DsRNA molecule, pharmaceutical composition and application of dsRNA molecule in extrahepatic delivery
By combining dsRNA molecules with specific monomeric structures and drugs, the challenge of delivering siRNA drugs in the CNS system has been solved, achieving efficient extrahepatic delivery and target gene knockdown, which can be applied to the treatment of diseases in the central nervous system, fat, muscle, lung, eye and other tissues.
Patent Information
- Application Number
- CN202511189360.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-08-26
- Filing Date
- 2025-08-25
- Publication Date
- 2026-03-03
AI Technical Summary
Existing siRNA drug delivery technologies have difficulty effectively crossing the blood-brain barrier, resulting in significant challenges in delivery to the central nervous system (CNS). This makes it impossible to address the internalization problem of CNS target cells, thus limiting the application of siRNA in extrahepatic tissues.
Using dsRNA molecules containing specific monomeric structures, delivery to the CNS system via local administration is achieved by utilizing lipid phosphate structures to improve delivery efficiency, and combining drug compositions such as sterile aqueous solutions, dispersions, and sterile powders to achieve highly efficient extrahepatic delivery.
It has achieved efficient delivery of dsRNA molecules to extrahepatic tissues such as the central nervous system, adipose tissue, muscle tissue, lungs, and eyes, significantly reducing target gene expression, and can be used for the prevention and treatment of related diseases.
Smart Images

Figure CN121592647A_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to dsRNA molecules containing a lipid phosphate structure, pharmaceutical compositions comprising the dsRNA molecules, and the use of the dsRNA molecules and pharmaceutical compositions in extrahepatic delivery. Background Technology
[0002] RNA interference (RNAi) is a gene silencing phenomenon induced by double-stranded RNA. siRNA can target and silence the expression of target genes by recognizing specific sequences of mRNA. Currently, six siRNA drugs have been approved by the FDA, demonstrating broad application prospects. However, all six drugs are liver-targeting. Most existing siRNA drug clinical trials are also for liver-related diseases, with only a few clinical trials targeting extrahepatic tissues. This is because advancements in delivery technology have limited the application of siRNA in extrahepatic tissues.
[0003] Existing siRNA drug delivery technologies mainly include liver-targeted delivery mediated by LNP and GalNAc, antibody-mediated muscle-targeted delivery, integrin ligand-mediated lung delivery, lipid-mediated CNS delivery, peptide nanoparticle-mediated tumor delivery, AAV delivery, and exosome delivery. Currently, GalNAc-conjugated delivery is the most widely studied, with 5 out of the 6 drugs mentioned above employing this technology. Extrahepatic delivery remains in a very early stage of development.
[0004] Because free siRNA in the blood cannot cross the blood-brain barrier (BBB), siRNA delivery to the central nervous system (CNS) is challenging. One effective method for delivering siRNA to the CNS is local administration. However, this does not solve the problem of internalization in CNS target cells. Reference 1 (Diverse lipid conjugates for functional extra-hepatic siRNA delivery in vivo, Nucleic Acids Research, 2019, Vol. 47, No. 3) discloses various lipid-conjugated siRNAs, some of which can achieve extrahepatic delivery, enabling functional gene silencing in the lungs, muscles, fat, heart, and adrenal glands. Reference 2 (WO2019217459A1) discloses a conjugated double-stranded iRNA agent used to reduce gene expression in extrahepatic cells. Currently, further development of efficient in vivo delivery methods is needed to enable siRNA drugs to exert their effects in extrahepatic tissues such as the CNS. Invention Overview
[0005] One aspect of this disclosure provides a dsRNA molecule comprising at least one monomeric structure of formula (I), wherein the monomeric structure of formula (I) is:
[0006]
[0007] in:
[0008] R1 is selected from H, OH, halogen, unsubstituted or C-substituted. 1-6 Alkoxy, C 1-6 Alkylamine, OH, amino, (C 1-6 Alkyl)2N-C 1-6 alkoxy-substituted C 1-6 Alkoxy, C 2-6 alkenyl-O-,C 1-6 Alkyl-NH-C 1-6 Alkyl-C(=O)-O-; preferably H, OH, F, OMe, methoxyethoxy (MOE-O-), N-methyl-acetoxy, N,N-dimethylethoxyethoxy, allyl-O-, N-methyl-acetoxy; more preferably H, OH, F, OMe, methoxyethoxy (MOE-O-); more preferably H, OMe, F;
[0009] R2 is selected from C 10-30 Alkyl group, preferably C 16-22 Alkyl, more preferably C 16 C 22 Alkyl, more preferably C 16 C 22 Straight-chain alkyl;
[0010] R3 is selected from H, natural or modified bases;
[0011] X is selected from O and S atoms, preferably O atoms;
[0012] R4 is selected from hydrogen or is not present.
[0013] In some embodiments, the monomer structure represented by formula (I) is selected from the following structures:
[0014]
[0015] In some embodiments, the monomer structure represented by formula (I) is selected from the following structures:
[0016]
[0017]
[0018] In some embodiments, the monomer structure represented by formula (I) is selected from the following structures:
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025] In some embodiments, the dsRNA molecule described in this disclosure comprises a monomeric structure as shown in formula (I).
[0026] In some implementations, the monomeric structure shown in formula (I) is located in one of the following positions within the dsRNA molecule:
[0027] i) The first digit at the 5' end of the sense chain;
[0028] ii) The middle position of the semantic chain.
[0029] The middle position refers to the position other than the 5' and 3' end positions, preferably the 4th to 8th positions from the 5' end, more preferably the 6th, 7th and 8th positions, and more preferably the 6th position.
