Application of NtNDPK2 gene in cold resistance of tobacco

By mining and knocking out the NtNDPK2 gene in tobacco and constructing a recombinant vector using CRISPR/Cas9 technology, we studied its function in tobacco cold tolerance, solved the problem of tobacco's intolerance to low temperatures, provided gene resources and breeding materials, and improved the cold tolerance of tobacco.

CN121592677APending Publication Date: 2026-03-03CHINA NATIONAL TOBACCO CORPORATION HUNAN PROVINCIAL CORPORATION
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411785724.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-06
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

In existing technologies, tobacco is not tolerant to low temperatures, which leads to premature flowering under low temperature stress, affecting the yield and quality of tobacco leaves. There is a lack of effective molecular breeding methods to improve new tobacco varieties with strong low temperature tolerance.

Method used

By analyzing the phosphorylated proteome of tobacco at low temperature, the NtNDPK2 gene was identified. The gene was then knocked out using CRISPR/Cas9 technology, and a recombinant vector was constructed for genetic transformation to obtain the knockout lines ndpk2-2 and ndpk2-15. Their function in tobacco cold tolerance was then investigated.

Benefits of technology

Knocking out the NtNDPK2 gene significantly reduced the cold tolerance of tobacco, increased ROS accumulation, decreased antioxidant enzyme activity, and aggravated membrane lipid peroxidation, providing genetic resources and breeding materials, and laying a theoretical foundation for breeding new cold-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121592677A_ABST
    Figure CN121592677A_ABST
Patent Text Reader

Abstract

The invention discloses application of an NtNDPK2 gene in cold resistance of tobacco, and belongs to the technical field of molecular biology. According to the application of the NtNDPK2 gene disclosed by the invention in the cold resistance of the tobacco, the sequence of the NtNDPK2 gene is as shown in SEQ ID NO. 1. The NtNDPK2 gene positively regulates and controls the cold resistance of the tobacco, and the cold resistance of the tobacco is remarkably reduced when the gene is knocked out. Gene resources and breeding materials are provided for cultivation of new cold-resistant tobacco varieties through exploration and functional research of the gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically to the application of the NtNDPK2 gene in tobacco cold tolerance. Background Technology

[0002] Tobacco is an important leaf crop, but it is intolerant of low temperatures. Two weeks of continuous low-temperature stress during the 6-7 leaf stage can cause premature flowering, leading to reduced yield and quality. Therefore, breeding new tobacco varieties with strong cold tolerance is crucial for mitigating the impact of low temperatures. Currently, identifying key functional genes and using molecular breeding techniques such as marker-assisted selection or gene editing to improve new varieties is an effective and feasible approach.

[0003] Low temperature stress can lead to the accumulation of reactive oxygen species (ROS) in plants. The accumulated ROS are mainly hydrogen peroxide (H2O2) and superoxide anion radicals (O2·4O2). - Reactive oxygen species (ROS) such as alkoxy radicals (RO-) accumulate excessively, leading to membrane lipid peroxidation and the production of large amounts of malondialdehyde (MDA). MDA reacts with membrane proteins, causing cell membrane damage, increasing membrane permeability, and resulting in ion leakage. Superoxide dismutase (SOD) is the first key antioxidant enzyme to function in the ROS scavenging system, effectively removing ROS and free radicals and enhancing plant resistance to stress. Peroxidase (POD) eliminates superoxide damage to cells by converting superoxide into inactive substances, and also improves cell signaling to promote cellular repair of oxidative damage. Proline is an important osmotic regulator that plants accumulate during stress. Under normal growth conditions, proline levels in plants are usually low, but after stress, proline accumulates in large quantities to prevent osmotic stress from harming the plant.

