupled with ST-N-Fel through covalent linkage between SpyTag and SpyCatcher. The self-assembled ferritin nanoparticle recombinant protein provided by the invention can be used for preparing an FIPV vaccine, and the vaccine has the capability of reducing ADE risk while inducing protective immune response.

Description

Technical Field

[0001] This invention belongs to the field of nanovaccine technology, and particularly relates to a self-assembled ferritin nanoparticle recombinant protein and its application in the preparation of feline infectious peritonitis virus vaccine. Background Technology

[0002] Feline infectious peritonitis (FIP) is a highly fatal infectious disease caused by feline infectious peritonitis virus (FIPV), primarily affecting young cats, with an annual infection mortality rate of 5%-12%. Currently, there is no commercially available effective vaccine. As a member of the coronavirus family, FIPV has a complex pathogenic mechanism and exhibits antibody-dependent enhancement (ADE), posing significant technical obstacles to the development of traditional inactivated or live attenuated vaccines. Summary of the Invention

[0003] The purpose of this invention is to provide a self-assembled ferritin nanoparticle recombinant protein and its application in the preparation of feline infectious peritonitis virus (FIP) vaccine. The FIP vaccine of this invention has the ability to reduce the risk of antibody-dependent enhancement (ADE) while inducing a protective immune response.

[0004] This invention provides a self-assembled ferritin nanoparticle recombinant protein, which is self-assembled from ST-N-Fer protein, HCV E2-SC protein and IFNγ-SC protein; the amino acid sequence of ST-N-Fer protein is shown in SEQ ID NO.1; the amino acid sequence of HCV E2-SC protein is shown in SEQ ID NO.2; the amino acid sequence of IFNγ-SC protein is shown in SEQ ID NO.3.

[0005] Preferably, the ST-N-Fer protein is covalently coupled to the HCV E2-SC protein; the ST-N-Fer protein is covalently coupled to the IFNγ-SC protein.

[0006] This invention also provides a method for preparing the self-assembled ferritin nanoparticle recombinant protein described above, comprising the following steps: The encoding gene of the ST-N-Fer protein was cloned into a prokaryotic expression vector to obtain a first recombinant prokaryotic expression vector; the first recombinant prokaryotic expression vector was expressed in prokaryotic cells to obtain the ST-N-Fer protein. The gene encoding the HCV E2-SC protein was cloned into a prokaryotic expression vector to obtain a second recombinant prokaryotic expression vector; the second recombinant prokaryotic expression vector was expressed in prokaryotic cells to obtain the HCV E2-SC protein. The gene encoding the IFNγ-SC protein was cloned into a prokaryotic expression vector to obtain a third recombinant prokaryotic expression vector; the third recombinant prokaryotic expression vector was expressed in prokaryotic cells to obtain the IFNγ-SC protein. The ST-N-Fer protein, HCV E2-SC protein, and IFNγ-SC protein were incubated to obtain the self-assembled ferritin nanoparticle recombinant protein.

[0007] Preferably, the basic framework of the prokaryotic expression vector includes the pET32a vector.

[0008] Preferably, the prokaryotic cells include Escherichia coli BL21.

[0009] Preferably, during the incubation, the ratio of the total molar amount of HCV E2-SC protein and IFNγ-SC protein to the molar amount of ST-N-Fer protein is 1:1; the molar ratio of HCV E2-SC protein to IFNγ-SC protein is 1:1.

[0010] Preferably, the incubation temperature is 4°C and the incubation time is 4 hours.

[0011] Preferably, the incubation buffer consists of 60 mM Tris-HCl, 8% glycerol, 0.1% Tween-20, 60 mM NaCl, and 250 mM imidazole.

[0012] The present invention also provides the application of the self-assembled ferritin nanoparticle recombinant protein described in the above-described scheme or the self-assembled ferritin nanoparticle recombinant protein prepared by the above-described preparation method in the preparation of feline infectious peritonitis virus vaccine.

[0013] The present invention also provides a feline infectious peritonitis virus vaccine, wherein the feline infectious peritonitis virus vaccine comprises the self-assembled ferritin nanoparticle recombinant protein described in the above scheme or the self-assembled ferritin nanoparticle recombinant protein prepared by the preparation method described above.

[0014] This invention provides a self-assembled ferritin nanoparticle recombinant protein, which is self-assembled from ST-N-Fer protein, HCV E2-SC protein, and IFNγ-SC protein. The amino acid sequence of the ST-N-Fer protein is shown in SEQ ID NO.1; the amino acid sequence of the HCV E2-SC protein is shown in SEQ ID NO.2; and the amino acid sequence of the IFNγ-SC protein is shown in SEQ ID NO.3. Traditional vaccines focus on the surface protein of feline infectious peritonitis virus (FIPV) as the antigen target, while this invention creatively selects the internal N protein as the antigen target. In addition to enhancing the immune effect, more importantly, it can actively avoid the risk of ADE (antibody-dependent enhancement). Based on this, in order to overcome the disadvantage of the weak immunogenicity of the N protein itself, this invention further adopts the technique of 'ferritin nanoparticle display' and synergistically integrates 'DC targeting' and 'immune enhancement' modules, ultimately successfully developing a safe (ADE-free) and highly effective (stimulating strong cellular immunity) next-generation nanovaccine. Specifically, this invention displays N protein on the surface of self-assembled ferritin nanoparticles and adds an immunostimulant IFN-γ and a targeting factor HCV E2 ligand to optimize the recombinant protein of the self-assembled ferritin nanoparticles. IFNγ-SC and HCV E2-SC can be efficiently coupled to ST-N-Fer through a covalent link between SpyTag and SpyCatcher. The recombinant protein of the self-assembled ferritin nanoparticles of this invention can be used to prepare FIPV vaccines, which can induce a protective immune response while reducing the risk of antibody-dependent enhancement (ADE). Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 A schematic diagram of HCV E2 / IFNγ-N-Fer self-assembled ferritin nanoparticle recombinant protein (three-component nanoparticles); Figure 2 Figure 1 shows the results of SDS-PAGE analysis; where M: Marker; 1: ST-N-Fer recombinant protein 81.5 kDa; 2: IFNγ-N-Fer recombinant protein 137 kDa; 3: HCV E2-N-Fer recombinant protein 152.8 kDa; 4: HCV E2 / IFNγ-N-Fer complex. Figure 3Negative-stained transmission electron microscopy image of three-component: HCV E2 / IFNγ-N-Fer nanoparticles; scale bar: 200 nm. Figure 4 The hydrodynamic diameter distribution of the three-component nanoparticles HCV E2 / IFNγ-N-Fer, as determined by DLS; Figure 5 The graph shows the results of indirect ELISA quantitative analysis of FIPV N-specific IgG in cat serum. Figure 6 Figure showing the results of sandwich ELISA analysis of IFN-γ cytokine levels; Figure 7 Figure showing the results of sandwich ELISA analysis of IL-4 cytokine levels; Figure 8 Figure showing the results of flow cytometry analysis of peripheral blood lymphocytes in cats; Figure 9 Figure showing the results of indirect immunofluorescence assay for evaluating the effect of immune serum on the adhesion of FIPV to feline peripheral blood mononuclear cells (PBMCs); Figure 10 To analyze viral replication in feline PBMCs under different concentrations of immune serum using qRT-PCR; Figure 11 Figure 1 shows the qRT-PCR results of cytokines secreted by feline PBMCs after treatment with immune serum and FIPV. Figure 12 Survival curves for cats that underwent FIPV challenge after immunization; Figure 13 A chart for monitoring clinical symptoms in cats; Figure 14 Record the cat's weight (upper part) and body temperature (lower part); Figure 15 The results of qRT-PCR detection of FIPV N gene content in cat liver, kidney and spleen are shown in the figure. The data are presented as mean ± standard deviation. Figure 16 The pET32a-HCV E2-SC plasmid map; Figure 17 The image shows the pET32a-IFN-γ-SC plasmid. Detailed Implementation

