A plectosphaerellaceae strain sgsf1379 and application thereof

Abstract

A kind of plectosphaerellaceae strain SGSF1379 and its application belong to the field of microorganism and biological control technology. In order to screen new strains with high efficiency and broad-spectrum inhibitory activity to multiple fusarium, a fungus SGSF1379 is isolated from forest litter in Xiaoxing'an Mountain area, and the strain SGSF1379 is determined as a new species of Herpotrichiellaceae by combining its morphological characteristics and molecular biology identification results. Through activity test experiment, it is found that the fermentation extract of the strain SGSF1379 has good antibacterial activity to fusarium oxysporum, fusarium solani and fusarium proliferatum. The new strain SGSF1379 provided by the present application has certain theoretical and practical significance for preventing and treating fusarium diseases.

Description

Technical Field

[0001] This invention belongs to the field of microbial and biological control technology, specifically relating to a Chaetomaceae strain SGSF1379 and its applications. Background Technology

[0002] Fusarium ( Fusarium Fusarium spp. (plant pathogens) are a widely distributed group of plant pathogenic fungi that seriously harm nearly 70% of the world's crops. These fungi produce various toxins, leading to symptoms such as tissue rot, root rot, and fruit and leaf decay after infection, severely impacting crop yield and quality. Among them, root rot caused by Fusarium is one of the major diseases in agricultural production, and many crops are susceptible to infection during their growth. For example, Fusarium root rot in plants such as soybeans and cumin not only causes a significant decrease in crop yield and reduces economic benefits, but may also threaten environmental safety and human health due to toxin accumulation.

[0003] To combat various plant diseases caused by Fusarium, current methods mainly include physical, chemical, and biological control. While chemical control is relatively fast-acting, long-term use can lead to increased pathogen resistance, pesticide residues, and environmental pollution. Biological control, due to its environmental friendliness and safety for non-target organisms and humans / animals, has gradually become a research hotspot (Hu Fengyuan, Han Shaohua, Sun Guohao, et al. Research progress on biocontrol of root-knot nematodes [J / OL]. Science of Biological Disasters, 1-8 [2025-09-14].). Exploring natural fungal resources to find biocontrol strains with antagonistic effects against plant diseases has become an important strategy in the field of plant protection.

[0004] Herpotrichiellaceae is a family of Ascomycota fungi widely distributed in the natural environment. Most are saprophytic or symbiotic, and some species may have the potential to antagonize plant pathogens. Although this family of fungi plays an important role in the ecosystem, research on their application in the biological control of plant diseases is still relatively lacking. In current technologies, biocontrol strains targeting Fusarium diseases mostly use Trichoderma (Trichoderma...). Trichoderma spp.) and broom mold ( Gliocladium The main strains are spp., etc. Although these strains have a certain control effect, their spectrum of action is narrow and their synergistic inhibitory effect on multiple Fusarium species is often not ideal.

[0005] Therefore, discovering new and efficient biocontrol fungal resources from nature, especially strains with broad-spectrum inhibitory activity against various Fusarium species, is of great significance for enriching biological control methods and promoting sustainable agricultural development. Summary of the Invention

[0006] To screen for novel strains with highly efficient and broad-spectrum inhibitory activity against various Fusarium species, this invention isolated a fungus, SGSF1379, from forest litter in the Lesser Khingan Mountains. Based on its morphological characteristics and molecular biological identification, strain SGSF1379 was identified as a new species of the Herpotrichiellaceae family. This strain has been deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20252444, deposit date November 3, 2025, at Wuhan University, Wuhan, China. Through activity testing, this invention found that the fermentation extract of strain SGSF1379 exhibits inhibitory activity against Fusarium oxysporum (…). Fusarium oxysporum Fusarium solani ( Fusarium solani Fusarium moniliforme ( ), Fusarium proliferatum All of them have good antibacterial activity.

