Transcription factor HbNAC47 related to saline-alkaline tolerance, and coding gene and application thereof
By cloning and overexpressing the HbNAC47 transcription factor gene of short-awned barley grass, the problem of salt tolerance in rice under high salinity and alkalinity conditions was solved, and the salt tolerance trait of rice was significantly improved.
Patent Information
- Application Number
- CN202610070088.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-20
- Publication Date
- 2026-03-06
AI Technical Summary
The lack of an effective transcription factor HbNAC47 gene in existing technologies limits the improvement of salt tolerance in crops such as rice under high salinity and alkalinity conditions. Traditional breeding methods are inefficient and rice has scarce genetic resources for salt tolerance.
The HbNAC47 transcription factor gene of short-awned barley grass was cloned and overexpressed, and a recombinant expression vector was constructed and transferred into rice. By regulating the expression of salt-alkali tolerance-related genes, the salt-alkali tolerance of rice was improved.
Overexpression of the HbNAC47 gene significantly enhanced the resistance of rice to salt-alkali stress and improved the growth performance of rice in saline-alkali environments.
Smart Images
Figure CN121609772A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a transcription factor HbNAC47 associated with salt and alkali tolerance, its encoding gene, and its applications. Background Technology
[0002] Soil salinization is one of the major abiotic stresses restricting global agricultural production, posing a serious threat to the growth, development, and yield of food crops such as rice. Developing new salt-tolerant rice varieties is a crucial strategic approach for the efficient development and utilization of saline-alkali land and the improvement of food production capacity. Traditional breeding methods suffer from drawbacks such as long cycles and low efficiency in improving crop salt tolerance. Furthermore, the relative scarcity of salt-tolerant genetic resources in rice itself further limits the practical application of this technology. With the rapid development of molecular biology techniques, cloning key stress-resistance genes through genetic engineering and applying them to crop genetic improvement has become a highly efficient and promising technical strategy.
[0003] NAC transcription factors are core regulatory elements in plant stress response signaling pathways. Their family members can synergistically regulate multiple stress response pathways, making them ideal targets for synergistic improvement of crop resistance. Current research largely focuses on endogenous NAC genes (such as SNAC1 and OsNAC2) in model plants like rice and Arabidopsis. While these genes can improve crop salt tolerance to some extent, their regulatory efficacy under combined high salt and high pH stress conditions is limited. Therefore, identifying novel NAC genes with superior functions from naturally salt-tolerant species has become an urgent need in the field of crop stress resistance genetic improvement.
[0004] Short-awned barley grass (Hordeum brevisubulatum), also known as wild barley, is a high-quality wild relative of cultivated barley. It possesses excellent palatability and high nutritional value, making it a superior salt-tolerant forage. Over its long evolutionary history, short-awned barley grass has developed unique mechanisms for sensing and adapting to salt stress, giving it significant economic and ecological value. However, its rich resources of stress-resistant genes, especially key transcription factor genes, have not been fully explored or effectively applied to the genetic improvement of crops such as rice.
[0005] To date, there are no publicly available technical reports concerning the cloning of the HbNAC47 transcription factor gene from short-awned barley grass, nor its application in enhancing the salt and alkali tolerance of rice. Therefore, there is an urgent need in the existing technology for a transcription factor HbNAC47 associated with salt and alkali tolerance, its encoding gene, and the application of this transcription factor or its encoding gene in the breeding of salt- and alkali-tolerant transgenic crops. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a transcription factor HbNAC47 associated with salt and alkali tolerance, its encoding gene and its application.
[0007] The objective of this invention is achieved through the following technical solution: a transcription factor HbNAC47 associated with salt and alkali tolerance, the amino acid sequence of which is shown in SEQ ID No.1.
[0008] The present invention also provides the encoding gene of the transcription factor HbNAC47, which is associated with the salt and alkali tolerance trait, and its nucleotide sequence is shown in SEQ ID No. 2.
[0009] The application of the transcription factor HbNAC47 or the encoding gene in the cultivation of salt-tolerant transgenic rice.
[0010] The present invention also provides recombinant expression vectors, expression cassettes or recombinant bacterial cells containing the encoding gene of the transcription factor HbNAC47, which is associated with the salt and alkali tolerance trait.
[0011] The present invention also provides the application of recombinant expression vectors, expression cassettes or recombinant bacterial cells encoding the transcription factor HbNAC47, which is associated with salt tolerance, in the cultivation of salt-tolerant transgenic rice.