[0017] This invention provides a self-assembled ferritin nanoparticle recombinant protein, which is self-assembled from ST-N-Fer protein (FIPV ST-N-Fer protein), HCV E2-SC protein and IFNγ-SC protein; the amino acid sequence of the ST-N-Fer protein is shown in SEQ ID NO.1; the amino acid sequence of the HCV E2-SC protein is shown in SEQ ID NO.2; and the amino acid sequence of the IFNγ-SC protein is shown in SEQ ID NO.3.

[0018] In this invention, the amino acid sequence shown in SEQ ID NO.1 is specifically as follows: .

[0019] In this invention, the amino acid sequence shown in SEQ ID NO.2 is specifically as follows: MSTHVTGGAQGHSIWRLTSLFSLGPTQRIQLVNTNGSWHINRTALNCNDSLQTGFIAALFYANKFNSSGCPERLASCRPIDKFAQGWGPITYAEPGSSDQRPYCWHYAPRPCGIVPASEVCVPVYCFTPSPVVVGTTDRSGVPTYTWGENETDVLLLNNTRPPQGNWFGCTWMNGTGFTKTCGGPPCNIGGVGNNTLTCPTDCFRKHPEATYAKCGSGPWLTPRCMVDYPYRLWHYPCTVNFTIFKVRMYVGGVEHRLNAACNWTRGERCDLEDRDRSELSPLLLSTTEWQILPCSFTTLPALSTGLIHLHQNIVDVQYLYGVGSAVVSFVIKWEYVLLLFLLLADARVCACLWMMLLIAQAEAASGGSGGSGGSVTTLSGLSGEQGPSGDMTTEEDSATHIKFSKRDEDGRELAGATMELRDSSGKTISTWISDGHVKDFYLYPGKYTFVETAAPDGYEVATPIEFTVNEDGQVTVDGEATEGDAHT。

[0020] In the present invention, the amino acid sequence shown in SEQ ID NO.3 is specifically: MNYTSFIFAFQLCIILCSSGYYCQAMFFKEIEELKGYFNASNPDVADGGSLFVDILKNWKEESDKTIIQSQIVSFYLKMFENLKDDDQRIQRSMDTIKEDMLDKLLNTSSSKRDDFLKLIQIPVNDLQVQRKAINELFKVMNDLSPRSNLRKRKRSQNLFRGRRASKASGGSGGSGGSVTTLSGLSGEQGPSGDMTTEEDSATHIKFSKRDEDGRELAGATMELRDSSGKTISTWISDGHVKDFYLYPGKYTFVETAAPDGYEVATPIEFTVNEDGQVTVDGEATEGDAHT。

[0021] Traditional vaccines targeting viral surface proteins (such as the S protein) are prone to producing non-neutralizing or sub-neutralizing antibodies, a major cause of antibody-dependent enhancement (ADE) and posing significant safety risks. In this invention, the N protein, as an internal viral protein, induces an immune response primarily driven by cellular immunity, rather than humoral immunity primarily based on the production of neutralizing antibodies, fundamentally avoiding the risk of ADE. Furthermore, the N protein exhibits high sequence conservation, enabling the vaccine to provide cross-protection against different FIPV strains and even variants with antigenic drift, improving the vaccine's broad spectrum and efficacy and preventing vaccine failure due to viral mutations. Moreover, the N protein is a protein highly expressed during viral infection, rich in T-cell epitopes, which can efficiently stimulate key cellular immunity, effectively inducing a strong Th1-type cellular immune response to effectively clear intracellular viruses. It can also induce cytotoxic T lymphocyte (CTL) responses, directly recognizing and destroying virus-infected cells, controlling intracellular pathogen infection such as FIPV from the core. In addition, traditional N protein subunit vaccines have weak immunogenicity, cannot effectively present antigens, and are difficult to stimulate sufficient cellular immunity. This invention utilizes ferritin nanocarriers as an antigen display platform, overcoming the technical bottleneck of insufficient immunogenicity in traditional subunit vaccines. It pioneers a multi-antigen nanoparticle vaccine immunization strategy based on displaying FIPV N protein, offering broader-spectrum protection compared to single-antigen vaccines while reducing ADE (antibody-dependent enhancement) risks. Furthermore, this invention develops a nanodelivery system targeting dendritic cells (DCs), employs specific HCV E2 ligand modification technology, utilizes the immunostimulant IFN-γ to establish precise immune homeostasis, and enhances the immunoprotective effect of nanoparticles (Nnps) through antigen selection and the synergistic effect of multiple IFN-γ cytokine components. This improves cellular immunity induced by the candidate vaccine while completely avoiding ADE risks.

[0022] In one embodiment, the total molar ratio of HCV E2-SC protein and IFNγ-SC protein to the molar ratio of ST-N-Fer protein is 1:1; the molar ratio of HCV E2-SC protein to IFNγ-SC protein is 1:1. In this invention, ST-N-Fer protein is covalently coupled to HCV E2-SC protein; ST-N-Fer protein is covalently coupled to IFNγ-SC protein.