[0030] In some embodiments, the dsRNA molecules involved in this disclosure are unmodified or modified, and the modified nucleotides in the dsRNA molecules include: 2'-O-methyl nucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, locked nucleotides, open-ring nucleotides (UNA), glycol nucleotides (GNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, baseless nucleotides, ribitol, reverse nucleotides, reverse baseless nucleotides, reverse 2'-OMe nucleotides, reverse 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholinonucleotides and 3'-OMe nucleotides, nucleotides containing a 5'-thiophosphate group, or terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bis(decanoic acid) group, 2'-amino-modified nucleotides, aminophosphates, or one or more of the following non-natural bases containing nucleotides. In some embodiments, it also includes an E-vinylphosphonate nucleotide at the 5' end of the sense strand and / or antisense strand; or a link between at least one (thio)phosphate nucleotide of the sense strand and / or antisense strand.
[0031] In some implementations, the length of the double-stranded region of the dsRNA molecule can be 19 to 30 nucleotide pairs; or 19 to 25 nucleotide pairs; or 19 to 21 nucleotide pairs; or 19 to 23 nucleotide pairs; or 21 to 23 nucleotide pairs; or the length of each strand independently is no more than 30 nucleotides; or the length of each strand independently is no more than 25 nucleotides; or the length of each strand independently is no more than 23 nucleotides.
[0032] In some implementations, the dsRNA molecule has two blunt ends; or at least one strand contains a 3' overhang of at least one nucleotide; or at least one strand contains a 3' overhang of at least two nucleotides.
[0033] Another aspect of this disclosure provides compounds of formula II and formula III for preparing the above-mentioned dsRNA molecules, the structures of said compounds of formula II and formula III being as follows:
[0034]
[0035] In Equations II and III above:
[0036] R1 is selected from H, OH, halogen, unsubstituted or C-substituted. 1-6 Alkoxy, C 1-6 Alkylamine, OH, amino, (C 1-6 Alkyl)2N-C 1-6 alkoxy-substituted C 1-6 Alkoxy, C 2-6 alkenyl-O-,C 1-6 Alkyl-NH-C 1-6 Alkyl-C(=O)-O-; preferably H, OH, F, OMe, methoxyethoxy (MOE-O-), N-methyl-acetoxy, N,N-dimethylethoxyethoxy, allyl-O-, N-methyl-acetoxy; more preferably H, OH, F, OMe, methoxyethoxy (MOE-O-); more preferably H, OMe, F;
[0037] R2 is selected from C 10 -C 30 Alkyl group, preferably C 16 -C 22 Alkyl, more preferably C 16 C 22 Alkyl, more preferably C 16 C 22 Straight-chain alkyl;
[0038] R3 is selected from H, natural or modified bases;
[0039] R5 is a hydroxyl protecting group, preferably benzyl, benzoyl, 2,6-dichlorobenzyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, methanesulfonyl, toluenesulfonyl, dimethoxytriphenylmethyl (DMTr), 9-phenylxanthine-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthine-9-yl (MOX), more preferably DMTr.
[0040] R6 and R7 are each independently C1-C 10 Alkyl group, preferably C1-C6 alkyl group, more preferably isopropyl group.
[0041] In some embodiments, the compounds of formula II and formula III are selected from:
[0042]
[0043] In some embodiments, the compound of formula II is selected from:
[0044]
[0045] The compound of formula III is selected from:
[0046]
[0047] In some embodiments, the compound of formula II is selected from:
[0048]
[0049] The compound of formula III is selected from:
[0050]
[0051] Without specifying the configuration, the dsRNA molecules, monomeric structures, and compounds of this disclosure may exist in specific geometric or stereoisomeric forms. All such dsRNA molecules, monomeric structures, and compounds of this disclosure, including cis and trans isomers, (-)- and (+)- enantiomers, (R)- and (S)- enantiomers, diastereomers, (D)- isomers, (L)- isomers, and racemic mixtures and other mixtures, such as mixtures enriched with enantiomers or diastereomers, are within the scope of this disclosure. Additional asymmetric carbon atoms may be present in substituents such as alkyl groups. All such isomers and mixtures thereof are included within the scope of this disclosure.
[0052] Optically active (R)- and (S)- isomers, as well as D- and L- isomers, can be prepared by chiral synthetic methods, or using chiral reagents or other techniques conventional in the art. To obtain an enantiomer of a dsRNA molecule or compound disclosed herein, preparation can be achieved by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated, and the auxiliary group is cleaved to provide a pure desired enantiomer. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a salt of the diastereomeric isomer is formed with a suitable optically active acid or base, followed by diastereomeric resolution using conventional methods known in the art, and then the pure enantiomer is recovered. Furthermore, the separation of enantiomers and diastereomeric isomers is typically accomplished using chromatography employing a chiral stationary phase and optionally combined with chemical derivatization (e.g., from amines to carbamates).
[0053] This disclosure also includes compounds identical to those described herein, but in which one or more atoms are labeled with isotopes whose atomic weights or mass numbers differ from those commonly found in nature. Examples of isotopes that can be incorporated into compounds of this disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, and fluorine, such as... 2 H, 3 H, 11 C 13 C 14 C 13 N、 15 N、 15 O、 17 O、 18 O、 31 P, 32 P, 35 S and 18 F, etc.
[0054] Another aspect of this disclosure provides a pharmaceutical composition comprising any one or more of the above-described dsRNA molecules and a pharmaceutically acceptable carrier.
[0055] In some embodiments, the pharmaceutical composition is an injectable dosage form, comprising a sterile aqueous solution or dispersion and a sterile powder. In some embodiments, the sterile solution may include a diluent such as water; a physiological saline solution; a non-volatile oil, polyethylene glycol, glycerin, or propylene glycol, etc.
[0056] In some embodiments, the pharmaceutical composition is an oral dosage form. In some embodiments, the oral dosage form includes excipients, such as polyethylene glycol, glyceryl stearate, etc. In some embodiments, the oral dosage form includes plasticizers, such as diethyl phthalate, glyceryl triacetate, dibutyl sebacate, dibutyl phthalate, or triethyl citrate, etc. In some embodiments, the oral dosage form includes a permeation enhancer, which can be bile salts or fatty acids. Bile salts can be ursodeoxycholic acid, chenodeoxycholic acid, and their salts. Fatty acids can be decanoic acid, lauric acid, and their salts, etc.