[0007] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention provides the following technical solution:

[0008] The first objective of this invention is to provide a Herpotrichiellaceae strain SGSF1379, with accession number CCTCC NO: M 20252444.

[0009] A second objective of this invention is to provide the application of the above-mentioned strain SGSF1379 in inhibiting the growth of Fusarium, including Fusarium oxysporum (Fusarium oxysporum). Fusarium oxysporum Fusarium solani ( Fusarium solani Fusarium moniliforme ( ), Fusarium proliferatum ).

[0010] In one embodiment of the present invention, the application involves using a fermentation extract of strain SGSF1379 to inhibit the growth of Fusarium.

[0011] This invention also provides the application of the above-mentioned strain SGSF1379 in the prevention and control of plant diseases caused by Fusarium, wherein the Fusarium includes Fusarium oxysporum (… Fusarium oxysporum Fusarium solani ( Fusarium solani Fusarium moniliforme ( ), Fusarium proliferatum ).

[0012] The present invention also provides a biocontrol agent containing a fermentation extract of the above-mentioned strain SGSF1379.

[0013] This invention also provides the application of the above-mentioned biocontrol agent in inhibiting the growth of Fusarium, wherein the Fusarium includes Fusarium oxysporum (Fusarium oxysporum). Fusarium oxysporum Fusarium solani ( Fusarium solani Fusarium moniliforme ( ), Fusarium proliferated ).

[0014] The present invention also provides a biopesticide containing a fermentation extract of the above-mentioned strain SGSF1379.

[0015] This invention also provides the application of the above-mentioned biological pesticide in the prevention and control of plant diseases caused by Fusarium, wherein the Fusarium includes Fusarium oxysporum (… Fusarium oxysporum Fusarium solani ( Fusarium solani Fusarium moniliforme ( ), Fusarium proliferatum ).

[0016] The present invention also provides a microbial fertilizer containing a fermentation extract of the above-mentioned strain SGSF1379.

[0017] This invention also provides the application of the above-mentioned microbial fertilizer in the prevention and control of plant diseases caused by Fusarium, wherein the Fusarium includes Fusarium oxysporum (Fusarium oxysporum). Fusarium oxysporum Fusarium solani ( Fusarium solani Fusarium moniliforme ( ), Fusarium proliferatum ).

[0018] The beneficial effects of this invention are:

[0019] This invention isolated a fungus, SGSF1379, from forest litter in the Lesser Khingan Mountains. Based on its morphological characteristics and molecular biological identification results, strain SGSF1379 was identified as a new species of Herpotrichiellaceae. Through activity testing experiments, this invention found that the fermentation extract of strain SGSF1379 is effective against Fusarium oxysporum (…). Fusarium oxysporum Fusarium solani ( Fusarium solani Fusarium moniliforme ( ), Fusarium proliferatum All of them exhibit good antibacterial activity. The novel strain SGSF1379 provided by this invention has certain theoretical and practical significance for the prevention and control of Fusarium diseases.

[0020] Preservation of biological materials

[0021] The strain SGSF1379 screened in this invention is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20252444, deposit date November 3, 2025, and address of the depository institution Wuhan University, Wuhan, China. Attached Figure Description

[0022] Figure 1 The graph shows the results of antibacterial activity tests of 11 fungi against Fusarium oxysporum.

[0023] Figure 2 The graph shows the results of antibacterial activity tests of 11 fungi against Fusarium solanum.

[0024] Figure 3 The image shows the results of antibacterial activity tests on 11 fungi against Fusarium oxysporum.

[0025] Figure 4 The images show the colony characteristics of strain SGSF1379 on four solid culture media. A shows the colony of strain SGSF1379 on the front side of PDA medium; B shows the colony of strain SGSF1379 on the back side of PDA medium; C shows the colony of strain SGSF1379 on the front side of YMA medium; D shows the colony of strain SGSF1379 on the back side of YMA medium; E shows the colony of strain SGSF1379 on the front side of MEA medium; F shows the colony of strain SGSF1379 on the back side of MEA medium; G shows the colony of strain SGSF1379 on the front side of OA medium; and H shows the colony of strain SGSF1379 on the back side of OA medium.