[0023] This invention also provides a method for preparing the self-assembled ferritin nanoparticle recombinant protein described above, comprising the following steps: The encoding gene of the ST-N-Fer protein was cloned into a prokaryotic expression vector to obtain a first recombinant prokaryotic expression vector; the first recombinant prokaryotic expression vector was expressed in prokaryotic cells to obtain the ST-N-Fer protein. The gene encoding the HCV E2-SC protein was cloned into a prokaryotic expression vector to obtain a second recombinant prokaryotic expression vector; the second recombinant prokaryotic expression vector was expressed in prokaryotic cells to obtain the HCV E2-SC protein. The gene encoding the IFNγ-SC protein was cloned into a prokaryotic expression vector to obtain a third recombinant prokaryotic expression vector; the third recombinant prokaryotic expression vector was expressed in prokaryotic cells to obtain the IFNγ-SC protein. The ST-N-Fer protein, HCV E2-SC protein, and IFNγ-SC protein were incubated to obtain the self-assembled ferritin nanoparticle recombinant protein.

[0024] In one implementation, the basic framework of the prokaryotic expression vector includes the pET32a vector.

[0025] In one implementation, the first recombinant prokaryotic expression vector is pET32a-ST-N-Fer; pET32a-ST-N-Fer is constructed based on pET32a-N-Fer; pET32a-N-Fer is constructed by Sangon Biotech Ltd., where N represents FIPV nucleocapsid protein (N) and Fer represents Helicobacter pylori ferritin; the construction method of pET32a-ST-N-Fer includes: using EcoR The pET32a-N-Fer recombinant plasmid was linearized using restriction endonuclease I, and the SpyTag sequence was cloned into the N-terminus of pET32a-N-Fer using fusion primers ST-F and ST-R to construct pET32a-ST-N-Fer.

[0026] As one implementation method, the nucleotide sequence optimized by the N-Fer codon is shown in SEQ ID NO.4, specifically as follows: gaattc atggccacacagggacaacgcgtcaactggggagatgaaccttccaaaagacgtggtcgttc taactctcgtggtcggaagaataatgatatacctttgtcattctacaaccccattaccctcgaacaaggatctaaa ttttggaatttgtgtccgagagaccttgttcccaaaggaataggtaataaggatcaacaaattggttattggaata gacagattcgttatcgtattgtaaaaggccagcgtaaggaactcgctgagaggtggttcttttacttcttaggtac aggacctcatgctgatgctaaattcaaagacaagattgatggagtcttttgggttgcaagggatggtgccatgaac aagcccacaacgcttggcactcgtggaaccaataacgaatccaaaccactgagatttgatggtaagataccgccac agtttcagcttgaagtgaaccgttctaggaacaattcaaggtctggttctcagtctagatctgtttcaagaaacag atctcaatctagaggaagacaccattccaataaccagaataataatgttgaggatacaattgtagccgtgcttgaa aaattaggtgttactgacaaacaaaggtcacgttctaaacctagagaacgtagtgattccaaacctagggacacaa cacctaagaatgccaacaaacacacctggaagaaaactgcaggcaagggagatgtgacaactttctatggtgctag aagtagttcagctaactttggtgatagtgatctcgttgccaatggtaacgctgccaaatgctaccctcagatagct gaatgtgttccatcagtgtctagcataatctttggcagtcaatggtctgctgaagaagctggtgatcaagtgaaag tcacgctcactcacacctactacctgccaaaggatgatgccaaaactagtcaattcctagaacagattgacgctta caagcgaccttctgaagtggctaaggatcagaggcaaagaagatccctttctaagtctgctgataagaagcctgag gagttgtctgtaactcttgtggaggcatacacagatgtgtttgatgacacacaggttgagatgattgatgaggtta cgaatagcggtggtagcggtggtatgttatcaaaagacatcattaagttgctaaacgaacaagtgaataaggaaat gaactcttccaacttgtatatgagcatgagttcatggtgctatacccatagcttagatggcgcggggcttttcttg tttgaccatgcggctgaagaatacgagcatgctaaaaagcttattatcttcttgaatgaaaacaatgtgcctgtgc aattgaccagcatcagcgcgcctgagcataagtttgaaggtttgactcaaattttccaaaaagcctatgaacatga gcaacacatcagcgagtctattaacaatatcgtagatcacgccataaaaagcaaagatcatgcgactttcaatttc ttgcaatggtatgtggctgaacagcatgaagaagaagtgcttttcaaggatattttggataaaattgagttgattg gtaatgaaaaccatggcttgtatttagccgatcagtatgtcaaagggatcgctaaaagcaggaaatcttaactcg ag ; where the bold sequence is EcoR I restriction site, single underlined sequence is FIPV N sequence, double underlined sequence is Linker sequence, wavy line sequence is ferritin (Fer) gene sequence, double underlined wavy line is... Xho I restriction site.

[0027] As one implementation, the nucleotide sequence of the SpyTag sequence is shown in SEQ ID NO.5, specifically: atgggcagcagccgtggtgttccgcacattgttatggttgacgcgtacaaaccgacgaaa.

[0028] In one implementation method, the present invention optimizes the codons of the HCV E2 gene, and then ligates the 3' end of the optimized HCV E2 gene to the 5' end of SpyCatcher, thereby fusing the HCV E2 gene with SpyCatcher to obtain HCV E2-SpyCatcher (HCV E2-SC); the nucleotide sequence of the optimized HCV E2-SC gene codon is shown in SEQ ID NO.8, specifically: gaattc atgtctacccacgtgaccggcggcgcccagggacactccatctggaggctgaccagcc tgttctctctgggccccacccagagaatccagctggtgaacaccaacggcagctggcacatcaaccggaccgccct gaactgcaacgactctctgcagaccggcttcatcgccgccctgttctacgccaacaagttcaatagctctggatgc ccagagaggctggcctcctgtagacccatcgacaaattcgctcagggatggggaccaatcacctacgctgaaccag gatcttctgaccagaggccctactgctggcactacgcccccagaccctgcggaatcgtgccagccagcgaggtgtg cgtgcccgtgtactgtttcaccccatccccagtggtggtgggaaccaccgaccggagcggcgtgcccacctacacc tggggcgagaacgaaaccgacgtgctgctgctgaacaacaccaggcctccccagggcaactggttcggctgcacct ggatgaatggaaccggattcaccaagacctgtggcggccctccctgtaacatcggcggcgtgggcaacaacaccct gacctgccccaccgactgtttcaggaagcaccccgaggccacctacgccaaatgtggatctggaccatggctgacc cccaggtgtatggtggactacccctaccgcctgtggcactacccctgcaccgtgaacttcaccatcttcaaagtgc ggatgtacgtgggcggcgtggaacacagactgaatgctgcttgcaactggaccaggggcgagaggtgcgacctgga agacagggacagatccgagctgagccccctgctgctgagcaccaccgaatggcagatcctgccctgtagcttcacc accctgcccgccctgtctaccggactgatccacctgcaccagaacatcgtggacgtgcagtacctgtacggcgtgg gctctgccgtggtgtccttcgtgatcaagtgggagtacgtgctgctgctgttcctgctgctggccgatgctagagt gtgcgcttgtctgtggatgatgctgctgatcgcccaggccgaagcc gctagc ggtgggtcaggcggtagcggaggt agcgtgacgacactgagcggtctgagtggggaacagggtccgtctggtgatatgaccaccgaagaagacagcgcaa cccacattaaatttagcaaacgtgatgaagatgggcgtgaactggcaggagcaaccatggaactgcgcgatagctc aggtaaaaccattagcacgtggattagcgatggacatgtaaaagacttttacctgtatccgggtaaatataccttt gttgaaactgcagcaccggacggctatgaagtggcaaccccgattgaatttaccgttaatgaagatggacaggtta ccgttgatggagaggcaaccgaaggtgatgcccatacctaa ctcgag; where the bold sequence is EcoR I restriction site, the underlined sequence is the HCV E2 sequence, the italic sequence is... Nhe I restriction site, double-underlined sequence is Linker sequence, underlined wavy sequence is SpyCatcher, double-underlined wavy sequence is... Xho I restriction site.

