Vitis davidii ziat10 gene, its encoded protein and application
Overexpression of the VdZAT10 gene in grape callus enhanced grape resistance to anthracnose, solving the problems of fungicide hazards to the environment and health and pathogen resistance, and providing a new gene selection method for breeding grapes resistant to anthracnose.
Patent Information
- Application Number
- CN202511670287.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-14
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2045-11-14
AI Technical Summary
In the existing technology, the use of fungicides to control grape anthracnose is harmful to the environment and health, and enhances the drug resistance of pathogens. There is a lack of effective means of breeding anthracnose-resistant genes.
The VdZAT10 gene and its encoded protein from grape thorn were provided. The VdZAT10 gene was overexpressed in grape callus by constructing the overexpression vector pcambia2300-GFP, which enhanced the resistance of grape to anthracnose.
Under pathogen stress, the expression level of the VdZAT10 gene is upregulated, which improves the resistance of grapes to anthracnose and provides a theoretical basis for breeding grapes resistant to anthracnose.
Smart Images

Figure CN121592664B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a VdZAT10 gene of Grape thorn, its encoded protein, and its applications. Background Technology
[0002] Grape( Vitisvinifera L. Originally from West Asia, grapes are cultivated worldwide and are one of the most widely grown fruits globally. Anthracnose, caused by fungi of the genus *Colletotrichum* in the Deuteromycetes, is a significant global disease affecting grapes, severely impacting yield and quality. Grape anthracnose primarily affects fruit after ripening, but can also infect leaves, shoots, tendrils, and fruit stalks, although symptoms are less pronounced on the fruit and rachis.
[0003] Currently, fungicides are mainly used to control anthracnose in grape cultivation. However, the use of fungicides not only harms the environment and health but also enhances the pathogen's resistance. Due to the adverse effects of using fungicides to control the spread of anthracnose, there is increasing interest in breeding anthracnose-resistant table grapes through hybridization. Previous studies have shown that only the functions of a few resistance genes in grapes have been reported in response to anthracnose infection, especially regarding the interaction network between grapes and anthracnose, and the isolation and functional analysis of key response genes.
[0004] Zinc-finger proteins (ZFPs) are a superfamily of transcription factors. Cys2 / His2 type zinc-finger proteins are one of the largest transcription factor families in plants. Eukaryotic C2H2 type zinc-finger proteins typically contain a specific conserved sequence of 25 to 30 amino acids: C-X2~4-C-X3-P-X5-L-X2-H-X3-H. A total of 98 C2H2 type zinc-finger protein transcription factors were identified in the grape genome. The results showed that the expression patterns of grape C2H2 type zinc-finger protein transcription factors differed in different tissues; most C2H2 type zinc-finger protein genes are involved in regulating grape growth and development. However, functional verification of the role of C2H2 type zinc-finger protein genes in anthracnose stress response is currently lacking.
[0005] The ZAT10 gene (zinc finger protein ZAT10) in plants mainly participates in the response to abiotic stresses (such as cadmium stress and low temperature stress), rather than directly targeting biotic stresses (such as pathogen infection). Its functional mechanisms involve transcriptional regulation, signaling pathway activation, and enhanced stress tolerance. For example, the literature (Tian Yuting. Physiological and transcriptomic analysis of DNA damage in grapes under salt stress. 2025) discloses the salt stress-related transcription factor VdZAT10. This invention, by elucidating the functional characteristics and mechanisms of action of the transcription factor VdZAT10 in the anthracnose stress response, provides a basis for enriching the theory of grape anthracnose resistance and grape anthracnose-resistant breeding. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a VdZAT10 gene of grapes, its encoded protein and its application, which can improve the resistance of grapes to anthracnose after overexpression.
[0007] This invention is implemented as follows: This invention first provides a VdZAT10 gene from grapevine, located on chromosome 7 of grapevine, distributed in the region 28042865-28043566, and its nucleotide sequence is shown in SEQ ID NO.1.
[0008] Specifically, the protein encoded by the VdZAT10 gene of the grape thorn has the amino acid sequence shown in SEQ ID NO.2.
[0009] Finally, this invention provides the application of the VdZAT10 gene from *Grape thorn* in enhancing resistance to grape pathogens after overexpression.
[0010] Furthermore, the pathogen is pathogenic anthrax bacteria.
[0011] Furthermore, the grapes include seedless white grapes.
[0012] Furthermore, the overexpression vector pcambia2300-GFP was constructed to overexpress the VdZAT10 gene in grape callus.
[0013] Specifically, VdZAT10 was linked to the binary vector pcambia2300-GFP to overexpress the VdZAT10 gene from Grape thorn.