[0057] In some embodiments, the pharmaceutical composition is a pulmonary or nasal dosage form.
[0058] In some embodiments, the pharmaceutical composition includes a local delivery agent, which may be a plurality of microvesicles, and the microvesicles may be liposomes.
[0059] Another aspect of this disclosure provides the use of the above-described dsRNA molecule or the above-described pharmaceutical composition in extrahepatic delivery (e.g., to the central nervous system, adipose tissue, muscle tissue, lung, eye, etc.), or in the preparation of a drug delivered extrahepatically.
[0060] Another aspect of this disclosure provides a method for reducing the expression of target genes in cells, or the use of the above-mentioned dsRNA molecule or the above-mentioned pharmaceutical composition in the preparation of a drug that reduces the expression of target genes in cells. The method or application includes contacting the cells with the dsRNA molecule of this disclosure or the dsRNA molecule in the above-mentioned pharmaceutical composition; the target gene is selected from SOD1, APP, GPR75, SCN9A, PMP22, MAPT, Leptin, MSTN1, MALAT1, Adiponectin, ACVR1C, ACVR2B, etc., and the cells are extrahepatic cells. Further, the method is an extrahepatic application method for reducing the expression of target genes in central nervous system cells, wherein the cells are derived from one or more of the following groups: cerebellum, brainstem, thoracic vertebrae, thoracic spinal cord, thoracic DRG, striatum, cortex, lumbar vertebrae, and hippocampus.
[0061] In some embodiments, the above-described dsRNA molecules or the above-described pharmaceutical compositions are used for the prevention and / or treatment of diseases associated with lung, fat, muscle, eye, and central nervous system (CNS) disorders, or in the preparation of medicaments for the prevention and / or treatment of diseases associated with lung, fat, muscle, eye, and central nervous system (CNS) disorders.
[0062] The dsRNA molecule disclosed herein can achieve efficient extrahepatic delivery and exhibits good knockdown effects on target genes in cells of different extrahepatic tissues such as the central nervous system, fat, muscle, lung, and eye. Attached Figure Description
[0063] Figure 1 The expression levels of SOD1 in rats under ICM 14 days were compared with those of the dsRNA molecule QLAD-002031, the negative control molecule QLAD-000270, the positive control molecule QLAD-000249, and the blank group.
[0064] Figure 2 The expression levels of SOD1 in rats under ICM 42 days were compared with those of the dsRNA molecule QLAD-002031, the negative control molecule QLAD-000270, the positive control molecule QLAD-000249, and the blank group.
[0065] Figure 3 The expression levels of SOD1 in mice at 14 days of IT were compared with those of the dsRNA molecule QLAD-002031, the negative control molecule QLAD-000270, the positive control molecule QLAD-000249, and the blank control group.
[0066] Figure 4 The expression levels of SOD1 in mice at 42 days of IT were compared with those of the dsRNA molecule QLAD-002031, the negative control molecule QLAD-000270, the positive control molecule QLAD-000249, and the blank control group. Detailed Implementation
[0067] the term
[0068] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference as if specifically and individually indicated that each individual publication, patent or patent application is incorporated by reference.
[0069] Before this disclosure is described in detail below, it should be understood that this disclosure is not limited to the specific methodologies, procedures, and reagents described herein, as these can vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of this disclosure. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
[0070] Some embodiments disclosed herein include numerical ranges, and certain aspects of this disclosure may be described using ranges. Unless otherwise stated, it should be understood that numerical ranges or descriptions using ranges are for the purpose of brevity and convenience only and should not be considered as a strict limitation of the scope of this disclosure. Therefore, descriptions using ranges should be considered as specifically disclosing all possible subranges and all possible specific numerical points within those ranges, as these subranges and numerical points have been explicitly stated herein. For example, a description of a range from 1 to 30 should be considered as specifically disclosing subranges from 1 to 3, 1 to 4, 1 to 5, 1 to 6, 1 to 10, 2 to 4, 2 to 6, 3 to 6, 10 to 30, 16 to 22, etc., and specific numerical points within those ranges, such as 1, 2, 3, 4, 5, 6. The above principles apply equally regardless of the breadth of the numerical values. When a range description is used, the range includes the endpoints of the range.
[0071] When referring to measurable values such as quantities, temporary durations, etc., the term “about” means a variation of ±20%, or in some cases ±10%, or in some cases ±5%, or in some cases ±1%, or in some cases ±0.1% of the specified value.
[0072] As used herein, "target sequence" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of the relevant gene, including mRNA that is a primary transcription product of RNA processing. The target portion of the sequence is at least long enough that the nucleotide sequence portion of the mRNA molecule formed during the transcription of the relevant gene, or in its vicinity, serves as a substrate for iRNA-guided cleavage.
[0073] As used in this article, "target gene" refers to genes that promote unwanted cell proliferation, growth factor genes, growth factor receptor genes, genes expressing kinases, adhesion protein genes, genes encoding G protein superfamily molecules, genes encoding transcription factors, genes mediating angiogenesis, viral genes, genes required for viral replication, cellular genes mediating viral function, genes of bacterial pathogens, genes of amoebic pathogens, genes of parasitic pathogens, genes of fungal pathogens, genes mediating unwanted immune responses, genes mediating pain management, genes mediating neurological diseases, alleles found in cells characterized by loss of heterozygosity, or an allele of a polymorphic gene, etc.
[0074] The target sequence can be approximately 18 to 35 nucleotides in length, for example, approximately 18 to 30 nucleotides. For example, the target sequence can be approximately 19 to 30 nucleotides, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides in length. In some embodiments, the target sequence is approximately 19 to approximately 30 nucleotides in length. In other embodiments, the target sequence is about 19 to about 25 nucleotides in length. In other embodiments, the target sequence is about 19 to about 23 nucleotides in length. In some embodiments, the target sequence is about 19 to about 21 nucleotides in length. Ranges and lengths between those listed above are also considered part of the invention.