[0029] In one implementation method, the present invention optimizes the codons of the IFN-γ gene, and then ligates the 3' end of the optimized IFN-γ gene to the 5' end of SpyCatcher, thereby fusing the IFN-γ gene with SpyCatcher to obtain IFN-γ-SpyCatcher (IFN-γ-SC); the nucleotide sequence of the IFN-γ-SC codon-optimized nucleotide sequence is shown in SEQ ID NO. 9, specifically: gaattc atgaactacaccagcttcatcttcgccttccagctgtgcatcatcctgtgctcc agcggctactactgccaggccatgttcttcaaggagatcgaggaactgaaaggctacttcaacgcctccaacccag acgtggctgatggcggaagcctgttcgtggacatcctgaagaactggaaagaggaaagcgacaagaccatcatcca gagccagatcgtgtctttctacctgaagatgttcgagaacctgaaagacgacgaccagagaatccagcggtctatg gacaccatcaaggaagacatgctggacaaactgctgaacacctcttccagcaagagagacgacttcctgaaactga tccagatccccgtgaacgacctgcaggtgcagaggaaggccatcaacgaactgttcaaagtgatgaacgacctgtc tccccgctccaacctgcggaagcgcaaaaggtctcagaacctgttcaggggcaggagagcctccaag gctagc ggt gggtcaggcggtagcggaggtagcgtgacgacactgagcggtctgagtggggaacagggtccgtctggtgatatga ccaccgaagaagacagcgcaacccacattaaatttagcaaacgtgatgaagatgggcgtgaactggcaggagcaac catggaactgcgcgatagctcaggtaaaaccattagcacgtggattagcgatggacatgtaaaagacttttacctg tatccgggtaaatatacctttgttgaaactgcagcaccggacggctatgaagtggcaaccccgattgaatttaccg ttaatgaagatggacaggttaccgttgatggagaggcaaccgaaggtgatgcccatacctaactcgag; Among them, the bold sequence is EcoR I restriction site, the underlined sequence is the IFN-γ sequence, the italic sequence is... Nhe I restriction site, double-underlined sequence is Linker sequence, underlined wavy sequence is SpyCatcher, double-underlined wavy sequence is... Xho I enzyme cutting site; the nucleotide sequence of the SpyCatcher is such as SEQ ID As shown in NO.10, specifically: gtgacgacactgagcggtctgagtggggaacagggtccgtctggtgatatgaccaccgaagaagacagcgcaacccacattaaatttagcaaacgtgatgaagatgggcgtgaactggcaggagcaaccatggaactgcgcgatagctcaggtaaaaccattagc acgtggattagcgatggacatgtaaaagacttttacctgtatccgggtaaatatacctttgttgaaactgcagcaccggacggctatgaagtggcaacccgattgaatttaccgttaatgaagatggacaggttaccgttgatggagaggcaaccgaaggtgatgcccatacctaa. As one implementation method, to ensure the correct spatial conformation of the fusion protein, a linker sequence ggtgggtcaggcggtagcggaggtagc (SEQ ID NO.11) is introduced at the fusion link between SpyTag or SpyCatcher and the target gene.

[0030] In one embodiment, the gene encoding the HCV E2-SC protein is inserted into a restriction endonuclease. EcoR I and Xho Between I and II, the gene encoding the IFNγ-SC protein is inserted into the restriction endonuclease. EcoR I and Xho Between I.

[0031] In one embodiment, the prokaryotic cells include Escherichia coli BL21.

[0032] In one embodiment, during the incubation, the total molar ratio of HCV E2-SC protein and IFNγ-SC protein to the molar ratio of ST-N-Fer protein is 1:1; the molar ratio of HCV E2-SC protein to IFNγ-SC protein is 1:1. In one embodiment, the incubation temperature is 4°C, and the incubation time is 4 h. In one embodiment, the incubation buffer composition is 60 mM Tris-HCl, 8% glycerol, 0.1% Tween-20, 60 mM NaCl, and 250 mM imidazole.

[0033] The present invention also provides the application of the self-assembled ferritin nanoparticle recombinant protein described in the above-described scheme or the self-assembled ferritin nanoparticle recombinant protein prepared by the above-described preparation method in the preparation of feline infectious peritonitis virus vaccine.

[0034] The present invention also provides a feline infectious peritonitis virus vaccine, wherein the feline infectious peritonitis virus vaccine comprises the self-assembled ferritin nanoparticle recombinant protein described in the above scheme or the self-assembled ferritin nanoparticle recombinant protein prepared by the preparation method described above.

[0035] In one embodiment, the self-assembled ferritin nanoparticle recombinant protein is the sole active ingredient of the feline infectious peritonitis virus vaccine.

[0036] This invention addresses key technical bottlenecks in feline infectious peritonitis virus (FIPV) vaccines, such as insufficient immunogenicity and ADE risk. It innovatively develops a multi-antigen-displaying nanoparticle vaccine based on ferritin carriers. Through targeted delivery and immune balance regulation, a novel nanoparticle vaccine that can circumvent ADE effects while providing strong immune protection has been successfully developed. It has the advantages of high efficiency and safety, and provides a promising prevention and control strategy for FIPV and other ADE-related viral pathogens.