[0026] Figure 5 Images of hyphae and spores of strain SGSF1379 under a microscope are shown. In the images, A and B are sporulation structures of strain SGSF1379, C is a conidial image of strain SGSF1379, and D is a hyphae and spore image of strain SGSF1379. The scale bars in A, B, C, and D are all 20 μm. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be noted that the embodiments mentioned below are only for explaining the invention and are not intended to limit the scope of the invention. The embodiments mentioned below are only some embodiments of the invention, not all embodiments. Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the objectives of the invention. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of this invention to realize and apply the technology of this invention. In the art, embodiments obtained by other those skilled in the art without creative effort are all protected by this invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials, reagents, culture media and instruments used are conventional materials, reagents, culture media and instruments in the art, which can be obtained by those skilled in the art through commercial channels.

[0029] The samples used for screening strains in this invention were derived from forest litter in the Lesser Khingan Mountains region of Heilongjiang Province.

[0030] The plant pathogens selected for this invention are from the following sources:

[0031] Fusarium oxysporum ( Fusarium oxysporum Fusarium solani ( Fusarium solani (Liu Shujuan. Identification of the pathogen of cumin root rot and the inhibitory effect and control experiment of fungal-drug mixture on root rot pathogens [D]. Gansu Agricultural University, 2006.), Fusarium moniliforme ( Fusarium proliferatum All samples were isolated from cumin plants infected with cumin root rot and were donated by the Xinjiang Academy of Agricultural Sciences.

[0032] The culture medium and its formulation used in this invention are as follows:

[0033] MEA medium (malt extract agar medium): 40 g malt extract, 20 g agar, 1 L water;

[0034] OA medium (oat medium): 30 g oat flakes, 20 g agar, 1 L water;

[0035] PDA medium (potato dextrose agar): 200 g potato, 20 g glucose, 20 g agar, 1 L water;

[0036] YMA medium (yeast malt agar medium): 2 g yeast extract, 10 g malt extract, 20 g agar, 1 L water;

[0037] YES+vermiculite medium: 20 g yeast extract, 0.5 g magnesium sulfate, 150 g sucrose, 1 mL of (10 g / L zinc sulfate heptahydrate + 5 g / L copper sulfate pentahydrate) solution, 1 L water, and 2 L of vermiculite as a carrier;

[0038] PD liquid medium (potato glucose medium): 200 g potato, 20 g glucose, 1 L water;

[0039] PD+Nic medium: PD medium supplemented with 10% nicotinamide by mass.

[0040] SM liquid medium (super malt medium): 50 g malt extract powder, 10 g yeast extract powder, 1 mL 20 mg / L ferrous sulfate solution, 1 mL 7 mg / L zinc sulfate solution, 1 L water;

[0041] Rice culture medium: 8 g rice, 14 mL water, 28 mg glycerol, 28 mg malt extract, 0.14 g sodium tartrate, 14 mg potassium dihydrogen phosphate, 14 mg magnesium sulfate heptahydrate, and 0.7 mg ferrous sulfate heptahydrate.

[0042] Example 1: Isolation of strain SGSF1379

[0043] Using forest litter from the Lesser Khingan Mountains region of Heilongjiang Province as the isolation source, fungi were isolated using a particle plate dilution technique. The specific method is as follows: First, the collected, air-dried litter samples were pulverized into granules and filtered through a sieve to obtain litter sample particles with a size of 100-200 μm. Then, using the plate dilution method, the granular sample was mixed with sterile water at a mass ratio of 1:100 to prepare a particle suspension. 50 μL, 100 μL, 150 μL, 200 μL, and 250 μL were then pipetted onto PDA agar plates, spread evenly with a spreader, and incubated at room temperature. Observations were made every 12 hours. Once fungal colonies grew, they were picked and transferred to PDA plates for purification. Multiple fungal strains were obtained after purification and culture. These strains were numbered, with one strain designated SGSF1379.