[0075] As used interchangeably herein, the terms “iRNA,” “RNAi agent,” “iRNA agent,” and “RNA interference agent” refer to an agent containing RNA as defined herein, which mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNA guides the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). “iRNA” as used herein can be double-stranded RNA and is referred to herein as a “double-stranded RNA agent,” “double-stranded RNA (dsRNA) molecule,” “dsRNA reagent,” “dsRNA,” “double-stranded RNA (dsRNA) conjugate,” or “double-stranded RNA (dsRNA) conjugate molecule.” The term “dsRNA” refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, meaning that these two nucleic acid strands have a “sense” orientation and an “antisense” orientation relative to the target RNA.
[0076] The terms “silence,” “reduction,” “inhibition,” “knockdown,” “block,” or “downregulation,” and other similar terms are used interchangeably and include any level of inhibition.
[0077] The term "chain containing a sequence" refers to an oligonucleotide containing a nucleotide chain, described by reference to a sequence using standard nucleotide nomenclature.
[0078] Typically, "G", "C", "A", "T", and "U" each represent a nucleotide containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively. However, it should be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil can be replaced by other parts without substantially altering the base-pairing properties of the oligonucleotide containing the nucleotide with this replacement part. For example, but not limited to, a nucleotide containing inosine as its base can base-pair with a nucleotide containing adenine, cytosine, or guanine. Therefore, nucleotides containing uracil, guanine, or adenine in the nucleotide sequence of the dsRNA characterized in this invention can be replaced with nucleotides containing, for example, inosine. In another example, adenine and cytosine at any position in the oligonucleotide can be replaced with guanine and uracil, respectively, to form a GU wobble base pairing with the target mRNA. Sequences containing such replacement parts are suitable for the compositions and methods characterized in this invention.
[0079] The terms "sequence" and "nucleotide sequence" refer to a continuous sequence of nucleobases or nucleotides, described using standard nomenclature with consecutive letters. Nucleic acid molecules may contain unmodified and / or modified nucleotides. Nucleotide sequences may contain unmodified and / or modified nucleotides.
[0080] The term "base" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, hybrid bases, size-enlarged bases, and fluorinated bases. Modified nucleobases or nucleobase mimics known to those skilled in the art are applicable herein. The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.
[0081] The term "nucleotide" has the same meaning as commonly understood in the art. Therefore, as used herein, "nucleotide" refers to a glycoside comprising a sugar moiety, a base moiety, and a covalently linked group (linking group) such as a phosphate or thiophosphate internucleotide linking group, and encompasses naturally occurring nucleotides, such as DNA or RNA, as well as non-naturally occurring nucleotides comprising modified sugar and / or base moieties, which are also referred to herein as nucleotide analogs. In this document, a single nucleotide may be referred to as a monomer or unit.
[0082] As used herein, unless otherwise stated, the term "complementarity" describes the relevance of a first nucleobase or nucleotide sequence (e.g., the sense strand or targeting mRNA of an RNAi reagent) to a second nucleobase or nucleotide sequence (e.g., the antisense strand or single-stranded antisense oligonucleotide of an RNAi reagent). It refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize with an oligonucleotide containing the second nucleotide sequence (forming base-pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) and to form a double-stranded or double-helix structure under certain standard conditions. Those skilled in the art will be able to select the set of conditions most suitable for hybridization testing. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include native or modified nucleotides or nucleotide mimics to at least the extent required to satisfy the hybridization requirements described above. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for the purpose of determining identity or complementarity.
[0083] As used herein, “perfect complementarity” means that in a pair of hybridized nucleobase or nucleotide sequences, all (100%) bases in the first oligonucleotide sequence will hybridize with the same number of bases in the second oligonucleotide sequence. The sequence may contain all or part of the first or second nucleotide sequence.
[0084] As used herein, when referring to a connection between two compounds or molecules, the terms “connection” or “combination” mean that the two compounds or molecules are connected by a covalent bond. Unless otherwise stated, the terms “connection” and “combination” as used herein may refer to a connection between a first compound and a second compound, with or without any inserted atoms or groups.
[0085] As used herein, the terms “individual” or “subject” refer to any animal, such as a mammal or marsupial. Individuals covered by this disclosure include, but are not limited to, humans, non-human primates (such as cynomolgus monkeys or rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, and any kind of poultry.
[0086] As used herein, the terms “disease,” “symptom,” or “disorder,” etc., refer to any alteration or dysregulation that impairs or interferes with the normal function of cells, tissues, or organs. For example, “disease” includes, but is not limited to: tumors, pathogen infections, autoimmune diseases, T-cell dysfunction disorders, or deficiencies in immune tolerance (such as transplant rejection).
[0087] As used in this article, the term "treatment" refers to a clinical intervention in an attempt to alter an individual's or treat a disease caused by cells, which can be preventative or intervention in a clinicopathological process. Treatment effects include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the condition, and alleviating or improving prognosis.
[0088] As used herein, the term "alkyl" can refer to a straight-chain or branched alkyl group, for example: C 1-3 Alkyl, C 1-6 Alkyl, C 10-30 Alkyl, C 12-25 Alkyl, C 16-22 Alkyl groups, etc. Representative alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecanyl, octadecyl, nonadecanyl, eicosyl or docosyl and similar groups.
[0089] As used herein, the term "alkenyl" refers to an alkyl group as defined above that contains at least one double bond between adjacent carbon atoms, and can be straight-chain or branched, for example: C 2-6 Alkenyl groups, etc. Alkenyl groups include both cis and trans isomers. Representative alkenyl groups include, but are not limited to, vinyl, propenyl, allyl, 1-butenyl, 2-butenyl, isobutenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, and similar groups.