[0037] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a self-assembled ferritin nanoparticle recombinant protein and its application in the preparation of a feline infectious peritonitis virus vaccine. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0038] Example 1 I. Expression and purification of ST-N-Fer protein, HCV E2-SC, and IFNγ-SC pET32a-N-Fer (where N represents FIPV nucleocapsid protein (N) and Fer represents Helicobacter pylori ferritin), constructed by Sangon Biotech Ltd., was used... EcoR The pET32a-N-Fer recombinant plasmid was linearized using restriction endonuclease I, and the SpyTag sequence was cloned into the N-terminus of pET32a-N-Fer using the following fusion primers to construct the pET32a-ST-N-Fer recombinant plasmid.

[0039] The optimized nucleotide sequence of the N-Fer codon is shown in SEQ ID NO.4, and the nucleotide sequence of the SpyTag sequence is shown in SEQ ID NO.5. Fusion primer ST-F: aagcaggaaatctctcgagatgggcagcagccgt (SEQ ID NO.6); Fusion primer ST-R: tatcggatccgaattatcctgacgggtggtaatacg (SEQ ID NO.7).

[0040] Simultaneously, the HCV E2 gene (GenBank No. JN870282.1) and IFN-γ gene (GenBank No. X86972.1) were codon-optimized and synthesized, and then fused with SpyCatcher, respectively. The 3' ends of the HCV E2 and IFN-γ genes were linked to the 5' ends of SpyCatcher, respectively, to construct the recombinant plasmid pET32a-HCV E2-SC (see plasmid map). Figure 16 ) and pET32a-IFN-γ-SC (see plasmid map) Figure 17 (In this context, the encoding gene of the HCV E2-SC gene is inserted into the restriction endonuclease...) EcoR I and Xho Between I and II, the coding gene of the IFNγ-SC gene is inserted into the restriction endonuclease. EcoR I and Xho The optimized nucleotide sequence of HCV E2-SpyCatcher (HCV E2-SC) is shown in SEQ ID NO. 8. The optimized nucleotide sequence of the IFN-γ-SpyCatcher (IFN-γ-SC) gene is shown in SEQ ID NO. 9. The nucleotide sequence of SpyCatcher (SC) is shown in SEQ ID NO. 10.

[0041] IFNγ-SC and HCV E2-SC can be efficiently coupled to ST-N-Fer via a covalent link between SpyTag and SpyCatcher. To ensure the correct spatial conformation of the fusion protein, a linker sequence (as shown in SEQ ID NO. 11) was introduced at the fusion link between SpyTag or SpyCatcher and the target gene. The recombinant protein was expressed using an E. coli expression system, and SDS-PAGE analysis confirmed that ST-N-Fer (81.5 kDa), HCV E2-SC, and IFN-γ-SC were successfully expressed in soluble form in the supernatant. Homogeneous protein was subsequently purified by nickel affinity chromatography.

[0042] The fusion proteins were expressed and purified using a prokaryotic expression system. The specific procedure was as follows: Recombinant plasmids pET32a-ST-N-Fer, pET32a-HCV E2-SC, and pET32a-IFNγ-SC were transformed into BL21(DE3) *E. coli*, and expression was induced for 16 h at 16°C using 1 mmol / L isopropyl thiogalactoside (IPTG) (catalog number: I8070, Solarbio). After centrifugation at 12,000 rpm for 20 min, the bacterial culture was resuspended in Tris buffer (60 mM Tris, 60 mM NaCl, 0.1% Tween-20, pH=7.5). The cells were then disrupted by sonication, and centrifuged again at 12,000 rpm for 20 min. The supernatant and precipitate were collected separately for SDS-PAGE solubility analysis. Cell-free supernatant after sonication was passed through a nickel column (catalog number: SA052100, Smart-Lifesciences) and eluted with Tris buffer containing 250 mM imidazole (60 mM Tris, 60 mM NaCl, 0.1% Tween-20, pH=7.5) in a volume of 15 mL.

[0043] To confirm the expression of the fusion protein, Western blotting analysis was performed. The simplified procedure is as follows: 40 µL of sample was mixed with 5× loading buffer, boiled at 100 °C for 14 min, and then separated by 10% SDS-PAGE. The sample was then transferred to a polyvinylidene fluoride (PVDF) membrane and blocked with 5% skim milk at room temperature for 2 h. After blocking, the membrane was incubated with mouse anti-His monoclonal antibody (catalog number: 66005-1-Ig, Proteintech) / whole-virus FIPV polyclonal antibody at room temperature for 2 h, washed three times with PBST, and then incubated with horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (catalog number: 23083128, Biosharp) / HRP-labeled goat anti-cat IgG (catalog number: 102-005-003, Jackson) at room temperature for 1 h. Finally, the protein bands were detected using an ECL chemiluminescence system.

[0044] II. Preparation of Self-Assembled Ferritin Nanoparticles as Recombinant Protein (Nanoparticles) Purified ST-N-Fer, HCV E2-SC, and IFNγ-SC proteins were mixed at a 1:1 molar ratio of total HCV E2-SC and IFNγ-SC protein to ST-N-Fer protein, with the molar ratio of HCV E2-SC to IFNγ-SC protein being 1:1. The reaction mixture was incubated in protein buffer at 4°C with continuous shaking for 4 h to facilitate coupling via the SpyCatcher / SpyTag system. Covalent coupling between ST-N-Fer and the targeting factor or immunostimulant was detected by 10% SDS-PAGE. When coupling the targeting factor or immunostimulant to ST-N-Fer in vitro, the molar concentration must be kept consistent.

[0045] To evaluate the immunomodulatory effects of the three-component HCV E2 / IFNγ-N-Fer (tfN / IHnps) nanoparticles in cats, we first fused purified IFNγ-SC and HCV E2-SC with ST-N-Fer recombinant protein in an equimolar ratio in vitro. Figure 1 This nanoparticle evolved from sfNnps and incorporated an immune enhancer (IFNγ) and an APC-targeting factor (HCV E2). SDS-PAGE confirmed that IFNγ-SC and HCV E2-SC can be highly coupled to ST-N-Fer through a covalent link between SpyTag and SpyCatcher, forming a complex. Figure 2 ).

[0046] Experimental Example 1: Particle size characterization of the self-assembled ferritin nanoparticles recombinant protein prepared in Example 1. The particle size of the self-assembled ferritin nanoparticles was characterized using dynamic light scattering (DLS) (Malvern Instruments, UK). A brief description of the procedure is as follows: The fused self-assembled ferritin nanoparticles obtained in Example 1 were diluted with PBS buffer (pH 7.4) to a final concentration of 0.1–0.5 mg / mL. An appropriate amount of protein sample was added to a reusable cuvette, and the particle size distribution was recorded by 10 scans (10 s each) at 20°C. Data analysis was then performed using dedicated software provided by Malvern Instruments to ensure accurate determination of particle size distribution and hydrodynamic diameter. Another 20 μL of recombinant protein sample was taken, and a copper mesh was carefully placed on the surface of the protein droplet for 5 min to absorb the adsorption. Excess liquid was then blotted away with filter paper. The copper mesh was then covered with uranium acetate staining solution and incubated for 5 min to enhance contrast. Excess staining solution was again blotted away with filter paper. The prepared samples were observed using an H-7650 transmission electron microscope (Hitachi, Japan).