[0004] Nucleoside diphosphate kinases (NDP kinases, NDPKs): NDP kinases, responsible for the synthesis of nucleoside triphosphates (NTPs), participate in many regulatory processes related to proliferation, development, and differentiation. They are essential for DNA / RNA synthesis, cell division, macromolecular metabolism, and growth. Enzymes maintain NTP or its deoxygenated derivatives by transferring the terminal (γ) phosphate from NTPs (such as ATP or GTP) to the terminal (γ) phosphate of any nucleoside diphosphate (NDP) or its deoxygenated derivative, thus participating in the regulation of biosynthetic metabolism and abiotic stress. NDPK sequences are highly conserved during evolution. All known NDPK isoenzymes contain a conserved histidine residue, which is related to the catalytic mechanism. Single-celled organisms typically possess only one gene encoding NDP kinases, while most multicellular organisms possess not only one orthologous gene providing most of the NDP kinase enzyme activity but also multiple different paralogous genes. Currently, several NDPK proteins have been isolated and identified from plants such as Arabidopsis thaliana, rice, spinach, tomato, and Chinese cabbage. Currently, there are four types of plant NDPK: NDPK I, NDPK II, NDPK III, and NDPK IV. Except for NDPK IV, whose function is still unclear, the other three types of NDPK proteins have multiple biological functions. NDPK II is mainly involved in reactive oxygen species (ROS) scavenging, auxin regulation, and plant photosynthesis. In Arabidopsis thaliana, AtNDPK2 can interact with MAPK to scavenge ROS and plays an important role in chloroplast function and auxin signal transduction. Arabidopsis Atndpk2 mutants exhibit defects in cotyledon opening and greening under both red and far-red light, indicating that this gene is involved in leaf photomorphogenesis. In rice, NDPK2 has been found to regulate the transcriptional levels of other related genes, thereby affecting chloroplast development and chlorophyll biosynthesis.

[0005] Currently, there is limited research on the function of the tobacco nucleoside diphosphate kinase gene in abiotic stress. Therefore, providing information on the application of the NtNDPK2 gene in tobacco cold tolerance is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides the application of the NtNDPK2 gene in tobacco cold tolerance.

[0007] Based on low-temperature tobacco phosphorylation proteomics analysis, an important candidate gene, NtNDPK2, was identified. This study further identified the function of this gene and elucidated its regulatory mechanism, providing genetic resources and a theoretical basis for low-temperature tolerant molecular breeding of tobacco.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] Application of the NtNDPK2 gene in tobacco cold tolerance, the NtNDPK2 gene sequence is shown in SEQ ID NO.1.

[0010] Furthermore, the application of knocking out the NtNDPK2 gene in the negative regulation of tobacco cold tolerance is explored, and the NtNDPK2 gene sequence is shown in SEQ ID NO.1.

[0011] Furthermore, the application of biomaterials with NtNDPK2 gene knockout in the negative regulation of tobacco cold tolerance, wherein the NtNDPK2 gene sequence is shown in SEQ ID NO.1;

[0012] The biomaterial is any one of the following:

[0013] A: An expression cassette capable of silencing the NtNDPK2 gene with a nucleotide sequence as shown in SEQ ID NO.1;

[0014] B: A recombinant vector containing the expression cassette described in A;

[0015] C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

[0016] Furthermore, the application of the NtNDPK2 gene in tobacco breeding, the NtNDPK2 gene sequence of which is shown in SEQ ID NO.1.

[0017] Furthermore, the application of the NtNDPK2 gene in the selection of cold-resistant tobacco germplasm, the NtNDPK2 gene sequence of which is shown in SEQ ID NO.1.

[0018] As can be seen from the above technical solution, compared with the prior art, this invention discloses the application of the NtNDPK2 gene in tobacco cold tolerance. Through low-temperature tobacco phosphorylation proteomics analysis, an important candidate gene, NtNDPK2, was identified. This gene has a CDS sequence length of 447 bp, encoding 148 amino acids and one nucleoside diphosphate kinase. Using Xiangyan 7 as a background, two knockout lines of this gene, ndpk2-2 and ndpk2-15, were obtained using CRISPR / Cas9 technology. Both the knockout lines and the wild type were subjected to low-temperature stress treatment. Under low-temperature stress, compared with Xiangyan 7 (WT), the two knockout lines showed significantly more severe wilting. Physiological and biochemical index measurements and ROS staining results showed that under low-temperature stress, the relative conductivity (EL), malondialdehyde (MDA), hydrogen peroxide (H2O2), and superoxide anion content in the two knockout lines ndpk2-2 and ndpk2-15 were significantly higher than those in the WT line; while the activities of superoxide dismutase (SOD) and peroxidase (POD) were significantly lower than those in the WT line. These results indicate that NtNDPK2 positively regulates tobacco cold tolerance, and knocking out this gene significantly reduces tobacco cold tolerance. The discovery and functional study of this gene provide genetic resources and breeding materials for cultivating new tobacco varieties with low-temperature tolerance. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0020] Figure 1 The attached figures show the phylogenetic tree (A) of NtNDPK2 and the similarity comparison of homologous genes and proteins (B) of this invention;

