Primer combination and kit for detecting HIV-1 (human immunodeficiency virus-1) and application of primer combination and kit
By designing a three-target primer combination of Vif/Vpr/Env and applying real-time PCR, the problems of incomplete HIV-1 subtype coverage and detection of very early low-load samples were solved, achieving simultaneous detection of multiple subtypes with high sensitivity and high specificity.
Patent Information
- Application Number
- CN202511968350.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-24
- Publication Date
- 2026-03-03
AI Technical Summary
Existing detection technologies do not fully cover HIV-1 subtypes, especially recombinant subtypes such as CRF01_AE and CRF07_BC, and are difficult to detect in very early low viral load samples. Existing technologies have low sensitivity and poor specificity.
A primer combination targeting three targets (Vif/Vpr/Env) was designed, structurally optimized, and labeled with fluorescent reporter and fluorescent quencher groups for quantitative real-time PCR detection of HIV-1, enabling simultaneous detection of multiple subtypes.
It improves the sensitivity and specificity of detection, can identify multiple HIV-1 subtypes, shortens the detection time, reduces the false negative rate, and reduces the cost of consumables and reagents.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a primer combination, kit for detecting HIV-1, and its application. Background Technology
[0002] Human immunodeficiency virus type 1 (HIV-1) is the core pathogen causing AIDS, with over 39.3 million people infected globally (WHO 2024 data). From a clinical perspective, existing testing technologies need to address two major pain points: firstly, incomplete subtype coverage (such as missed detection of recombinant subtypes like CRF01_AE and CRF07_BC); and secondly, difficulty in detecting very early low viral load samples (viral load <50 copies / mL within 7 days of infection). Therefore, there is an urgent need for a reagent with higher sensitivity and more comprehensive subtype coverage that can be effectively used to detect HIV-1. Summary of the Invention
[0003] This invention aims to address at least one of the technical problems existing in the prior art. To this end, this invention proposes a primer combination for detecting HIV-1.
[0004] The present invention also provides reagents comprising the above-described primer combinations.
[0005] The present invention also provides a kit comprising the above-described primer combinations or reagents.
[0006] The present invention also provides applications of the above primer combinations, reagents or kits.
[0007] The present invention also provides a method for detecting whether a sample to be tested is or contains HIV-1 for non-disease diagnostic purposes.
[0008] The present invention also provides a system.
[0009] According to a first aspect of the present invention, a primer combination for detecting HIV-1 includes at least one of primer set 1, primer set 2, and primer set 3; The primer set 1 includes an upstream primer with a nucleic acid sequence as shown in SEQ ID NO: 1 and a downstream primer with a nucleic acid sequence as shown in SEQ ID NO: 2; The primer set 2 includes an upstream primer with a nucleic acid sequence as shown in SEQ ID NO: 5 and a downstream primer with a nucleic acid sequence as shown in SEQ ID NO: 6; The primer set 3 includes an upstream primer with a nucleic acid sequence as shown in SEQ ID NO: 9 and a downstream primer with a nucleic acid sequence as shown in SEQ ID NO: 10.
[0010] The primer combination of the present invention is obtained through sequence design, structural optimization and synergistic application design of Vif / Vpr / Env three-target primers, which completely overcomes the shortcomings of the existing technology of "incomplete coverage, low sensitivity and poor specificity", and has irreplaceable application value in clinical diagnosis and HIV-1 virus detection of cell therapy products.
[0011] A reagent according to a second aspect of the present invention comprises the primer combination described in the first aspect embodiment. Since the reagent employs all the technical solutions of the primer combinations described above, it possesses at least all the beneficial effects brought about by the technical solutions of the above embodiments.
[0012] According to some embodiments of the present invention, primer set 1, primer set 2, and primer set 3 each independently include a probe.
[0013] According to some embodiments of the present invention, the nucleic acid sequence of the probe of primer set 1 is shown in SEQ ID NO: 14.
[0014] According to some embodiments of the present invention, the nucleic acid sequence of the probe of primer set 2 is shown in SEQ ID NO: 15.
[0015] According to some embodiments of the present invention, the nucleic acid sequence of the probe of primer set 3 is shown in SEQ ID NO: 16.
[0016] According to some embodiments of the present invention, the probe sequences in primer sets 1, 2, and 3 are labeled with a fluorescent reporter group and a fluorescent quencher group at both ends, respectively.