[0090] Example
[0091] Example 1: Synthesis of phosphoramidite monomers containing lipid groups
[0092] 1.1 Synthesis of compound QLR-5
[0093]
[0094] Compounds 1-3
[0095] Under nitrogen protection, Mg (3.6 g, 1.5 eq.) and three iodine granules were added to a three-necked flask containing 10 mL THF. Then, 1-bromohexadecane (30 g, 1.0 eq.) and 60 mL THF were placed in a constant-pressure dropping funnel and mixed thoroughly. Under nitrogen protection, 1 / 5 of the 1-bromohexadecane solution was added to the flask and rapidly heated to 65 °C until the reaction solution slowly became clear. The remaining solution in the dropping funnel was then slowly added dropwise to the three-necked flask. After the addition was complete, the reaction was carried out in an oil bath at 65 °C for 45 minutes, and then the reaction solution was cooled to 20-25 °C. Bis(diisopropylamino)phosphorus chloride (17.6 g, 0.67 eq.) was added to another three-necked flask. Under nitrogen protection, 60 mL THF was added, and the mixture was then transferred to a condenser-stirrer below 0 °C. Grignard reagent was then slowly added using a syringe. After the addition was complete, the reaction was carried out at 0-5 °C for 23 hours. After the reaction was complete, the reaction solution was filtered under nitrogen protection, and the filter cake was washed with dry n-heptane. The filtrate was concentrated to dryness. n-Heptane was added to the concentrate, the mixture was stirred to suspend, and then filtered under pressure. The filtrate was concentrated to obtain the crude product. The crude product was subjected to silica gel chromatography to obtain 25.5 g of compounds 1-3. Purity 31 P-NMR: 99.6%.
[0096] 1 H NMR (500MHz, CDCl3) δ3.45-3.34(m,3H),1.68-1.56(m,2H),1.39(d,J=3.7Hz,4H), 1.36-1.22(m,28H),1.19(d,J=6.8Hz,10H),1.08-0.96(m,10H),0.89-0.82(m,4H).
[0097] Compound QLR-5
[0098] Compounds 1-4 (12.3 g, 1.0 eq.) were dissolved in 123 mL of DCM, followed by compounds 1-3 (12.0 g, 1.2 eq.) and DCI (2.59 g, 1.0 eq.). The mixture was then heated to 25 °C and reacted for 2 h. After the reaction and post-treatment were complete, the crude product was subjected to silica gel chromatography and concentrated to dryness to obtain 5.0 g of product with a purity of 99.1% by UPLC. 31 P-NMR: 99.2%.
[0099] 1H NMR(500MHz, CDCl3)δ10.00(s,1H),8.14-8.02(m,1H),7.53-7.20(m,9H), 6.91-6.79(m,4H),6.13-5.95(m,1H),5.19-5.12(m,1H),4.67-4.37(m,1H) ,4.26-4.10(m,1H),3.98-3.36(m,14H),1.74-1.50(m,2H),1.44-1.21(m, 30H),1.20-0.94(m,10H),0.90(t,J=6.9Hz,3H).MS(ESI)m / z=916.56[M+H] + Theoretical: 916.56.
[0100] Example 2: Synthesis of dsRNA molecules QLAD-000249, QLAD-000270, and QLAD-002031
[0101] The synthesis of dsRNA molecules was similar to that of conventional phosphoramide solid-phase synthesis. Using a Mermade 12 synthesizer (LGC), starting with a universal CPG carrier, nucleoside phosphoramide monomers were linked one by one according to the synthetic program. Nucleoside monomer raw materials, such as 2'-fRNA and 2'-O-methylRNA, were purchased from Shanghai Zhaowei. 5-Ethylthio-1H-tetrazole (ETT) was used as the activator (0.6M acetonitrile solution), 0.22M PADS dissolved in a 1:1 volume ratio of acetonitrile and trimethylpyridine was used as the sulfidation agent, and iodopyridine / aqueous solution was used as the oxidizing agent. After solid-phase synthesis, the oligonucleotides were cleaved from the solid support and soaked in a 3:1 solution of 28% ammonia and ethanol at 50°C for 16 hours. The mixture was then centrifuged, and the supernatant was transferred to another centrifuge tube. After concentration and evaporation to dryness, it was purified by C18 reversed-phase chromatography with 0.1M TEAA and acetonitrile as the mobile phase. DMTr was removed using 3% trifluoroacetic acid solution. The target oligonucleotide was collected, lyophilized, identified as the target product by LC-MS, and then quantified by UV (260nm).
[0102] The obtained single-stranded oligonucleotides were annealed according to complementary pairing in equimolar ratios to finally obtain the double-stranded dsRNA molecules shown in Table 1. The double-stranded dsRNA molecules were dissolved in 1×PBS and adjusted to the required concentration for the experiment.
[0103] Table 1. Nucleotide sequences of unmodified SOD1 sense and antisense strands.
[0104] sense chain sequence (5'-3') Antisense chain sequence (5'-3') CAUUUUAAUCCUCACUCUAAA UUUAGAGUGAGGAUUAAAAUGAG
[0105] Table 2 lists the abbreviations for one or more nucleotides used in nucleic acid sequence representation. It is understood that these monomers, when present in oligonucleotides, are linked together by 5'-3'-phosphodiester bonds.
[0106] Table 2 List of Abbreviations
[0107]
[0108]
[0109] Table 3. Nucleotide sequences of modified SOD1 sense and antisense strands.
[0110]
[0111] Uhd is 2'-O-hexadecyluridine-3'-phosphate, and its preparation method is derived from patent document WO2019217459A1.
[0112] Example 3: Evaluation of dsRNA molecules containing the monomeric structure of this disclosure in rats over a 14-day period in the CNS region.
[0113] To assess the in vivo activity of SOD1 double-stranded nucleotides (also known as dsRNA), rats were administered the drug via ICM.