[0012] The beneficial effects of this invention are: by overexpressing the HbNAC47 gene of short-awned barley grass, this invention regulates the expression of salt-tolerant genes, thereby obtaining salt-tolerant plants, which have great production and application value. Attached Figure Description
[0013] Figure 1 This is an agarose gel electrophoresis image of the PCR amplification product of the short-awned barley grass gene HbNAC47. Figure 2 This represents the expression level of the HbNAC47 gene in different tissues under salt-alkali stress conditions. Figure 3 This refers to the subcellular localization of the HbNAC47 protein in tobacco leaves. Figure 4 PCR detection results of HbNAC47 gene transgenic rice plants; where A represents the PCR detection results of OE#1-9 transgenic plants and B represents the PCR detection results of OE#10-18 transgenic plants. Figure 5 These are the experimental results of T3 generation HbNAC47 transgenic rice lines and wild-type rice under salt-alkali stress; Figure 6 This is an identification of the RNA level in rice overexpressing the HbNAC47 gene. Detailed Implementation
[0014] The present invention will now be described in detail with reference to the accompanying drawings.
[0015] Example 1: Cloning of the HbNAC47 gene in short-awned barley grass Seeds of *Barley grass* were collected at the Anda field experimental base (located at Zhangjiadian Andong 2nd Road, Wolitun Town, Anda City, Suihua City, Heilongjiang Province) and germinated in the laboratory. Leaves from two-leaf stage seedlings were selected as samples, and RNA was extracted from the samples using the Plant RNA Kit from Tiangen Biotech (Beijing) Co., Ltd., strictly following the instructions. RNA quality and concentration were detected by agarose gel electrophoresis and NanoDrop spectrophotometry. For RNA samples that met quality standards, the cDNA synthesis reaction system was prepared according to Table 1-1 using the TransScript One-Step gDNA Removal and cDNA Synthesis reagent from Beijing TransGen Biotech Co., Ltd., to reverse transcribe the RNA into cDNA.
[0016] Table 1-1 cDNA Synthesis Reaction System
[0017] Reaction conditions: 50 ℃ for 15 min, 85 ℃ for 5 s, 4 ℃ ∞.
[0018] Based on the HbNAC47 gene sequence annotated in the *Barley grass* transcriptome data, sequence alignment and analysis were performed using the NCBI website. Specific primers for this gene were designed using the software tool Primer 5.0 to amplify the *Barley grass* HbNAC47 gene. HbNAC47-clo-F: CTACTCATTCCGATTCCGTTCC, SEQ ID No. 3; HbNAC47-clo-R: TCCCTGCCTATCTGCCACA, SEQ ID No. 4.
[0019] Using cDNA as a template, PCR reaction was performed using KOD One™ PCR MasterMix reagent from Toyobo (Shanghai) Biotechnology Co., Ltd. The PCR reaction system for the cloned fragments was prepared according to Table 1-2, and the reaction procedure is shown in Table 1-3.
[0020] Table 1-2 PCR Reaction System
[0021] Table 1-3 PCR Reaction Procedure
[0022] The HbNAC47 gene was amplified by PCR using specific primers HbNAC47-clo-F and HbNAC47-clo-R. The PCR products were then detected by 1% agarose gel electrophoresis. The amplification results are shown below. Figure 1 As shown, the target DNA band is correctly positioned and sized. The PCR products were recovered using the OMEGA Gel Extraction Kit according to the manufacturer's instructions. The recovered products were ligated into the pMD19-T vector, and the ligation system is shown in Table 1-4.
[0023] Table 1-4 PMD-19-T Carrier Linkage System
[0024] Reaction conditions: 16℃, 1h Transform TOP10 competent cells using E. coli strain TOP10 (purchased from Shanghai Angyu Biotechnology Co., Ltd.). Follow the steps below to transform the ligation product: (1) Remove the Escherichia coli TOP10 competent cells from -80℃ and place them on ice to thaw slowly; (2) When the sensor is in a semi-melted state, add the ligation product and let it stand on ice for 30 min; (3) Heat shock in a 42℃ water bath for 60 seconds, remove and let stand on ice for 2 minutes; (4) Add 700µL of antibiotic-free liquid LB medium to a clean bench and incubate at 37℃ and 200rpm for 1h. (5) Place the bacterial solution at room temperature, centrifuge at 4000 r / min for 2 min, and take 700 μL of supernatant in a clean bench. Mix the remaining bacterial solution by suction and beating. (6) After coating, invert the plate and place it in a 37°C incubator overnight; (7) Pick three single colonies on LB solid medium and put them into 50 mL centrifuge tubes containing 5 mL of liquid LB (containing kanamycin antibiotics). Incubate at 37°C and 220 r / min for 12-16 hours with shaking.