[0021] Figure 2 The attached figure shows the cis-acting element analysis of the NtNDPK2 promoter of the present invention;

[0022] Figure 3 The attached figures show the gene sequence alignment (A), sequencing peak diagram analysis (B), and protein sequence alignment (C) of the knockout strain of this invention;

[0023] Figure 4 The attached figure shows the phenotypic identification of the cold tolerance of the knockout lines of this invention; phenotypic results of 30-day-old seedlings treated at 4℃ for 4 hours; Bar value = 5cm;

[0024] Figure 5 The attached figure shows the ROS staining of tobacco leaves under low-temperature stress according to the present invention.

[0025] Figure 6 The attached figure shows the physiological and biochemical indicators of the knockout lines of this invention; the results of physiological and biochemical indicator determination of 30-day-old seedlings treated at 4℃ for 24 hours; * indicates that the knockout lines and WT showed significant differences under specific treatments (* indicates P<0.05). Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] The NtNDPK2 CDS sequence is shown in SEQ ID NO.1.

[0028] ATGGAGGCAGACTCATCATGATCAAGCCTGATGGTGTCCAACGTGGCCTGGTTGGTGAGATTATCGGAAGATTTGAGAAGAAAGGATTCTCTTTGAAAGGCTTGAAGCTCATCACTGTGGATCGTGCCTTTGCTGAAAAGCATTACGCAGACCTGTCTGCTAAGCCTTTCTTTAGTGGGCTTGTTGATTATATTATCTCTGGCCCCGTTGTTGCAATGGTCTGG GAAGGTAAGGGTGTAGTTACCACTGGCAGGAAGATCATTGGAGCAACAAACCCATTGGAGTCTGCTCCTGGTACAATCCGGTGGTGATTATGCTATTGACATTGGCAGGAACGTTATTCATGGAAGTGATGCAGTCGAGAGTGCAAGGAAGGAAATTGCTCTTTGGTTCCCCGAAGGAGTTGCAGAGTGGCAGAGCAGCCTTCACTCTTGGATCTATGAGTAG; SEQ. ID NO.1.

[0029] The NtNDPK2 protein sequence is shown in SEQ ID NO.2.

[0030] SEQ ID NO.2.

[0031] The promoter sequence is shown in SEQ ID NO.3.

[0032]

[0033] Example 1: Gene Sequence Feature Analysis

[0034] Sequence alignment of the NtNDPK2 CDS was performed using the NCBI-BLAST website (http: / / www.ncbi.nlm.nih.gov / BLAST / ), retrieving 15 highly similar sequences. These sequences were translated into their corresponding protein sequences, and homology alignment was performed using MEGA 7.0. A phylogenetic tree was constructed using neighbor-joining. Protein sequence similarity was compared using DNAMAN 6.0. Results are shown below. Figure 1 .

[0035] Phylogenetic tree analysis ( Figure 1 A) It was found that NtNDPK2 is most closely related to NsNDPK1 (XP 009788779.1) of Tobacco Monopolysaccharide. Figure 1 A). Homologous protein sequence alignment ( Figure 1 B) It was found that this protein has a high homology with NsNDPK1 of Tobacco denudata and NaNDPK1 of Tobacco denudata. Figure 1 B).

[0036] Promoter cis-acting elements were predicted using PLANT CARE based on the promoter sequence approximately 2000 bp upstream of the NtNDPK2 start codon. Analysis revealed ( Figure 2 The NtNDPK2 promoter contains seven cis-acting elements, including a defense and stress responsiveness element, an auxin-responsive element, an abscisic acid responsive element (ABRE element), a low-temperature responsive LTR element, a jasmonic acid responsiveness element (MeJA element), and a MYB element. It is speculated that these elements may play an important role in the regulation of tobacco cold tolerance by NtNDPK2.