[0047] Negative staining transmission electron microscopy (TEM) confirmed that the complex formed highly uniform nanoparticles with morphology similar to natural ferritin; dynamic light scattering (DLS) analysis detected that the hydrodynamic diameters of the complex were 68 nm and 142 nm, respectively. Figure 3 and Figure 4 The results indicate that the self-assembled ferritin nanoparticles (tfN / IHnps) were successfully constructed.

[0048] Experimental Example 2: Uptake of different antigens by RAW264.7 cells and DC2.4 cells. I. Analysis of the uptake of different antigens by RAW264.7 cells and DC2.4 cells using fluorescence microscopy RAW264.7 cells and DC2.4 cells were cultured at a rate of 2 × 10⁻⁶. 5 Cells were seeded per well in 12-well plates and cultured at 37°C and 5% CO2 for 24 h. Cells and proteins were incubated at 37°C for 4 h, then the culture medium was removed, cells were washed with PBS, and then fixed with 4% (v / v) paraformaldehyde for 30 min. Cells were washed with PBS again, and 0.5 mL of 2% (v / v) Triton X-100 was added to permeate the cell membrane for 10 min. Nuclei were stained with DAPI at room temperature for 5 min. Antigen uptake by RAW264.7 and DC2.4 cells was analyzed using fluorescence microscopy.

[0049] A primary immunization followed by two booster immunizations were employed. Single-component ST-N-Fer (sfNnps), two-component IFNγ-Fer (dfN / Inps), two-component HCV E2-N-Fer (dfN / Hnps), and three-component IFNγ / HCV E2-N-Fer (tfN / IHnps) nanoparticles (self-assembled ferritin nanoparticles prepared in Example 1) were mixed with FA in equimolar proportions and immunized in cats at weeks 0, 3, and 6. A control group (Inac) was established simultaneously. After three immunizations, the dfN / Inps, dfN / Hnps, tfN / IHnps, and Inac groups all induced significantly higher levels of FIPV N-specific antibodies than the sfNnps group. p <0.05%, representing increases of 1.27-fold, 1.14-fold, 1.29-fold, and 1.26-fold, respectively. Further analysis of serum cytokines revealed that dfN / Inps, dfN / Hnps, tfN / IHnps, and Inac all promoted IL-4 and IFN-γ secretion, with the most significant increase in IL-4 levels observed in the inactivated vaccine group, which was 1.31 times higher than that in the sfNnps group. p <0.05; serum IFN-γ levels were significantly higher than sfNnps in the dfN / Inps, dfN / Hnps, tfN / IHnps, and Inac groups ( p <0.05), where the serum IFN-γ levels in the dfN / Hnps and dfN / Inps groups were comparable to those in the Inac group, but the IFN-γ level induced by tfN / IHnps was 114.48% of that induced by Inac ( Figures 5-7 ).

[0050] II. Flow cytometry analysis of cellular uptake of different antigens Cell uptake was analyzed by flow cytometry. RAW264.7 cells and DC2.4 cells were divided into groups of 2 × 10⁻⁶. 5 RAW264.7 and DC2.4 cells were seeded at a ratio of 1 cell / well in 12-well plates and cultured overnight. Subsequently, protein stimulation was added to both cells, and they were incubated at 37°C for 4 h. Green cell fluorescence was measured by flow cytometry to determine the uptake of different antigens (nanoparticles).

[0051] Fluorescence microscopy and flow cytometry were used to observe and analyze the uptake of nanoparticles by dendritic cells. A 6-well plate culture system was used, with 3 × 10⁶ cells seeded per well. 5Dendritic cells (DCs2.4 line) were incubated with FITC-labeled nanoparticles (catalog number: HY-66019, MedChemExpress) for 8 h. The culture medium was then removed, and the cells were washed with PBS to remove unbound nanoparticles. Intracellular uptake of the nanoparticles was observed using a Nikon fluorescence microscope, and the uptake efficiency of the nanoparticles by dendritic cells was quantitatively analyzed using a BDBiosciences flow cytometer.

[0052] In terms of cellular immunity, flow cytometry was used to monitor changes in peripheral blood T lymphocyte subsets after immunization. Following the initial immunization, CD4+ levels were observed in each immunization group. + The T cell ratio was significantly higher in the normal saline group than in the normal saline group. p <0.05), indicating that the vaccine can rapidly induce a T helper cell response. After two booster immunizations, CD4 counts in the dfN / Inps, dfN / Hnps, tfN / IHnps, and Inac groups were significantly higher. + The T cell ratio increased by 2.52-fold, 4.53-fold, 3.35-fold, and 2.66-fold respectively compared to the initial immunization. After three immunizations, the CD4 counts in the dfN / Inps, dfN / Hnps, and tfN / IHnps groups increased. + The T cell ratios were 1.28-fold, 1.77-fold, and 2.08-fold higher than those in the sfNnps group, respectively, with no statistically significant difference between the Inac group and the sfNnps group. p >0.05). In addition, CD8+ in peripheral blood... + T-cell ratio analysis showed that after two booster immunizations, CD8 ratios in the dfN / Inps, dfN / Hnps, tfN / IHnps, and Inac groups were significantly lower. + The T cell ratio increased by 2.17-fold, 4.80-fold, 3.63-fold, and 1.39-fold respectively compared to the first immunization; after three immunizations, the CD8+ ratio in the dfN / Hnps and tfN / IHnps groups increased. + The proportion of T cells was significantly higher than that of sfNnps ( p <0.05), there was no statistically significant difference in dfN / Hnps group ( p >0.05), while the CD8 of the Inac group + The T cell ratio was significantly lower than that of sfNnps, decreasing by 2.08 times, demonstrating the superiority of tfN / IHnps in driving cellular immune responses. Figure 8 ).