[0025] The cultured bacterial culture was used as a template for identification and sent to Jilin Kumei Biotechnology Co., Ltd. for sequencing. Sequencing analysis verified the correctness of the inserted fragment. Sequencing results showed that the sequence was completely identical to SEQ ID NO: 1. The obtained HbNAC47 gene coding sequence was 1050 bp in length, encoding 350 amino acids, and contained typical NAC family domains. After successful sequencing, plasmid was extracted to obtain the pMD19-T-HbNAC47 recombinant plasmid.
[0026] Example 2: Spatiotemporal expression pattern analysis of HbNAC47 gene in short-awned barley grass under salt-alkali stress Short-awned barley grass seeds germinated to the two-leaf stage in a culture room. Seedlings were subjected to salt-alkali stress treatment with 200 mM NaHCO3 solution; the treatment time was set at five gradients: 0 h (CK), 3 h, 6 h, 12 h, and 24 h. Young leaves of the stressed plants were collected, and total RNA was extracted. Using the CYP2 gene as an internal control, the expression pattern of the HbNAC47 gene was analyzed by qRT-PCR using the TransStart® Probe qPCR SuperMix kit. The real-time quantitative PCR reaction system is shown in Table 2-1, and the real-time quantitative PCR reaction program is shown in Table 2-2. 2 -ΔΔct The relative expression levels of genes were calculated using this method. The results are as follows: Figure 2 As shown, HbNAC47 is expressed in both roots and leaves, but the expression level in roots is significantly higher than in leaves, while the expression level in leaves is relatively low. RT-qPCR and transcriptome data showed a high degree of consistency in expression patterns, further validating the reliability of the experimental results. The primers used are as follows: CYP2-F:CCTGTCGTGTCGTCGGTCTAAA, SEQ ID No.5; CYP2-R:ACGCAGATCCAGCAGCCTAAAG, SEQ ID No.6; HbNAC47-qF:GCTGGATGACTGGTGCTGTGT, SEQ ID No.7; HbNAC47-qR:GGTGTGGTTGTTCTGCGAGTCC, SEQ ID No. 8.
[0027] Table 2-1 Real-time quantitative PCR reaction system
[0028] Table 2-2 Real-time quantitative PCR reaction program
[0029] Example 3: Subcellular localization experiment of HbNAC47 gene 1. Subcloning was performed using the pMD19-T-HbNAC47 recombinant plasmid (obtained in Example 1) as a template.
[0030] Using the correctly sequenced positive clone plasmid obtained in Example 1 as a template, cloning primers for the pBI121-GFP-HbNAC47 vector were designed and constructed using Snapgene software. The restriction enzyme sites were KpnⅠ and BamHI. The primers used are as follows: Inf-PBI121-GFP-F: GGACTCTAGAGGATCCATGCCAATGGGGCAGCAGCGC, SEQ ID No. 9; Inf-PBI121-GFP-R: CGACCTCGAGGGTACCCATGTGCAGCTGCTGGCTGA, SEQ ID No. 10.
[0031] The PCR reaction system is shown in Table 1-1 (only the primers are different), and the PCR reaction procedure is shown in Table 1-2. After separation by 1.5% agarose gel electrophoresis, the PCR products were recovered using the OMEGA Gel Extraction Kit according to the manufacturer's instructions. The recovered products were ligated into the pBI121-GFP vector and digested with Kpn I and BamHI according to the ligation system shown in Table 3-1, at 37°C for 30 min. The digested products were detected by 1% agarose gel electrophoresis to confirm complete digestion and that the fragment size met the requirements. The digested products were then recovered from the gel for ligation. Recombination was performed at 50°C for 30 min according to the ligation system shown in Table 3-2. The method for transforming the ligated products into competent cells is described in Example 1.
[0032] Table 3-1 Enzyme digestion system
[0033] Table 3-2 Connection System
[0034] Positive clones were selected, cultured in a shaker, identified, and then sequenced. Sequencing analysis verified that the inserted fragment was correct. Plasmids were extracted after successful sequencing.
[0035] 2. The pBI121-GFP-HbNAC47 recombinant plasmid was transformed into Agrobacterium using the heat shock transformation method. The specific steps are as follows: (1) Take EHA105 competent cells out of the -80℃ freezer, wait on ice until they partially thaw, and insert them into ice when the cells are in an ice-water mixture state for later use. (2) Take 100 μL of competent cells, add 1 μg of plasmid DNA to be transformed, gently stir the bottom of the tube to mix, and perform the following treatments in sequence: stand on ice for 5 minutes, liquid nitrogen for 5 minutes, water bath at 28°C for 5 minutes, ice bath for 5 minutes; (3) Then add 700 μL of antibiotic-free YEB liquid medium and incubate at 28°C with shaking for 3 hours; (4) Centrifuge at 6000 rpm for one minute to collect the bacteria, and take 100 μL of supernatant. Gently pipette and resuspend the bacterial block, then spread it on a YEB plate containing the corresponding antibiotics (50 μg / mL Kana, 20 μg / mL Rif). Invert the plate and incubate at 28°C for 3 days. (5) PCR detection, and preserve the bacterial solution with the correct test results.