[0014] The present invention has verified that the expression level of the VdZAT10 gene under pathogen stress was upregulated 6 days after inoculation with anthracnose in resistant varieties; and that overexpression of VdZAT10 in the callus tissue of seedless white grapes enhanced the grapes' resistance to anthracnose.
[0015] The present invention has the following advantages: This invention provides a VdZAT10 gene from Grape thorn, which is 702 bp in length, encodes 233 amino acids, and has the nucleotide sequence shown in SEQ ID No. 1 and the amino acid sequence shown in SEQ ID No. 2. It contains two zf-C2H2_6 domains.
[0016] This invention analyzed the expression of the VdZAT10 gene in the peel of grape berries after infection with anthracnose. RT-qPCR results showed that VdZAT10 expression was upregulated on day 6 of infection, indicating that VdZAT10 can respond to grape anthracnose infection.
[0017] This invention constructs a vector, VdZAT10-GFP, carrying GFP overexpression by cloning the VdZAT10 sequence. Transforming grape callus tissue into this vector resulted in milder disease symptoms compared to the control group after inoculation with *Staphylococcus aureus*. This verifies that VdZAT10 is a positive regulator in the grape response to *Staphylococcus aureus* infection. Therefore, this invention provides… VdZAT10 Genes can enhance grapes' resistance to anthracnose, providing a theoretical basis for breeding grapes with anthracnose resistance. Attached Figure Description
[0018] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0019] Figure 1 Grape thorns and some species VdZAT10 Homologous protein sequence clustering analysis, where the red box represents Vitis davidii. VdZAT10 .
[0020] Figure 2 for VdZAT10 A schematic diagram of gene construction into the pCambia2300-GFP vector.
[0021] Figure 3 prickly grape VdZAT10 Protein domain analysis diagram.
[0022] Figure 4 prickly grape VdZAT10 Chromosomal localization.
[0023] Figure 5 for VdZAT10 Figure showing the expression levels in response to grape anthracnose induction and in different tissue regions.
[0024] Figure 6 for VdZAT10 Overexpression of the drug in grape callus tissue enhanced resistance to anthrax; A: RT-qPCR detection of expression levels in grapes; B: Overexpression. VdZAT10 Phenotype of callus tissue 3 days after inoculation with anthrax (left: control, right: overexpression) VdZAT10 ). Detailed Implementation
[0025] The present invention will now be described in detail with reference to the accompanying drawings and embodiments, but this is not intended to limit the invention and is merely an example.
[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0027] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0028] The bacterial strains and plasmids used in the examples are as follows: The overexpression vector used in the experiment was pCambia2300-GFP; the Agrobacterium used in the overexpression experiment was strain GV3101 (p19+pSoup); and the Escherichia coli Top10 competent cells used were from TianGen.
[0029] The main reagents used in the examples include a reverse transcription kit, RT-qPCR supermix (Transgen), plasmid extraction kit, plant RNA extraction kit, gel extraction kit, LA high-fidelity enzyme, sucrose, MS powder, Tris, agar powder, CTAB, 75% ethanol, and anhydrous ethanol.
[0030] The culture medium used in the induction experiment in Example 4 was 1 / 2 MS liquid medium.
[0031] Example 4: The co-culture medium was obtained by adding MES, sucrose, coagulant and acetylsuccinone to WPM medium; the final concentration of MES in the co-culture medium was 0.5 g / L, the final concentration of sucrose was 20 g / L and the final concentration of acetylsuccinone was 100 μM.
[0032] Example 1 VdZAT10 CDS sequence cloning and vector construction 1. Use the following primers to clone grape cDNA from the library. VdZAT10 The total length.
[0033] SEQ ID No. 3: P2300- VdZAT10 -BamHI-F: tcggtacccggggatcc ATGGCTCTGGAGACTCTGAATTCA; SEQ ID No. 4: P2300- VdZAT10 -SalI-R: gctcaccatggtgtcgac CTATACTCCTGGATGATGCTTCGC Note: Lowercase sequences are adapter primers (vector sequences), and uppercase sequences are gene sequences.
[0034] 2. Constructing a carrier Homologous recombination reactions were performed using seamless cloning kits from Bometech and Invitrogen (e.g.) Figure 2 The gel recovery product obtained above was mixed with the linearized vector (pCambia2300-GFP) and the reaction solution was added at the same time. The reaction system was 10 μL / 1 μL. The reaction was carried out at 37℃ for 60 min, followed by an ice-water bath for 15 min for subsequent reactions. Only after PCR verification and sequencing to confirm the correct sequence could it be used for subsequent experiments.