[0017] According to some embodiments of the present invention, the probe sequences in primer set 1, primer set 2, and primer set 3 are respectively labeled with different fluorescent reporter groups.
[0018] According to some embodiments of the present invention, the fluorescent reporter group is selected from FAM, JOE, VIC, HEX, ROX, CY3 or CY5; the fluorescent quencher group is selected from BHQ1, BHQ2, TAMRA or MGB.
[0019] According to some embodiments of the present invention, the reagent further includes a PCR reaction solution.
[0020] According to some embodiments of the present invention, the PCR reaction solution further includes at least one of calcium ions, buffer, dNTPs, and Taq enzyme.
[0021] According to some embodiments of the present invention, the PCR reaction solution comprises 2×ArtiCan ATM SYBR qPCR Mix.
[0022] A reagent kit according to a third aspect of the present invention includes the primer combination described in the first aspect embodiment or the reagent described in the second aspect embodiment. Since the reagent employs all the technical solutions of the primer combinations described in the above embodiments, it possesses at least all the beneficial effects brought about by the technical solutions of the above embodiments.
[0023] The kit provided by this invention can be used for early diagnosis of HIV-1 infection in clinical settings, monitoring of mother-to-child transmission of HIV-1, evaluation of the efficacy of antiviral treatment for HIV-1 infected individuals, and quality testing of cell banks in cell therapy products.
[0024] According to some embodiments of the present invention, the kit further includes PCR reaction solution.
[0025] According to some embodiments of the present invention, the PCR reaction solution further includes at least one of calcium ions, buffer, dNTPs, and Taq enzyme.
[0026] According to some embodiments of the present invention, the PCR reaction solution comprises 2×ArtiCan ATM SYBR qPCR Mix.
[0027] Application of the primer combination described in the first aspect embodiment, the reagent described in the second aspect embodiment, or the kit described in the third aspect embodiment according to the fourth aspect embodiment of the present invention in any one of A1)-A8): A1) Testing or auxiliary testing for HIV-1 not for disease diagnosis purposes; A2) Prepare products for detecting or assisting in the detection of HIV-1; A3) Testing or auxiliary testing of the Vif gene for purposes other than disease diagnosis; A4) Prepare products for detecting or assisting in the detection of Vif genes; A5) Testing or auxiliary testing of the Vpr gene for purposes other than disease diagnosis; A6) Prepare products for detecting or assisting in the detection of the Vpr gene; A7) Testing or auxiliary testing of the Env gene for purposes other than disease diagnosis; A8) Prepare products for detecting or assisting in the detection of the Env gene.
[0028] According to some embodiments of the present invention, the product is selected from kits or chips.
[0029] According to some embodiments of the present invention, the method of using the product includes the following steps: The nucleic acid molecules of the sample to be tested are detected using the primer combination described in the first aspect embodiment or the kit described in the second aspect embodiment.
[0030] According to a fifth aspect of the present invention, a method for detecting whether a sample is or contains HIV-1 for non-disease diagnostic purposes is used, employing the primer combination described in the first aspect embodiment, the reagent described in the second aspect embodiment, or the kit described in the third aspect embodiment.
[0031] According to some embodiments of the present invention, the method includes the following steps: Using the nucleic acid of the sample to be tested as a template, an amplification reaction is performed using the primer combination described in the first aspect embodiment, the reagent described in the second aspect embodiment, or the kit described in the third aspect embodiment. The amplification results are used to determine whether the sample to be tested is or contains HIV-1.
[0032] According to some embodiments of the present invention, the amplification reaction is a real-time quantitative PCR amplification reaction.
[0033] According to some embodiments of the present invention, the reaction system of the real-time PCR reaction includes: 0.3-0.7 μM upstream primer; 0.3-0.7 μM downstream primer; and 20-100 ng of nucleic acid molecules from the sample to be tested.
[0034] According to some embodiments of the present invention, the amplification program of the real-time PCR reaction is as follows: pre-denaturation at 48-52℃ for 1-3 min; pre-denaturation at 94-96℃ for 1-3 min; denaturation at 94-96℃ for 10-30 s, annealing at 50-60℃ for 20-40 s, extension at 65-75℃ for 20-30 s, for 35-45 cycles, and fluorescence data is collected.
[0035] According to some embodiments of the present invention, the amplification program of the real-time PCR reaction is as follows: pre-denaturation at 50℃ for 2 min; pre-denaturation at 95℃ for 2 min; denaturation at 95℃ for 15 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, 40 cycles, and fluorescence data are collected.