[0114] Male rats were randomly assigned to the following groups: PBS group (solvent control group, n=3), QLAD-000249 (n=3), QLAD-000270 (n=3), and QLAD-002031 (n=3). For each test compound, it was dissolved and diluted with PBS to 45 μg / μL (1.8 mg injection dose), and administered at a volume of 40 μL / rat. The specific steps were as follows: After anesthetizing the SD rats, their heads were flexed as far towards their chests as possible. The depression above the first cervical vertebra (foramen magnum) was located with the left hand and fixed in position. A scalp needle was taken with the right hand (the tip of the needle was blunted), and the needle was carefully inserted vertically into the cerebellomedullary cistern along the midline of this depression. When the needle is correctly inserted into the cerebellomedullary cistern, the person administering the injection will feel no resistance as the needle moves forward, and will hear a very soft "click" sound. This indicates that the needle has passed through the dura mater and entered the cerebellomedullary cistern, and clear cerebrospinal fluid can be extracted. At this point, the medication can be injected.
[0115] Beforehand, use a microsyringe to measure 30 μL of PBS and 40 μL of the test sample, respectively. Then, using a 1 mL syringe, sequentially draw 30 μL of PBS, 5 μL of air, and 40 μL of the drug solution into a scalp vein needle, for a total of 75 μL. Inject over 40 seconds. After administration, return the animal to its cage.
[0116] On day 14 post-injection, each rat was sacrificed by CO2. Cerebellum, brainstem, striatum, cortex, and hippocampus tissues were then rapidly extracted and flash-frozen in liquid nitrogen. Subsequently, mRNA was extracted using Thermofisher Kingfisher reagent and its accompanying reagents (Thermofisher, 5400930) and analyzed using TaqMan Faster. TM SOD1 mRNA levels were quantified using a one-step premix (Applied Biosystems, 4444434), human GAPDH, and a rat SOD1 TaqMan probe. SOD1 mRNA expression was normalized using GAPDH mRNA expression. Results were normalized to those from the PBS group, and relative expression levels of the target gene were calculated using a 2-1... -ΔΔCT The calculation formula is as follows:
[0117] ΔCT = Average Ct value of target gene (SOD1) - Average Ct value of internal reference gene (GAPDH);
[0118] ΔCT = ΔCT (drug-treated group) - ΔCT (PBS control group);
[0119] relative mRNA expression level = 2 -ΔΔCT The results are shown in Table 4. Figure 1 As shown.
[0120] The results show that, compared with the negative control molecule without lipid delivery (QLAD-000270) and the blank group, the Yangshen molecule (QLAD-000249) and the disclosed dsRNA molecule (QLAD-002031) both exhibited good mRNA knockdown effects in different CNS regions during the 14-day rat experiment. In particular, the disclosed dsRNA molecule (QLAD-002031) showed a higher mRNA knockdown effect than the Yangshen molecule (QLAD-000249) in different CNS regions.
[0121] Table 4 shows the in vivo evaluation of dsRNA molecules containing the monomeric structures of this disclosure in rats over 14 days.
[0122]
[0123] Example 4: Evaluation of dsRNA molecules containing monomers of this disclosure in rats over 42 days in the CNS region.
[0124] To assess the in vivo activity of SOD1 double-stranded nucleotides (also known as dsRNA), rats were administered the drug via ICM.
[0125] Male rats were randomly divided into four groups: PBS group (solvent control group, n=4), QLAD-000249 (n=4), QLAD-000270 (n=4), and QLAD-002031 (n=4). For each test compound, it was dissolved and diluted with PBS to 45 μg / μL (1.8 mg injection dose), and administered at a volume of 40 μL per rat. The specific experimental method was the same as in Example 3. Forty-two days after injection, each rat was sacrificed by CO2. Subsequently, cerebellum, brainstem, thoracic spinal cord, striatum, cortex, and hippocampus tissues were rapidly extracted and flash-frozen in liquid nitrogen. Data processing was the same as in Example 3. The results are shown in Table 5. Figure 2 As shown.
[0126] The results show that, compared with the negative control molecule without lipid delivery (QLAD-000270) and the blank group, the Yangshen molecule (QLAD-000249) and the disclosed dsRNA molecule (QLAD-002031) both exhibited good mRNA knockdown effects in different CNS regions during the 42-day rat experiment. In particular, the disclosed dsRNA molecule (QLAD-002031) showed a higher mRNA knockdown effect than the Yangshen molecule (QLAD-000249) in different CNS regions.
[0127] Table 5 shows the in vivo evaluation of dsRNA molecules containing the monomeric structures of this disclosure in rats over 42 days.
[0128]
[0129]
[0130] Example 5: Evaluation of dsRNA compounds containing monomers of this disclosure in mice over 14 days in the CNS region.
[0131] To assess the in vivo activity of SOD1 double-stranded nucleotide (dsRNA), mice were administered the drug via IT.
[0132] Male mice were randomly assigned to four groups: PBS group (solvent control group, n=4), QLAD-000249 (n=4), QLAD-000270 (n=4), and QLAD-002031 (n=4). For each test compound, it was dissolved and diluted in PBS to a concentration of 30 μg / μL (300 μg injection dose), and administered at a volume of 10 μL per mouse. The specific procedures are as follows:
[0133] Mice were anesthetized with Serta-50 and administered the medication intraperitoneally. The skin at the injection site on the back was shaved and disinfected. Using the thumb or forefinger, the intervertebral spaces along the midline of the bilateral iliac bones were located. Indentations were made with the fingernail to indicate the L5-L6 intervertebral space as the injection site. The base of the tail was slightly rotated to indicate the midline of the spine. Before injection, the needle bevel was adjusted to face the animal's head. The animal was secured, and the syringe was aligned along the midline of the spine. The needle was gently inserted vertically (or at a slight angle of 70-80°) into the intersection of the indentations, keeping the syringe vertical. When bone was reached, the angle was slowly reduced to approximately 30°, and the needle was then slid into the intervertebral space. Injection began, pushing in 1 μL of the solution every 4 seconds, for a total of 10 μL. After injection, the needle was held in place for approximately 1 minute, then the syringe was gently rotated out to avoid leakage.