[0037] Example 2: Functional identification of the tobacco NtNDPK2 gene

[0038] (I) Construction of gene editing vectors

[0039] 1) Based on the provided sequence information and sequence alignment results, and in conjunction with the target site design website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR, design two CRISPR target sites, Target 1 and Target 2. The specific target site sequences are as follows:

[0040] Target 1: CTGCTAAGCCTTTCTTTAGT; SEQ ID NO.4;

[0041] Target 2: TCTGCTCCTGGTACAATCCG; SEQ ID NO.5.

[0042] 2) Synthesize the target fragment

[0043] The target fragment shown in SEQ ID NO.6 was synthesized by Tianyi Huiyuan Biotechnology Co., Ltd.

[0044] TTCGATTCCCGGCTGGTGCACTGCTAAGCCTTTCTTTAGTgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcAA CAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCATCTGCTCCTGGTACAATCCGgttttagagctagaaatagc; SEQ ID NO.6.

[0045] In SEQ ID NO.6, 1-20bp are homologous arms on the vector, 21-40bp are the Target 1 sequence, 41-116bp are the gRNA scaffold, 117-193bp are the TRNA sequence, 194-213bp are the Target 2 sequence, and 214-233bp are homologous arms on the vector.

[0046] 3) Recombination of target fragment and final vector

[0047] (1) The target fragment obtained in step 2) and the linearized vector pKSE401 purified by KpnI digestion were added to the recombinant system at a molar ratio of 2:1 (Novizan, The reaction is carried out using the IIOne Step Cloning Kit. Please refer to the instruction manual for specific methods.

[0048] (2) Add 1 μL of homologous recombination ligation product to 20 μL of Escherichia coli chemically competent cells for transformation, plate on Km resistance plate, and incubate overnight at 37°C.

[0049] (3) Selecting positive clones

[0050] Select single clones for colony PCR or culture PCR. Primer sequences are as follows:

[0051] U6-261DF:TGTCCCAGGATTAGAATGATTAGGC; SEQ ID NO.7;

[0052] DNPK2-inf-T2as:

[0053] TTCTAGCTCTAAAACCGGATTGTACCAGGAGCAGA; SEQ ID NO.8.

[0054] PCR system: 2 μL of bacterial culture (single colony picked into 500 μL of Km resistant LB), 2 μL of 10× Buffer, 2 μL of dNTP xiture (2 mM), 0.3 μL of U6-261DF (10 μM), 0.3 μL of DNPK2-inf-T2as (10 μM), 0.2 μL of Taq (5 U / μL), and up to 20 μL of ddH2O.

[0055] PCR program: 98℃ for 3 min; 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 30 sec; 72℃ for 8 min; 25℃ for 1 min.

[0056] Then, after identifying positive clones using 1% agarose gel electrophoresis, the shaken bacterial culture (200 μL) was sent to a sequencing company for verification.

[0057] 4) Extract plasmid pKSE401-NtNDPK2

[0058] Add correctly sequenced and complete clones to 5-10 ml of LB medium containing Km in an Erlenmeyer flask and incubate overnight at 37°C with a shaker at 200 rpm. Take 500 μl of fresh bacterial culture and add an equal volume of sterilized 50% glycerol, store the E. coli culture at -80°C, and extract plasmids from the remaining bacterial culture using a plasmid extraction kit (FastPure EndoFree Plasmid Mini Kit-Box2, catalog number DC203-01).

[0059] (II) Genetic transformation of tobacco

[0060] (1) Preparation of Agrobacterium

[0061] Add 1 μL of plasmid to 50 μL of GV3101 Agrobacterium competent cells (refer to the manufacturer's instructions for specific methods). Transform and plate onto LB agar plates containing 50 μg / mL kanamycin resistance, incubate at 28°C for 48 h, and perform colony PCR identification. The amplification primers, reaction system, and reaction procedure are the same as above. Detect the PCR products by gel electrophoresis. If the electrophoretic bands of the positive control (using the correctly sequenced plasmid as a template) and the sample are clear and of the correct size, and the negative control (using water as a template) shows no band, it indicates that the sample can proceed to the next step and can be used to infect tobacco.