[0036] According to some embodiments of the present invention, the evaluation criteria for determining whether the sample to be tested is or contains HIV-1 based on the amplification results include: When the Ct value is UNDET or >40, it indicates that the sample being tested is not or does not contain HIV-1. When the Ct value is 38-40, it indicates that a retest is needed. If the Ct value is still 38-40, it indicates that the sample to be tested is not or does not contain HIV-1. When the Ct value is ≤38, it indicates that the sample to be tested is or contains HIV-1.
[0037] A system according to a sixth aspect of the present invention includes: Detection module: used to amplify the nucleic acid molecules of the sample to be tested using the primer combination described in the first aspect embodiment, the reagent described in the second aspect embodiment, or the kit described in the third aspect embodiment; Analysis module: Used to evaluate whether the sample to be tested is or contains HIV-1 based on the amplification results.
[0038] The primer combinations according to embodiments of the present invention have at least the following beneficial effects: The primer combination in this example is characterized by high sensitivity and high specificity, and can be used for the specific detection of HIV-1.
[0039] In current clinical testing, HIV-1 samples often require simultaneous verification of viral presence, quantitative viral load, and even subtype differentiation. This invention, by utilizing the provided primer combination, requires a smaller sample volume and can be applied to various globally prevalent HIV-1 subtypes (such as type B, type C, and AE recombinant types), achieving "one tube for multiple subtypes." It eliminates the need for prior identification of viral subtypes, significantly improving the detection rate of HIV-1 variants and reducing false negatives. The detection efficiency is high, allowing simultaneous detection of three targets in a single tube, eliminating the need for three separate singleton PCRs, reducing consumable and reagent costs, and shortening the detection time from 3-4 hours to 1-2 hours.
[0040] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the invention. Attached Figure Description
[0041] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 This is a melting curve of primer set 1 used to detect the Vif gene in an embodiment of the present invention; Figure 2 This is a melting curve of primer set 1 used to detect the Vpr gene in an embodiment of the present invention; Figure 3 This is a melting curve of the primer set used to detect the Env gene in an embodiment of the present invention; Figure 4 This is a melting curve of primer set 2 used to detect the Vif gene in an embodiment of the present invention; Figure 5 This is a melting curve of primer set 2 used to detect the Vpr gene in an embodiment of the present invention; Detailed Implementation The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0042] Experimental reagents: 2×ArtiCan ATM The SYBR qPCR Mix was purchased from Beijing Qingke Biotechnology Co., Ltd., product number: DLQ102; HIV-1 quantitative standard, synthesized by Beijing Qingke Biotechnology Co., Ltd., catalog number: N / A; Buffer TE was purchased from Tiangen Biotech (Beijing) Co., Ltd., item number: DP304; The Staphylococcus aureus standard strain was purchased from Wenzhou Weiqiong Microbial Technology Co., Ltd., product number: TC-16005; Mycoplasma pneumoniae was purchased from Huzhou Shenke Biotechnology Co., Ltd., product number: 1501503; JCV quantitative standard (5×10) 5 (copies / ml) were purchased from Beijing Xin Nuomeidi Gene Testing Technology Co., Ltd.; HIV-1 subtype A, HIV-1 subtype B, HIV-1 subtype C, HIV-1 subtype CRF01_AE, and HIV-1 subtype CRF07_BC inactivated viral nucleic acid standards were purchased from Jingliang Technology (Shenzhen) Co., Ltd. The DNA of the human mesenchymal stem cells (Hu-MSC) comes from Yuanpin Cell Biotechnology Group Co., Ltd.
[0043] Example 1: Design of primer combinations for detecting HIV-1 virus This embodiment prepared a primer combination for detecting HIV-1 virus. The specific design and verification process is as follows: 1. Primer combination design Based on the complete genome sequence of HIV-1 strain D86068.1, this invention designs specific primers targeting three gene sequences: Vif, Vpr, and Env. The primers were structurally optimized (length 19-24 bp, ΔG > -5 kcal / mol, no consecutive complementary bases at the 3' end) to avoid non-specific amplification and primer dimer formation. Simultaneously, BLAST alignment was used to ensure that the primers had <5% homology with other viral genomes and <3% homology with the human genome, avoiding cross-reactions and ensuring high specificity. Furthermore, the PCR product length of all primers was controlled below 200 bp; short fragments reduce the impact of RNA template degradation on amplification, significantly improving the detection success rate of low-load samples. Finally, primer sets 1, 2, 1, 2, and 2 for detecting the Vif, Vpr, and Env genes were obtained. The primer set sequences are shown in Table 1.