[0053] Experiment Example 3 evaluates the in vivo retention and biodistribution characteristics of fluorescently labeled antigens. To evaluate the in vivo retention and biodistribution characteristics of fluorescently labeled antigens, FITC-labeled N monomers or self-assembled ferritin nanoparticles prepared in Example 1 (N nanoparticles, containing equimolar doses of FIPV N antigen) were injected into the right hind limb of BALB / c mice. Before injection, the fluorescence intensity of each sample was measured in vitro to ensure that the initial fluorescence levels of each group were similar. The fluorescence intensity was monitored every 12 h after injection. Before each imaging, mice were anesthetized with isoflurane (Cat. No.: R510-22-10, RayBio) to reduce motion artifacts. A small animal in vivo imaging system was used to capture the fluorescence signals of each group and dynamically track the retention and distribution of antigens. After 48 h of injection, the draining lymph nodes (injection site) and spleen were collected to evaluate the biodistribution of fluorescent antigens. The fluorescence intensity of the above tissues was quantitatively analyzed using the real-time image analysis software provided with the imaging system.

[0054] On day 0, day 14, and day 28, BALB / c mice were immunized with 50 μg of N nanoparticle vaccine or FIPV N monomers, ensuring that all groups received an equal molar dose of FIPV N antigen. Blood was collected from the tail vein on day 14 after each immunization to isolate serum. On day 42 after immunization, the spleen was removed, and splenocytes were isolated using a splenocyte isolation kit.

[0055] All experiments were conducted using female cats aged 1 to 2 years. Each cat was individually housed in a separate cage at room temperature (25 °C). A total of 21 cats were randomly divided into 6 groups (3 cats per group), namely Normal saline (saline group), sfNnps (N-Fer group), dfN / Hnps (HCV E2-N-Fer group), dfN / Inps (IFNγ-N-Fer group), tfN / Ihnps (HCV E2 + IFNγ-N-Fer group), and Inac group (inactivated vaccine group). At the time of enrollment, all cats were negative for feline coronavirus (FCoV), feline immunodeficiency virus (FIV), feline panleukopenia virus (FPV), feline herpesvirus (FHV), feline leukemia virus (FeLV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) as detected by virus-specific RT-PCR (using oropharyngeal / rectal swabs and specific primers). Adaptive feeding was carried out for approximately 1 month before immunization.

[0056] For the immunogenicity assessment of the multi-component nanoparticle vaccine, cats were subcutaneously inoculated on days 0, 21, and 42 with 100 μg of FA-emulsified ST-N-Fer nanoparticles, multi-component nanoparticles, or single-component nanoparticles (containing an equimolar amount of N antigen; in multi-component nanoparticles, IFNγ or HCV E2 was mixed with N antigen in a 1:1 molar ratio). A control group was established using a whole-virus inactivated FIPV vaccine. Peripheral blood was collected 21 days after each immunization for serum separation and PBL isolation. During the protective efficacy assessment phase, 2 mL of FIPV virus suspension (10 μg / mL) was injected intraperitoneally after immunization. 5.5 TCID 50 Infection was performed. Clinical symptoms, survival rate, weight, and body temperature were monitored and recorded daily during the post-infection observation period.

[0057] To further assess the risk of adverse drug reaction (ADE) in multi-component nanoparticle vaccines, we co-treated feline peripheral blood mononuclear macrophages with serum from three immunizations of different groups and an equal volume of FIPV before challenge, and used indirect immunofluorescence to detect viral antigen adhesion. The results showed that the normal saline group, sfNnps group, tfN / IHnps group, and two-component vaccine group exhibited very little viral antigen fluorescence, which was punctate, similar to the FIPV control group. However, the Inac group showed abundant viral antigen fluorescence signals, diffusely distributed. Figure 9 ).

[0058] Viral RNA levels were detected by quantitative real-time fluorescence. The results showed that there was no significant difference in viral copy number between the tfN / IHnps group and the FIPV control group. p >0.05), while the viral copy number in the Inac group showed a gradient decreasing trend with increasing serum dilution, and was significantly higher than that in the vaccine-immunized group and the FIPV control group up to a dilution of 32-fold. p <0.05%, further verifying that tfN / IHnps immune serum does not exhibit ADE (antibody-dependent enhancement). Figure 10 In inducing abnormal release of inflammatory factors, the secretion levels of TNF-α, IL-1β, IL-6, and IL-10 in the cell supernatant of the tfN / IHnps group and other vaccine-immunized groups were lower than or comparable to those in the FIPV control group, and no abnormal surge in inflammatory factors was observed. However, the levels in the Inac group were significantly higher than those in the FIPV control group. p >0.05), further supporting tfN / IHnps completely avoids ADE risks ( Figure 11 ).

[0059] We conducted lethal challenge experiments on all cats after they completed three rounds of vaccination and dynamically observed their clinical performance and survival rates for 60 days. The cats' clinical symptoms were monitored daily. Symptoms were scored as follows: lethargy, loss of appetite, unsteady gait, high fever (>40.1℃), jaundice, and significant weight loss (>2.5%), with 1 point added to the total score for each symptom. The cats' weight (upper part) and body temperature (lower part) were recorded daily.

[0060] In the early stages of infection, 33% of cats in the Inac group exhibited lethargy on day 2, and all animals showed decreased appetite and lethargy by day 5. Similarly, 100% of cats in the normal saline group showed lethargy on day 5, with one-third experiencing decreased appetite. Unlike the control group, only 33% of cats in the sfNnps group and 66% in the dfN / Hnps group experienced brief periods of drowsiness in the early stages, while the dfN / Inps and tfN / IHnps groups showed no obvious clinical symptoms throughout the early stages of infection, demonstrating that the novel nanovaccine effectively prevents acute FIPV infection-related manifestations. Subsequent observation of clinical manifestations and survival rates further demonstrated the superior protective effect of the tfN / IHnps vaccine. By day 8 post-infection, the survival rate in the Inac group had decreased to 66%, while all other experimental groups remained alive. By day 12, all animals in the Inac group had died, and the survival rate in the normal saline group had also decreased to 66%; while the dfN / Hnps, dfN / Inps, and tfN / IHnps groups maintained 100% survival. By day 17, all cats in the normal saline group had died, while there were still no deaths in the sfNnps, dfN / Hnps, dfN / Inps, and tfN / IHnps groups. As the observation period lengthened, some cats in the sfNnps, dfN / Hnps, and dfN / Inps groups gradually developed clinical symptoms such as intermittent fever and weight loss, and their survival rates fluctuated accordingly: on days 21 and 25 post-infection, the survival rates in the dfN / Inps and dfN / Hnps groups decreased to 66%; on day 41 post-infection, the survival rate in the sfNnps group further decreased to 33%. In contrast, cats in the tfN / IHnps group maintained relatively stable body temperature and a consistently increasing weight throughout the observation period, with very few infection-related clinical symptoms. By the end of day 60, all animals in the tfN / IHnps group survived, the survival rate in the dfN / Hnps and dfN / Inps groups was 66%, the survival rate in the sfNnps group dropped to 33%, and none of the Inac and normal saline groups survived. Figure 12-14 ).