[0044] Example 2: Determination of the inhibitory effect of strain SGSF1379 on Fusarium oxysporum

[0045] 1. Selection of test strains

[0046] In Example 1 of this invention, forest litter collected from the Lesser Khingan Mountains region of Heilongjiang Province was isolated, and 11 relatively novel fungi with an ITS similarity of less than 98.5% were obtained. The ITS closest strains, accession numbers and similarities of these 11 fungi are shown in Table 1. Antibacterial tests were conducted using these 11 fungi.

[0047] Table 1 Information on 11 fungal strains

[0048]

[0049] 2. Preparation of crude extracts from the fermentation of various fungi to be tested

[0050] Mycelial cakes from the edges of 11 fungal colonies were inoculated into PD liquid medium and cultured for 4 days at 180 r / min in a shaker at 25℃ to prepare seed culture solutions. 20 mL of each of the three liquid media (SM, PD, PD+Nic) and three solid media (PDA, YES+vermiculite, rice) were prepared, and 200 μL of each seed culture solution was inoculated for small-scale fermentation. The liquid media culture conditions were: 180 r / min, 25℃, and protected from light for 14 days; the solid media culture conditions were: 25℃ and protected from light for 21 days. After fermentation, the culture was soaked in ethyl acetate for 24 h, and then concentrated under reduced pressure using a rotary evaporator to obtain a crude fermentation extract. The crude extract was completely dissolved in 1 mL of DMSO to obtain a crude fermentation extract solution for later use.

[0051] 3. Anti-Fusarium activity test

[0052] The activity test against Fusarium oxysporum was conducted using the perforation diffusion method on six crude fermentation extracts of the above 11 fungi. The tested Fusarium oxysporum included *Fusarium oxysporum* (…). F. oxysporum Fusarium solani ( F. solani Fusarium moniliforme ( ), F. proliferatum The specific method involves using a 6 mm diameter punch to make six evenly spaced holes in a PDA medium, adding 20 μL of each of the six crude fermentation extract solutions in sequence to each hole, and finally inoculating a Fusarium mycelium cake in the center of the PDA medium. The medium is then incubated at 25°C, and the growth of the plant pathogenic fungus is observed to obtain an active strain.

[0053] The results of the anti-Fusarium activity test are shown in Table 2 and Figure 1 As shown in the results, the crude fermentation extracts obtained from strain SGSF1379 via PD+Nic and YES+vermiculite media, and the crude fermentation extracts obtained from strain SGSF1469 via PDA media, exhibit good antibacterial activity against Fusarium oxysporum.

[0054] Table 2. Results of the test on the antifungal activity of 11 fungal strains against Fusarium oxysporum.

[0055]

[0056] Note: "–" indicates an inhibition rate of less than 30%; "+" indicates an inhibition rate of greater than 30%; Inhibition rate: (growth radius of control group - growth radius of experimental group) / growth radius of control group.

[0057] The results of the anti-Fusarium solani activity test are shown in Table 3 and Figure 2As shown in the results, the six crude fermentation extracts of strain SGSF793 and the crude fermentation extract of strain SGSF1379 obtained by fermentation on YES + vermiculite medium have good antibacterial activity against Fusarium solani.

[0058] Table 3. Results of the test on the antifungal activity of 11 fungal strains against Fusarium solanum.

[0059]

[0060] Note: "–" indicates an inhibition rate of less than 30%; "+" indicates an inhibition rate of greater than 30%; Inhibition rate: (growth radius of control group - growth radius of experimental group) / growth radius of control group.

[0061] The results of the anti-Fusarium activity test are shown in Table 4 and Figure 3 As shown in the results, the crude fermentation extracts obtained from strain SGSF790 via fermentation in PD+Nic and YES+vermiculite media, the crude fermentation extracts obtained from strain SGSF962 via fermentation in PD, PD+Nic, and YES+vermiculite media, and the crude fermentation extracts obtained from strain SGSF1379 via fermentation in SM, PD, PD+Nic, and YES+vermiculite media all exhibit good antibacterial activity against Fusarium moniliformes.