[0062] Single colonies were selected and cultured in liquid LB medium containing 25 μg / mL rifampicin and 100 μg / mL kanamycin. The culture was incubated at 28°C for 24 h with shaking. The culture was then centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the culture was resuspended in a immersion buffer (containing 10 mM MgCl2, pH 5.2, 10 mM 2-(N-morpholine)ethanesulfonic acid (MES), and 0.1 mM acetylsylphenone) and incubated at room temperature for at least 3 h until OD500 was reached. 600 The value is approximately 0.6, which is used as a pre-treatment solution.

[0063] (2) Genetic transformation

[0064] Plump and uniform "Xiangyan No. 7" tobacco seeds were disinfected with 10% sodium hypochlorite solution for 15 minutes, rinsed 5 times with sterile water, and slightly dried with sterile absorbent paper. Four seeds per bottle were sown on MS medium containing 30 g / L sucrose and 8 g / L agar (pH 5.8). The incubator was placed at 25℃ under constant temperature and light conditions of 1600 lx light intensity and a photoperiod of 16 h (light) / 8 h (dark) for 45 days. After the sterile seedlings developed 4 leaves, they were cut into small pieces of approximately 5 mm x 5 mm, and the veins were removed. After pre-culturing on MS medium containing 2 mg / L 6-BA and 0.2 mg / L IAA for 2 days, the explants were soaked in Agrobacterium infection solution. The infected explants were then cultured in the dark on MS medium containing 2 mg / L 6-BA and 0.2 mg / L IAA for 2 days. After co-culturing, 50 mg / L kanamycin and 500 mg / L carbenicillin were added to the culture medium for selection to induce the production of resistant callus. The culture conditions were the same as above, and subcultures were performed every 14 days. When the resistant shoots on the callus grew to 2 cm, the shoots were transferred to rooting medium (MS + 50 mg / L kanamycin + 500 mg / L carbenicillin + 0.2 mg / L IAA). Rooting occurred in about 7 days. When the seedlings grew to about 6 cm, the mouths of the culture bottles were opened for hardening off for 2 days. Then, the seedlings were transplanted into high-temperature sterilized tobacco-specific substrate (Hunan Tianliang Agricultural Technology Development Co., Ltd.), covered with plastic film to retain moisture, and cultured under light at 25–27℃.

[0065] (III) Sequencing analysis of positive seedlings

[0066] Cut leaves from sterile rooted tissue culture seedlings and use... Plant DNA Isolation Mini Kit (Nanjing Novizan, catalog number: DC104-01) was used to extract total DNA. Detailed instructions were provided in the product manual. The knockout material was amplified by PCR using PrimeSTAR Max DNA Polymerase, a high-fidelity enzyme from Bio-Tech (Beijing) Co., Ltd.

[0067] Primer sequence information is as follows:

[0068] NDPK2-crispr-F:GACCCACTCAGTGTTGATGTTG; SEQ ID NO.9;

[0069] NDPK2-crispr-R:TCTGCCACTCTGCAACTCCT; SEQ ID NO. 10.

[0070] Fragment length: 787bp.

[0071] The PCR procedure is shown in Table 1, and the reaction system is shown in Table 2.

[0072] Table 1 PCR Procedure

[0073]

[0074] Table 2 PCR reaction system

[0075]

[0076] Sequencing analysis was performed on 30 gene-edited positive seedlings, from which two successfully edited gene knockout lines, ndpk2-2 and ndpk2-15, were screened. ndpk2-2 had a 4-base deletion at target site 2, and ndpk2-15 had a 2-base deletion at target site 2. Figure 3 A), and the peaks near the target point all show clean single peaks ( Figure 3 B). Protein sequence analysis revealed premature translation termination of this protein in the ndpk2-2 strain, and a disordered sequence of amino acids 101-147 in the ndpk2-15 strain, with this sequence located within the NDPK domain, resulting in loss of function. Figure 3 C).

[0077] (iv) Identification of cold tolerance in knockout strains

[0078] Wild-type and knockout line seeds were cleaned, disinfected, and then subjected to low-temperature treatment at 4℃ for 48 hours. They were then sown on the substrate and cultured in an artificial climate chamber (temperature 25℃, relative humidity 75%, light / dark = 16h / 8h) for 30 days before further treatment.