[0134] On day 14 post-injection, each mouse was sacrificed by CO2. Cerebellum, brainstem, striatum, cortex, and hippocampus tissues were then rapidly extracted and flash-frozen in liquid nitrogen. Subsequently, mRNA was extracted using Thermofisher Kingfisher reagent and its accompanying reagents (Thermofisher, 5400930) and analyzed using TaqMan Faster. TM SOD1 mRNA levels were quantified using a one-step premix (Applied Biosystems, 4444434), human GAPDH, and a mouse SOD1 TaqMan probe. SOD1 mRNA expression was normalized using GAPDH mRNA expression data. Results were normalized to those from the PBS group, and relative expression levels of the target gene were calculated using a 2-1... -ΔΔCT The calculation formula is as follows:
[0135] ΔCT = Average Ct value of target gene (SOD1) - Average Ct value of internal reference gene (GAPDH);
[0136] ΔCT = ΔCT (drug-treated group) - ΔCT (PBS control group);
[0137] relative mRNA expression level = 2 -ΔΔCT The results are shown in Table 6. Figure 3 As shown.
[0138] The results show that, compared with the negative control molecule without lipid delivery (QLAD-000270) and the blank group, the Yangshen molecule (QLAD-000249) and the disclosed dsRNA molecule (QLAD-002031) both exhibited good mRNA knockdown effects in different CNS regions during the 14-day mouse experiment. In particular, the disclosed dsRNA molecule (QLAD-002031) showed a higher mRNA knockdown effect than the Yangshen molecule (QLAD-000249) in all five CNS regions, while their effects were similar in the thoracic spinal cord region.
[0139] Table 6 shows the in vivo evaluation of dsRNA molecules containing the monomeric structures of this disclosure in mice after 14 days.
[0140]
[0141]
[0142] Example 6: Evaluation of dsRNA compounds containing monomers of this disclosure in mice over 42 days in the CNS region.
[0143] To assess the in vivo activity of SOD1 double-stranded nucleotide (dsRNA), mice were administered the drug via IT.
[0144] Male mice were randomly assigned to four groups: PBS group (solvent control group, n=4), QLAD-000249 (n=4), QLAD-000270 (n=4), and QLAD-002031 (n=4). For each test compound, it was dissolved and diluted with PBS to 30 μg / μL (300 μg injection dose), and administered at a volume of 10 μL per mouse. The procedure was consistent with Example 5.
[0145] On day 42 post-injection, each mouse was sacrificed by CO2. Cerebellum, brainstem, thoracic spinal cord, striatum, cortex, and hippocampus tissues were then rapidly extracted and flash-frozen in liquid nitrogen. Subsequently, mRNA was extracted using Thermofisher Kingfisher reagent and its accompanying reagents (Thermofisher, 5400930) and analyzed using TaqMan Faster. TM SOD1 mRNA levels were quantified using a one-step premix (Applied Biosystems, 4444434), human GAPDH, and a mouse SOD1 TaqMan probe. SOD1 mRNA expression was normalized using GAPDH mRNA expression assays. Results were normalized to those from the PBS group, and relative expression levels of the target gene were calculated using a 2-1... -ΔΔCT The calculation formula is as follows:
[0146] ΔCT = Average Ct value of target gene (SOD1) - Average Ct value of internal reference gene (GAPDH);
[0147] ΔCT = ΔCT (drug-treated group) - ΔCT (PBS control group);
[0148] relative mRNA expression level = 2 -ΔΔCT The results are shown in Table 7. Figure 4 As shown.
[0149] The results show that, compared with the negative control molecule without lipid delivery (QLAD-000270) and the blank group, the Yangshen molecule (QLAD-000249) and the disclosed dsRNA molecule (QLAD-002031) exhibited good mRNA knockdown effects in different CNS regions during the 42-day mouse experiment. In particular, the disclosed dsRNA molecule (QLAD-002031) showed a higher mRNA knockdown effect than the Yangshen molecule (QLAD-000249) in all CNS regions.
[0150] Table 7 shows the in vivo evaluation of dsRNA compounds containing monomers of this disclosure in mice at 42 days.
[0151]
[0152] The above results indicate that the disclosed dsRNA molecule exhibits good knockdown effects on target genes in different regions of the CNS system.
Claims
1. A dsRNA molecule comprising at least one monomeric structure of formula (I), wherein the monomeric structure of formula (I) is: in: R1 is selected from H, OH, halogen, unsubstituted or C-substituted. 1-6 Alkoxy, C 1-6 Alkylamine, OH, amino, (C 1-6 Alkyl)2N-C 1-6 alkoxy-substituted C 1-6 Alkoxy, C 2-6 alkenyl-O-,C 1-6 Alkyl-NH-C 1-6 Alkyl-C(=O)-O-; preferably H, OH, F, OMe, methoxyethoxy (MOE-O-), N-methyl-acetoxy, N,N-dimethylethoxyethoxy, allyl-O-, N-methyl-acetoxy; more preferably H, OH, F, OMe, methoxyethoxy (MOE-O-); more preferably H, OMe, F; R2 is selected from C 10 -C 30 Alkyl group, preferably C 16 -C 22 Alkyl, more preferably C 16 C 22 Alkyl, more preferably C 16 C 22 Straight-chain alkyl; R3 is selected from H, natural or modified bases; X is selected from O and S atoms, preferably O atoms; R4 is selected from hydrogen or is not present.
2. The dsRNA molecule as described in claim 1, characterized in that: The monomer structure shown in formula (I) is selected from the following structures: R1, R3, R4 and X are as defined in claim 1.