[0061] Experiment 4 assesses the in vitro antibody-dependent enhancement (ADE) activity of immune serum. To assess the in vitro antibody-dependent enhancement (ADE) activity of the immune serum, blood was collected from the peripheral veins of healthy cats and placed into heparin-anticoagulated tubes. PBMCs were isolated using a feline peripheral blood mononuclear cell (PBMC) isolation kit (catalog number: P4500, Solarbio). After erythrocyte lysis and cell counting, the cell concentration was adjusted, and the PBMCs were seeded into 12-well cell culture plates. Feline infectious peritonitis virus (FIPV) suspension (MOI=1) was mixed with immune feline serum (serum from cats that underwent triple immunization in Example 2) at a 1:1 ratio and incubated at 37°C for 1 h. The pre-incubated mixture was added to the wells containing PBMCs and incubated for another 2 h. The effect of the feline immune serum on FIPV virus attachment was assessed using indirect immunofluorescence staining targeting the FIPV N protein. The groups were divided into sfNnps (N-Fer group), FIPV (virus group), dfN / Hnps (HCV E2-N-Fer group), dfN / Inps (IFNγ-N-Fer group), tfN / Ihnps (HCVE2+ IFNγ-N-Fer group), and Inac group (inactivated vaccine group). The immune serum for each group was the serum from the cats after the third immunization in Example 2.

[0062] Viral load testing showed that when all members of the Inac group died on day 12 post-infection, the FIPV N gene copy numbers in the dfN / Hnps, dfN / Inps, and tfN / IHnps groups were significantly lower than those in the Inac group. p <0.05, among which the FIPV N gene copy number in the tfN / IHnps group was 3.80 times lower than that in the Inac group, which was better than that in the sfNnps (1.79 times), dfN / Hnps (2.97 times), and dfN / Inps (2.78 times); while on day 17 post-infection, when all members of the normal saline group had died, the FIPV N gene copy numbers in the dfN / Hnps, dfN / Inps, and tfN / IHnps groups were all significantly lower than those in the normal saline group, decreasing by 1.72, 2.50, and 3.46 times, respectively. Figure 15 In summary, the tfN / IHnps vaccine not only completely avoids the risk of ADE, but also effectively inhibits the occurrence of early clinical symptoms after FIPV infection, and provides sustained protection against death and subacute disease progression, which is significantly superior to other nanoparticle vaccine combinations such as sfNnps, dfN / Hnps, and dfN / Inps.

[0063] In summary, this invention constructs a self-assembled nanovaccine by fusing the full-length N protein of feline infectious peritonitis virus (FIPV) with ferritin nanoparticles. 24-mer assembly is achieved, resulting in uniformly sized particles. Immunostimulatory factors and targeting factors are irreversibly assembled onto Nnps via covalent peptide bonds using the SpyTag / SpyCatcher system, preparing FIPV N protein nanoparticles with a dual-functional module of "DC-targeting peptide-IFNγ". When the immunostimulatory factor IFNγ and the targeting factor HCV E2 are coupled to Nnps, they significantly enhance antigen presentation and immunogenicity in mice and cats, particularly inducing a stronger T-cell immune response compared to using Nnps alone. Notably, the Nnps functionalized with IFNγ and HCV E2 exhibit strong immunoprotective effects in FIPV challenge experiments, and more importantly, do not induce adverse drug reactions (ADE).

[0064] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A self-assembled ferritin nanoparticle recombinant protein, characterized in that, The self-assembled ferritin nanoparticle recombinant protein is self-assembled from ST-N-Fer protein, HCV E2-SC protein and IFNγ-SC protein; The amino acid sequence of the ST-N-Fer protein is shown in SEQ ID NO.1; The amino acid sequence of the HCV E2-SC protein is shown in SEQ ID NO.2; The amino acid sequence of the IFNγ-SC protein is shown in SEQ ID NO.

3.

2. The self-assembled ferritin nanoparticle recombinant protein according to claim 1, characterized in that, The ST-N-Fer protein is covalently coupled to the HCV E2-SC protein; the ST-N-Fer protein is covalently coupled to the IFNγ-SC protein.

3. The method for preparing the self-assembled ferritin nanoparticle recombinant protein according to claim 1 or 2, characterized in that, Includes the following steps: The encoding gene of the ST-N-Fer protein was cloned into a prokaryotic expression vector to obtain a first recombinant prokaryotic expression vector; the first recombinant prokaryotic expression vector was expressed in prokaryotic cells to obtain the ST-N-Fer protein. The gene encoding the HCV E2-SC protein was cloned into a prokaryotic expression vector to obtain a second recombinant prokaryotic expression vector; the second recombinant prokaryotic expression vector was expressed in prokaryotic cells to obtain the HCV E2-SC protein. The gene encoding the IFNγ-SC protein was cloned into a prokaryotic expression vector to obtain a third recombinant prokaryotic expression vector; the third recombinant prokaryotic expression vector was expressed in prokaryotic cells to obtain the IFNγ-SC protein. The ST-N-Fer protein, HCV E2-SC protein, and IFNγ-SC protein were incubated to obtain the self-assembled ferritin nanoparticle recombinant protein.

4. The preparation method according to claim 3, characterized in that, The basic framework of the prokaryotic expression vector includes the pET32a vector.

5. The preparation method according to claim 3, characterized in that, The prokaryotic cells include Escherichia coli BL21.

6. The preparation method according to claim 3, characterized in that, During the incubation, the ratio of the total molar amount of HCV E2-SC protein and IFNγ-SC protein to the molar amount of ST-N-Fer protein is 1:1; the molar ratio of HCV E2-SC protein to IFNγ-SC protein is 1:

1.

7. The preparation method according to claim 3, characterized in that, The incubation temperature is 4°C, and the incubation time is 4 hours.

8. The preparation method according to claim 3 or 7, characterized in that, The incubation buffer consisted of 60 mM Tris-HCl, 8% glycerol, 0.1% Tween-20, 60 mM NaCl, and 250 mM imidazole.

9. The use of the self-assembled ferritin nanoparticle recombinant protein according to claim 1 or 2, or the self-assembled ferritin nanoparticle recombinant protein prepared by the preparation method according to any one of claims 3 to 8, in the preparation of feline infectious peritonitis virus vaccine.

10. A feline infectious peritonitis virus vaccine, characterized in that, The feline infectious peritonitis virus vaccine comprises the self-assembled ferritin nanoparticle recombinant protein as described in claim 1 or 2, or the self-assembled ferritin nanoparticle recombinant protein prepared by any one of the preparation methods described in claims 3 to 9.

Images