[0035] Example 2 VdZAT10 Bioinformatics Analysis Will VdZAT10 The amino acid sequences were compared using the BLAST database, and homologous sequences from different species were downloaded to construct a phylogenetic tree. The results are as follows: Figure 3 As shown, VdZAT10 It is 702 bp in length and encodes 233 amino acids. VdZAT10 The amino acid sequence similarity was analyzed using MEGA6 multiple comparisons. *Vitis thorn* VdZAT10 The gene is located on chromosome 7 of the grape thorn (Vitis thunbergii). Figure 4 The phylogenetic tree was constructed using the maximum likelihood (NJ) method, distributed in the region 28042865-28043566. VdZAT10 The amino acid sequences were compared with those of Grape simonii and Grape rotundi using the Clustw program, and it was found that... VdZAT10 and Riverside Grapes' ZAT10 It has a high degree of homology. Figure 1 ).
[0036] Example 3 VdZAT10 Gene expression pattern analysis Acupuncture was used to treat thorny grapes ( Vitis davidii (Disease-resistant varieties) were inoculated with *Colletotrichum discoidus*, and grape skins infected with *Colletotrichum discoidus* were collected as experimental materials. RT-qPCR was performed and... VdZAT10 Gene expression patterns were analyzed. The results are as follows: Figure 5 As shown, on days 0, 1, 2, 3, and 6 after inoculation of Grapevine with anthracnose, the concentration of [unclear text - possibly related to fruit peel or fruit] in the pericarp [unclear text - possibly related to a specific culture or product]. VdZAT10 Expression levels were induced to be upregulated on day 6 as infection progressed. Figure 5 (A). Expression was found in different tissues in mature fruit. VdZAT10 The expression level is high (MF: mature fruit) Figure 5 (B) indicates VdZAT10 It may be induced in response to grape anthracnose.
[0037] Example 4: Overexpression of grape callus tissue enhanced VdZAT10 Resistance to anthrax The loose callus tissue used in this invention was induced from the stems and leaves of 'Seedless White' grape tissue culture seedlings. The induction medium was: MS + 30 g / L sucrose + 0.3 mg / L 6-BA + 2.0 mg / L NAA + 7 g / L agar, and the pH was adjusted to 5.8. Agrobacterium-mediated transformation of the grape callus tissue was performed, and the specific genetic transformation method is shown below: Cut loose grape callus into pieces, ensuring the pieces are not too large. Place the cut callus in Agrobacterium bacterial suspension (the vector constructed in Example 1 was transformed with Agrobacterium, single clones were picked for verification, and the culture was shaken to adjust the concentration of Agrobacterium to approximately OD600=1). Gently shake for 10 minutes, discard the bacterial suspension, and use sterile filter paper to absorb the bacterial suspension from the surface of the callus. Place the callus in co-culture medium and incubate in the dark for 48 hours. After dark culture, place the callus in a sterilization solution (300-500 mg / L Cef, 200-300 mg / L Carb, 1 / 2 MS and 20 g / L sucrose) and shake for 10 minutes. Discard the sterilization solution and repeat 3 times. Rinse the callus 3 times with sterile water, and use sterile filter paper to absorb the bacterial suspension from the surface of the callus. Place the callus in a selection medium (50 mg / L Kan (overexpression vector), 300 mg / L Cef and 200 mg / L Carb). Finally, RT-qPCR was used to determine the expression level of the transgenic plants. The RT-qPCR results showed... VdZAT10 Successfully transferred to grape callus tissue ( Figure 6 (A)
[0038] Anthrax was inoculated onto the transformed callus. The callus tissue was spread evenly on a petri dish, and an anthracnose mycelium block was inoculated at the very center. Uninoculated callus served as a control. Results showed that grape callus overexpressing VdZAT10 had smaller lesions, indicating that overexpression... VdZAT10 Grape callus tissue exhibited enhanced resistance to anthrax. Figure 6 (B)
[0039] While specific embodiments of the present invention have been described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and not intended to limit the scope of the present invention. Equivalent modifications and variations made by those skilled in the art in accordance with the spirit of the present invention should be covered within the scope of protection of the claims of the present invention.
Claims
1. A type of thorny grape VdZAT10 The application of the gene in enhancing grape resistance to pathogens through overexpression is characterized by: The prickly grape VdZAT10 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2; the pathogen is pathogenic anthracnose; the grape is a seedless white grape.
2. The application according to claim 1, characterized in that: The overexpression vector pcambia2300-GFP was constructed for overexpression in seedless white grape callus. VdZAT10 Gene.
Citation Information
Patent Citations
Vitis davidii VdbHLH51 gene as well as encoding protein and application thereof
CN121022870A