3. The dsRNA molecule according to any one of claims 1-2, characterized in that: The monomer structure shown in formula (I) is selected from the following structures: R3 is defined as in any one of claims 1-2.
4. The dsRNA molecule according to any one of claims 1-3, characterized in that: The monomer structure shown in formula (I) is selected from the following structures:
5. The dsRNA molecule according to any one of claims 1-4, characterized in that: The monomer structure shown in formula (I) is located in one of the following positions in the dsRNA molecule: i) The first digit at the 5' end of the sense chain; ii) The middle position of the semantic chain; The middle position refers to the position other than the 5' and 3' end positions, preferably the 4th to 8th positions from the 5' end, more preferably the 6th, 7th and 8th positions, and more preferably the 6th position.
6. The dsRNA molecule according to any one of claims 1-5, characterized in that: The dsRNA molecule is either unmodified or modified, and the modified nucleotides in the dsRNA molecule include: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, locked nucleotide, open-ring nucleotide (UNA), glycol nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, baseless nucleotide, ribitol, reverse nucleotide, reverse baseless nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide containing a 5'-thiophosphate group, or terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bis(decylamide) group, 2'-amino modified nucleotide, aminophosphate, or one or more of the following non-natural bases containing nucleotides.
7. The dsRNA molecule according to any one of claims 1-6, characterized in that: The modified nucleotide also includes an E-vinylphosphonate nucleotide at the 5' end of the sense strand and / or antisense strand; or is linked between at least one (thio)phosphate nucleotide in the sense strand and / or antisense strand.
8. The dsRNA molecule according to any one of claims 1-7, characterized in that: The length of the double-stranded region of the dsRNA molecule can be selected from 19 to 30 nucleotide pairs; or 19 to 25 nucleotide pairs; or 19 to 21 nucleotide pairs; or 19 to 23 nucleotide pairs; or 21 to 23 nucleotide pairs; or the length of each strand independently does not exceed 30 nucleotides; or the length of each strand independently does not exceed 25 nucleotides; or the length of each strand independently does not exceed 23 nucleotides.
9. The dsRNA molecule according to any one of claims 1-8, characterized in that: The dsRNA molecule has two blunt ends; or at least one strand contains a 3' overhang of at least one nucleotide; or at least one strand contains a 3' overhang of at least two nucleotides.
10. A compound represented by Formula II or Formula III, wherein the structures of said compounds are as follows: In Equations II and III above: R1 is selected from H, OH, halogen, unsubstituted or C-substituted. 1-6 Alkoxy, C 1-6 Alkylamine, OH, amino, (C 1-6 Alkyl)2N-C 1-6 alkoxy-substituted C 1-6 Alkoxy, C 2-6 alkenyl-O-,C 1-6 Alkyl-NH-C 1-6 Alkyl-C(=O)-O-; preferably H, OH, F, OMe, methoxyethoxy (MOE-O-), N-methyl-acetoxy, N,N-dimethylethoxyethoxy, allyl-O-, N-methyl-acetoxy; more preferably H, OH, F, OMe, methoxyethoxy (MOE-O-); more preferably H, OMe, F; R2 is selected from C 10 -C 30 Alkyl group, preferably C 16 -C 22 Alkyl, more preferably C 16 C 22 Alkyl, more preferably C 16 C 22 Straight-chain alkyl; R3 is selected from H, natural or modified bases; R5 is a hydroxyl protecting group, preferably benzyl, benzoyl, 2,6-dichlorobenzyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, methanesulfonyl, toluenesulfonyl, dimethoxytriphenylmethyl (DMTr), 9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl (MOX), more preferably DMTr; R6 and R7 are each independently C1-C 10 Alkyl group, preferably C1-C6 alkyl group, more preferably isopropyl group.
11. The compound according to claim 10, characterized in that: The compounds of formula II and formula III are respectively selected from: R1, R2, and R3 are defined as in claim 8.
12. The compound according to any one of claims 10-11, characterized in that: The compound of formula II is selected from: The compound of formula III is selected from: Wherein, R1 and R3 are as defined in any one of claims 8-9.
13. The compound according to any one of claims 10-12, characterized in that: The compound of formula II is selected from: The compound of formula III is selected from:
14. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises one or more dsRNA molecules as described in any one of claims 1-9 and a pharmaceutically acceptable carrier.
15. The pharmaceutical composition according to claim 14, characterized in that: The pharmaceutical composition is an injectable dosage form, an oral dosage form, a pulmonary or nasal dosage form, or a locally delivered dosage form.
16. The use of the dsRNA molecule as described in any one of claims 1-9 or the pharmaceutical composition as described in any one of claims 14-15 in extrahepatic delivery (e.g., central nervous system, adipose tissue, muscle tissue, lung, eye, etc.).
17. A method for reducing the expression of a target gene in a cell, the method comprising contacting the cell with a dsRNA molecule as described in any one of claims 1-9 or a dsRNA molecule in a pharmaceutical composition as described in any one of claims 14-15, wherein the cell is an extrahepatic cell.
18. The method as described in claim 17, characterized in that: The target genes are selected from SOD1, APP, GPR75, SCN9A, PMP22, MAPT, Leptin, MSTN1, MALAT1, Adiponectin, ACVR1C, ACVR2B, etc.
19. The method according to any one of claims 17-18, characterized in that: The method reduces the expression of target genes in cells of the central nervous system, which are derived from one or more of the following groups: cerebellum, brainstem, thoracic vertebrae, thoracic spinal cord, thoracic DRG, striatum, cortex, lumbar vertebrae, and hippocampus.
20. The use of the dsRNA molecule according to any one of claims 1-9 or the pharmaceutical composition according to any one of claims 14-15 in the prevention and / or treatment of diseases associated with disorders of the lungs, fat, muscles, eyes and central nervous system (CNS).
Citation Information
Patent Citations
Extrahepatic delivery
WO2019217459A1