[0079] Low-temperature simulation experiment using an incubator: A Rumed constant-temperature and light incubator (Germany) was used, with a temperature of 4℃, a photoperiod of 16h / 8h light / dark, and a relative humidity of 60% to subject tobacco seedlings to low-temperature stress. At 0h and 24h of treatment, the third leaf from the bottom of the plant was taken, the main vein was removed, and 0.2g of leaf sample was accurately weighed, quickly wrapped in aluminum foil, and flash-frozen in liquid nitrogen, then stored at -80℃. Five biological replicates were set up for each treatment for physiological and biochemical assays. The 25℃ treatment served as the control (CK).

[0080] Results of cold tolerance phenotype identification of knockout strains are shown in Figure 4 .like Figure 4 As shown, 4℃ low temperature stress for 4 hours caused tobacco leaves to wilt due to water loss, and the two knockout lines were significantly more wilted than the wild type, indicating that the low temperature tolerance of tobacco with this gene knocked out was significantly reduced.

[0081] Subsequently, tobacco leaves treated at 4℃ for 24 h were stained with NBT and DAB, such as... Figure 5 As shown, the staining intensity of both knockout lines under low temperature stress was deeper than that of WT, indicating that the knockout lines accumulated more superoxide anions and hydrogen peroxide (H2O2) than WT.

[0082] (V) Determination of physiological and biochemical indicators of knockout strains

[0083] Conductivity: Take 0.2g of fresh leaf tissue from the fourth true leaf of the seedling (counting downwards from the top leaf) using a round punch, place it in a centrifuge tube containing 25ml of ddH2O, and treat on a shaker at 37℃ for 24h. Measure the conductivity L1 of the first extravasation. Then, place the EP tube in an autoclave at 120℃ for 15 minutes. After cooling to room temperature, measure the conductivity L2 of the second extravasation. Calculate the relative conductivity content (EL = L1 / L2 * 100%).

[0084] Malondialdehyde (MDA) content was determined using a plant-based MDA test kit (Nanjing Jiancheng, catalog number: A003-3-1); hydrogen peroxide (H2O2) content was determined using a hydrogen peroxide test kit (Nanjing Jiancheng, catalog number: A064-1-1); superoxide dismutase (SOD) and peroxidase (POD) activities were determined using SOD (Nanjing Jiancheng, catalog number: A001-3) and POD activity assay kits (Nanjing Jiancheng, catalog number: A084-3-1), respectively; total protein (TP) content was determined using the Coomassie Brilliant Blue method with a protein quantification (TP) kit (Nanjing Jiancheng, catalog number: A045-2).

[0085] Physiological and biochemical results are shown in Figure 6 ; Figure 6 The results showed that the contents of EL, MDA, and H2O2 in ndpk2-2 and ndpk2-15 were significantly higher than those in WT under low-temperature stress; while the activities of SOD and POD and the contents of TP were significantly lower than those in WT. These results indicate that knocking out the NtNDPK2 gene leads to increased ROS content, decreased antioxidant enzyme activity, and exacerbated membrane lipid peroxidation in tobacco, ultimately resulting in reduced cold tolerance.

[0086] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of the NtNDPK2 gene in tobacco cold tolerance, characterized in that, The NtNDPK2 gene sequence is shown in SEQ ID NO.

1.

2. The application of NtNDPK2 gene knockout in the negative regulation of tobacco cold tolerance, characterized in that, The NtNDPK2 gene sequence is shown in SEQ ID NO.

1.

3. The application of biomaterials with NtNDPK2 gene knockout in the negative regulation of tobacco cold tolerance, characterized in that, The NtNDPK2 gene sequence is shown in SEQ ID NO.1; The biomaterial is any one of the following: A: An expression cassette capable of silencing the NtNDPK2 gene with a nucleotide sequence as shown in SEQ ID NO.1; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

4. The application of the NtNDPK2 gene in tobacco breeding, characterized by, The NtNDPK2 gene sequence is shown in SEQ ID NO.

1.

5. The application of the NtNDPK2 gene in the breeding of cold-resistant tobacco germplasm, characterized in that, The NtNDPK2 gene sequence is shown in SEQ ID NO.1.