[0044] Table 1
[0045] 2. Optimization of primer sets within primer sets Using the primer sets designed in step 1 (primer set 1 for detecting the Vif gene, primer set 1 for detecting the Vpr gene, and primer set 2 for detecting the Env gene), primer set 2 for detecting the Vif gene, and primer set 2 for detecting the Vpr gene, experiments were conducted to screen out the optimal primer set.
[0046] Synthesis of standard plasmids: Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize recombinant plasmids containing HIV-1 target gene fragments (Vif, Vpr, Env) (the Vif, Vpr, and Env target gene fragments were cloned into the same pUC57 plasmid vector).
[0047] Vif target fragment (5'→3') GACCAACTAATTCATCTGTATTACTTTGACTGTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGGACATAAC (SEQ ID NO: 11).
[0048] Vpr target segment (5'→3'): AGACCAAGGGCCACAGAGGGAGCCACACAATGAATGGACACTAGAGCTTTTAGAGGAGCT (SEQ ID NO: 12).
[0049] Env target segment (5'→3'): TTGCTGAGGGCTATTGAGGCACAATTTGCTGAGGGCTATTGAGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTA (SEQ ID NO: 13).
[0050] The preparation steps of the detection template are as follows: 4 μg of standard plasmid was reconstituted with 1 ml of Buffer TE to obtain an initial concentration of 1.2 × 10⁻⁶. 12 Quantitative standards were prepared at a concentration of 1.2 × 10⁻⁶ copies / mL. The quantitative standards were serially diluted with Buffer TE to obtain a concentration of 1.2 × 10⁻⁶. 11 copies / mL, concentration of 1.2 × 10 10 Quantitative standards in copies / mL.
[0051] Real-time PCR reaction system and procedure: Real-time PCR reaction system: Total reaction volume 10 μL, 2× ArtiCan ATM 5 μL of SYBR qPCR Mix, 0.5 μL of upstream primer (10 μM), 0.5 μL of downstream primer (10 μM), and 4 μL of sample DNA were used. The final concentration of each primer was 0.5 μM. The same template was used for replicate reactions, and all reactions were performed on a LightCycler 480 real-time PCR instrument.
[0052] Real-time quantitative PCR reaction program 1: 50℃ pre-denaturation for 2 min; 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 40 cycles, fluorescence signal acquisition at 72℃.
[0053] Real-time quantitative PCR reaction program 2: 50℃ pre-denaturation for 2 min; 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 60℃ annealing and extension for 30 s, 40 cycles, fluorescence signal acquisition at 60℃.
[0054] Primer set 1 for detecting the Vif gene, primer set 1 for detecting the Vpr gene, and primer set 2 for detecting the Env gene were used in the above-described quantitative real-time PCR reaction system, following the above-described real-time quantitative PCR reaction program 1 and the above-described detection template. Primer set 2 for detecting the Vif gene and primer set 2 for detecting the Vpr gene were used in the above-described quantitative real-time PCR reaction system, following the above-described real-time quantitative PCR reaction program 1, to detect the 2.59×10⁻⁶ primer purchased from Jingliang Technology Co., Ltd. 6 Copies / mL of nucleic acid reference material were reverse transcribed using a gold-standard reverse transcription kit (Beijing Qingke) to obtain cDNA for PCR detection.
[0055] The results of primer screening are as follows Figure 1-5 As shown, the melting curves of primer sets 1 (for detecting the Vif gene), 1 (for detecting the Vpr gene), and 1 (for detecting the Env gene) all exhibit single peaks, indicating the absence of primer dimers and non-specific amplification. Primer sets 2 (for detecting the Vif gene) and 2 (for detecting the Vpr gene) show no CT values and no peaks in their melting curves, indicating they are unsuitable for detecting HIV-1. Therefore, primer sets 1 (for detecting the Vif gene), 1 (for detecting the Vpr gene), and 1 (for detecting the Env gene) were selected for subsequent experiments.
[0056] Example 2 Primer and probe set for detecting HIV-1 virus This embodiment provides primer and probe sets for detecting HIV-1 virus, specifically primer and probe sets for detecting the Vif gene, the Vpr gene, and the Env gene, with specific sequences shown in Table 2 below.