[0036] 3. Agrobacterium tumefaciens transiently transforms tobacco leaves (1) Take 50µL of the correctly identified original bacterial culture and inoculate it into 5mL of YEP liquid medium (containing the corresponding antibiotics 50μg / mL Kana and 20μg / mL Rif), and incubate overnight at 28℃ with shaking at 200rpm for 16-18h until OD600=0.8-1.0; (2) Take 2 ml of overnight bacterial culture and inoculate it into 5 mL of YEP liquid medium (containing the corresponding antibiotics 50 μg / mL Kana and 20 μg / mL Rif). Incubate at 28℃ and 200 rpm for 5-6 h until OD600 = 0.8-1.0. (3) Centrifuge the large-scale bacterial culture at 6000 rpm for 8 min and collect the bacterial cells; (4) Preparation of resuspension buffer: 5 mL 10 mM MgCl2, 10 mL 10 mM MES (pH 5.5), 50 µl 100 µM acetylsuccinone (AS), add ddH2O to 500 mL; (5) Resuspend the collected bacterial cells 2-3 times using resuspension buffer until the bacterial solution has an OD600 of 0.8-1.0; (6) Place the mixed bacterial solution in a 28℃ incubator and let it stand in the dark for 2-3 hours; (7) Select healthy tobacco plants and water them thoroughly 24 hours before injection so that the leaves can be injected. Use a sterile syringe to inject the induced bacterial solution into the intercellular spaces from the back of the leaves. (8) The injected tobacco was placed in a dark incubator at 28°C for 2 days; (9) Tear off leaf tissue from the infected area, prepare a temporary slide, and observe the fluorescence signal through an inverted fluorescence microscope.
[0037] The results are as follows Figure 3As shown, 35S:HbNAC47-GFP indicates the location of HbNAC47 in the cell, 35S:GFP is the empty vector emitting green fluorescence, Bright shows the structure of tobacco cells under bright field, and Merged is a combined image of the GFP and Bright channels. The green fluorescence of the 35S:GFP empty vector control is simultaneously localized in the cell nucleus and cell membrane, while the green fluorescence signal of the 35S-NAC47-GFP fusion protein is expressed in the cell nucleus. These results indicate that the HbNAC47 protein is specifically localized in the cell nucleus, consistent with the nuclear localization signal (NLS) predicted by bioinformatics and the functional characteristics of typical NAC transcription factors.
[0038] Example 4: Obtaining HbNAC47 gene-transgenic rice and its salt-alkali resistance test 1. Construction of expression vector 1300-FLAG-HbNAC47 Using the correctly sequenced positive clone plasmid obtained in Example 1 as a template, cloning primers for the 1300-FLAG-HbNAC47 vector were designed and constructed using Snapgene software. The restriction enzyme sites were Kpn I and BamHI. The primers used are as follows: Inf-1300-FLAG-F:GGACTCTAGAGGATCCATGCCAATGGGGCAGCAGCGC, SEQ ID No. 11; Inf1300-FLAG-R:CGACCTCGAGGGTACCCATGTGCAGCTGCTGGCTGA, SEQ ID No. 12.
[0039] The PCR reaction system is shown in Table 1-1 (only the primers are different), and the PCR reaction procedure is shown in Table 1-2. After separation by 1.5% agarose gel electrophoresis, the PCR products were recovered using the OMEGA Gel Extraction Kit according to the manufacturer's instructions. The recovered products were ligated into the pBI121-GFP vector and digested with Kpn I and BamHI according to the digestion and ligation system shown in Table 3-1, at 37℃ for 30 min. The digested products were detected by 1% agarose gel electrophoresis to confirm complete digestion and that the fragment size met the requirements. The digested products were then recovered from the gel for ligation. The ligation products were transformed into competent cells at 50℃ for 30 min according to the ligation system shown in Table 3-2. The transformation method is described in Example 1. Positive clones were picked, cultured, identified, and sequenced. Sequencing analysis verified the correctness of the inserted fragment. After successful sequencing, the plasmid was extracted. The correct recombinant plasmid was named 1300-FLAG-HbNAC47.