[0057] Table 2
[0058] Example 3: A kit for detecting HIV-1 This embodiment provides a kit for detecting HIV-1, which contains primer set 1 for detecting the Vif gene prepared in Example 1 at a concentration of 10 μM, primer set 1 for detecting the Vpr gene prepared in Example 1 at a concentration of 10 μM, and / or primer set for detecting the Env gene prepared in Example 1 at a concentration of 10 μM, a negative control, and a positive control.
[0059] The negative control was water.
[0060] The positive control is the standard plasmid prepared in Example 1.
[0061] The kit is used as follows: Using the above kit, the sample to be tested is amplified using the following real-time PCR reaction system and procedure.
[0062] Real-time PCR reaction system and procedure: Real-time PCR reaction system: Total reaction volume 10 μL, 2× ArtiCan ATM 5 μL of SYBR qPCR Mix, 0.5 μL of upstream primer (10 μM), 0.5 μL of downstream primer (10 μM), and 4 μL of sample DNA were used. The final concentration of each primer was 0.5 μM. The same template was used for replicate reactions, and all reactions were performed on a LightCycler 480 real-time PCR instrument.
[0063] Real-time quantitative PCR reaction program 1: 50℃ pre-denaturation for 2 min; 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 40 cycles, fluorescence signal acquisition at 72℃.
[0064] The criteria for determining the results are shown in Table 3.
[0065] Table 3
[0066] Example 4 Sensitivity Detection The standard plasmid gradient template was detected using the kit prepared in Example 3 and the method of using the kit.
[0067] Preparation of standard plasmid gradient template: 4 μg of vector was reconstituted with 1 mL of Buffer TE to obtain an initial concentration of 1.2 × 10⁻⁶. 12 Quantitative standards were prepared in copies / mL. The quantitative standards were diluted with Buffer TE according to Table 4.
[0068] Table 4 Dilution of Quantitative Standards
[0069] Table 5. Detection results of positive control samples at different concentrations
[0070] The test results are shown in Table 5. It can be seen from the table that, according to the aforementioned positive test result judgment criteria, the detection limit of the three primer pairs of the present invention for HIV-1 virus is 3 copies / mL.
[0071] Example 5 Specificity Detection Using the kit prepared in Example 3 and the method of using the kit, specific detection was performed using nucleic acid molecules of human MSCs, Staphylococcus aureus, Mycoplasma pneumoniae, JCV virus samples, HIV-1 subtype A, HIV-1 subtype B, HIV-1 subtype C, HIV-1 subtype CRF01_AE, and HIV-1 subtype CRF07_BC as templates.
[0072] The experimental steps are as follows: (1) Nucleic acid extraction from the sample to be tested (Tiangen DP304 kit): 1) Take 1.2 × 10 6 For a cell sample / 200 μL cell-free sample, add 200 μL of buffer GA and vortex until completely resuspended; 2) Add 20 μL of Proteinase K solution and mix well; 3) Add 200 μL of buffer GB, mix thoroughly by inverting, incubate at 70°C for 10 min, the solution should become clear, and then centrifuge briefly; 4) Add 200 μL of anhydrous ethanol, shake well for 15 seconds, and centrifuge briefly; 5) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (place the adsorption column in the collection tube), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid; 6) Add 500 μL of buffer GD to the adsorption column CB3 (make sure anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid; 7) Add 600 μL of washing buffer PW to the adsorption column CB3 (make sure anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid; 8) Repeat step 7). 9) Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the waste liquid, and place the adsorption column CB3 at room temperature for 5 minutes. 10) Transfer the CB3 adsorption column to a clean centrifuge tube. Add 50 μL of elution buffer TE to the center of the adsorption membrane. Incubate at room temperature for 2-5 min, then centrifuge at 12,000 rpm for 2 min. Collect the solution in the centrifuge tube. Determine the nucleic acid concentration of the sample using a micro spectrophotometer. Take 100 ng of nucleic acid for subsequent detection.
[0073] Human mesenchymal stem cells (Hu-MSC), Staphylococcus aureus, Mycoplasma pneumoniae, JCV virus (nucleic acid standard from a commercially available kit from Beijing Xin Nuomeidi Gene Detection Technology Co., Ltd.), HIV-1 subtype A, HIV-1 subtype B, HIV-1 subtype C, HIV-1 subtype CRF01_AE, and HIV-1 subtype CRF07_BC were used as templates for detection using these three pairs of primers.