[0040] 2. The 1300-FLAG-HbNAC47 recombinant plasmid was transformed into Agrobacterium using the heat shock transformation method. The specific method is described in Example 3.
[0041] 3. Obtaining HbNAC47 transgenic rice plants An optimized Agrobacterium-mediated genetic transformation method for rice (japonica rice) was used (SLAMET-LOEDIN et al., 2014; Liu Defang, 2019). The constructed vector plasmid was transformed into Agrobacterium EHA105. After rooting, the plants were cultured at 30℃ under light for 7-10 days, resulting in 18 transgenic plants, labeled OE#1, OE#2, OE#3, OE#4, OE#5, OE#6, OE#7, OE#8, OE#9, OE#10, OE#11, OE#12, OE#13, OE#14, OE#15, OE#16, OE#17, and OE#18. Genomic DNA was extracted from the rice using an Omaga plant DNA extraction kit. PCR detection was performed on positive seedlings. The reaction system is shown in Table 4-1, and the reaction procedure is shown in Table 4-2. The PCR primers are as follows: M13-F: CAGGAAACAGCTATGAC, SEQ ID No. 13; HbNAC-500bp-R: CCTCTGCGCCTGGTGGTCCG, SEQ ID No. 14.
[0042] Table 4-1 PCR reaction system for detecting positive rice seedlings
[0043] Table 4-2 PCR Reaction Procedure
[0044] The results are as follows Figure 4 Among them, WT, WT1, and WT2 were untransformed wild-type rice and served as negative controls for detecting overexpressing transgenic rice. The plasmid (1300-FLAG-HbNAC47 recombinant plasmid) served as a positive control for detecting the DNA level of HbNAC47 gene heterologously overexpressing rice. OE#1-18 represent the PCR results of the DNA level of 18 transgenic positive lines of short-awned barley grass heterologously overexpressing the HbNAC47 gene. Except for OE#17, all overexpressing lines showed obvious specific bands, indicating that HbNAC47 was successfully inserted and overexpressed in rice, while wild-type (… Figure 4 WT1 and WT2 in A; Figure 4 The absence of specific bands in WT (B) confirmed the successful construction of the transgenic plant.
[0045] Transgenic positive plants were used for propagation, and T3 generation seeds were used for subsequent functional verification experiments.
[0046] 4. Salt and alkali resistance detection of T3 generation HbNAC47 gene transgenic rice Based on the relative expression levels of overexpressed rice (see...) Figure 6 Plump and healthy wild-type rice seeds and seeds from two transgenic rice lines with high HbNAC47 expression levels (OE#2 and OE#5) were selected. After sterilization, the seeds were spread evenly in 9cm petri dishes, and 25ml of sterile water was added. Germination was carried out in a 30℃ incubator for 24-48 hours. After germination, the seeds were transferred to a light incubator at 28℃, with 16 hours of light and 8 hours of darkness, and 60% humidity, keeping the seedbed moist. After germination, the seedlings were grown in 1 / 8 Hogland solution until day 14. The wild-type and overexpression line seedlings were then replaced with 60mM NaHCO3 solution and cultured under stress for day 5. Figure 5 As shown, this study compared the phenotypic changes of wild-type (WT) and HbNAC47 overexpressing lines (OE#2 and OE#5) under salt-alkali stress. Before stress treatment, all materials grew normally and had the same phenotype. After five consecutive days of salt-alkali stress, wild-type plants exhibited typical stress damage symptoms, such as obvious leaf wilting and yellowing; in contrast, the two overexpressing lines (OE#2 and OE#5) showed significantly enhanced salt-alkali tolerance, with relatively unfolded and green leaves, and their overall growth status was significantly better than that of the wild type. This indicates that the HbNAC47 gene can enhance the resistance of transgenic rice seedlings to salt-alkali stress.
[0047] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A transcription factor HbNAC47 associated with salt and alkali tolerance, characterized in that: The amino acid sequence of which is shown as SEQ ID No.
1.
2. The gene encoding the transcription factor HbNAC47 associated with salt and alkali tolerance according to claim 1, characterized in that: The nucleotide sequence of which is shown as SEQ ID No.
2.
3. The use of the transcription factor HbNAC47 of claim 1 or the coding gene of claim 2 in breeding salt-tolerant transgenic rice.
4. A recombinant expression vector, expression cassette or recombinant bacteria containing the coding gene of the salt-tolerant trait-related transcription factor HbNAC47 of claim 2.
5. The use of the recombinant expression vector, expression cassette or recombinant bacteria of the salt-tolerant trait-related transcription factor HbNAC47 of claim 4 in breeding salt-tolerant transgenic rice.