[0074] (2) Real-time PCR reaction system and procedure Total reaction volume 10 μL, 2× ArtiCan ATM 5 μL of SYBR qPCR Mix, 0.5 μL of upstream primer (10 μM), 0.5 μL of downstream primer (10 μM), and 4 μL of sample DNA were used. The final concentration of each primer was 0.5 μM. The same template was used for replicate reactions, and all reactions were performed on a LightCycler 480 real-time PCR instrument.
[0075] The reaction procedure for real-time quantitative PCR is as follows: pre-denaturation at 50℃ for 2 min; pre-denaturation at 95℃ for 2 min; denaturation at 95℃ for 15 s; annealing and extension at 60℃ for 30 s; 40 cycles; fluorescence signal acquisition at 60℃.
[0076] Table 6 Results of primer specificity detection for the three sets of primers
[0077] The experimental results are shown in Table 6. As can be seen from the table, these three sets of primers have good specificity and can identify different subtypes of HIV-1 virus, but cannot identify other species.
[0078] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. A primer combination for detecting HIV-1, characterized in that, Includes at least one of primer set 1, primer set 2, and primer set 3; The primer set 1 includes an upstream primer with a nucleic acid sequence as shown in SEQ ID NO: 1 and a downstream primer with a nucleic acid sequence as shown in SEQ ID NO: 2; The primer set 2 includes an upstream primer with a nucleic acid sequence as shown in SEQ ID NO: 5 and a downstream primer with a nucleic acid sequence as shown in SEQ ID NO: 6; The primer set 3 includes an upstream primer with a nucleic acid sequence as shown in SEQ ID NO: 9 and a downstream primer with a nucleic acid sequence as shown in SEQ ID NO:
10.
2. A reagent, characterized in that, Includes the primer combination described in claim 1.
3. The reagent according to claim 2, characterized in that, Primer set 1, primer set 2, and primer set 3 each independently include a probe; Preferably, the probe sequences in primer sets 1, 2, and 3 are each labeled with a fluorescent reporter group and a fluorescent quencher group at both ends, respectively; Preferably, the fluorescent reporter group is selected from FAM, JOE, VIC, HEX, ROX, CY3 or CY5; the fluorescent quencher group is selected from BHQ1, BHQ2, TAMRA or MGB.
4. A reagent kit, characterized in that, The kit contains the primer combination as described in claim 1 or the reagent as described in any one of claims 2-3.
5. The reagent kit according to claim 4, characterized in that, The reagents also include PCR reaction solution.
6. The use of the primer combination of claim 1, the reagent of any one of claims 2-3, or the kit of any one of claims 4-5 in any one of A1)-A8): A1) Testing or auxiliary testing for HIV-1 not for disease diagnosis purposes; A2) Prepare products for detecting or assisting in the detection of HIV-1; A3) Testing or auxiliary testing of the Vif gene for purposes other than disease diagnosis; A4) Prepare products for detecting or assisting in the detection of Vif genes; A5) Testing or auxiliary testing of the Vpr gene for purposes other than disease diagnosis; A6) Prepare products for detecting or assisting in the detection of the Vpr gene; A7) Testing or auxiliary testing of the Env gene for purposes other than disease diagnosis; A8) Prepare products for detecting or assisting in the detection of the Env gene.
7. The application according to claim 6, characterized in that, The product is selected from reagent kits or chips.
8. The application according to claim 6, characterized in that, The method of using the product includes the following steps: The nucleic acid molecules of the sample to be tested are detected using the primer combination as described in claim 1, the reagent as described in any one of claims 2-3, or the kit as described in any one of claims 4-5. Preferably, the reaction system of the real-time PCR reaction includes: 0.3-0.7 μM upstream primer; 0.3-0.7 μM downstream primer; and 20-100 ng of nucleic acid molecules from the sample to be tested.
9. A method for detecting whether a sample is or contains HIV-1 for non-disease diagnostic purposes, characterized in that, The method includes the following steps: The nucleic acid molecules of the sample to be tested are detected using the primer combination as described in claim 1, the reagent as described in any one of claims 2-3, or the kit as described in any one of claims 4-5.
10. A system, characterized in that, include: Detection module: used to amplify nucleic acid molecules of the sample to be tested using the primer combination as described in claim 1, the reagent as described in any one of claims 2-3, or the kit as described in any one of claims 4-5; Analysis module: Used to evaluate whether the sample to be tested is or contains HIV-1 based on the amplification results.