[0062] Table 4. Test results of the activity of 11 fungal strains against Fusarium latum.

[0063]

[0064] Note: "–" indicates an inhibition rate of less than 30%; "+" indicates an inhibition rate of greater than 30%; Inhibition rate: (growth radius of control group - growth radius of experimental group) / growth radius of control group.

[0065] The results of the three activity tests showed that only strain SGSF1379 was resistant to all three Fusarium species, and the crude extract obtained by fermentation on YES+vermiculite medium had good antibacterial activity against the three Fusarium species.

[0066] Example 3: Identification of strain SGSF1379

[0067] 1. Morphological analysis of strain SGSF1379

[0068] (1) Morphological analysis of strain SGSF1379

[0069] Strains SGSF1379 were inoculated into the center of four solid culture media (PDA, YMA, MEA, and OA) at a depth of 90 mm. After 14 days of cultivation, the growth characteristics of the colonies were observed, including colony color, colony morphology, colony texture, and morphological characteristics such as whether there were wrinkles and whether pigments were produced. The size of the hyphae, sporulation structure, and size and shape of the conidia of strain SGSF1379 were observed under a microscope.

[0070] Morphological analysis of strain SGSF1379 showed that the colonies of strain SGSF1379 were round, brownish-green, with the outermost ring being darker in color and forming radial, fluffy hyphae, while the inner ring was lighter in color than the outer ring. No exudate was observed on the colonies, and no color was produced on the culture medium outside the colonies. The colonies were homogeneous in texture, with a dark brownish-green reverse side and no radial grooves on either side. Figure 4 The hyphae of strain SGSF1379 are transparent, smooth, septate, and branched. Conidiophores are solitary, arising scattered from both ends of the hyphae; they are unbranched, cylindrical, erect or slightly curved, and produce spores at the apex. Conidia are transparent, septate, oval to club-shaped, with rounded, untruncended ends, and approximately 4.5–6.0 μm × 2.0–3.2 μm in size. Figure 5 ).

[0071] (2) Effects of different temperatures and culture media on the colony diameter of strain SGSF1379

[0072] Strain SGSF1379 was inoculated into four different 90 mm PDA, YMA, MEA and OA media and incubated at four different temperatures of 15℃, 20℃, 25℃ and 30℃ for 14 days. The diameter of its colonies was then measured.

[0073] The results are shown in Table 5. Strain SGSF1379 formed the largest colonies after 14 days of cultivation at 25℃: 2.62 cm on PDA medium, 2.92 cm on YMA medium, 2.94 cm on MEA medium, and 3.40 cm on OA medium. Therefore, the optimal growth temperature for strain SGSF1379 is 25℃, and the optimal culture medium is OA medium.

[0074] Table 5. Statistical results of colony diameter of strain SGSF1379 on different temperatures and culture media (unit: cm)

[0075]

[0076] Note: Uppercase letters represent comparisons of differences in the same culture medium at different temperatures, while lowercase letters represent comparisons of differences in the same culture medium at different temperatures.

[0077] 2. Taxonomic analysis of strain SGSF1379

[0078] DNA from strain SGSF1379 was extracted using the CTAB method. Different regions of the DNA fragment from strain SGSF1379 were amplified using different primers, and the obtained PCR products were analyzed by agarose gel electrophoresis. After electrophoresis, the agarose gels were analyzed using a fully automated gel imaging system, and PCR samples with well-defined bands were selected for sequencing. The internal transcribed spacer region (ITS) was amplified using primers ITS1 / ITS4, yielding a sequence fragment of 474 bp (SEQ ID NO.1); the conserved LSU region of the 28S rRNA large subunit was amplified using primers LROR / LR5, yielding a sequence fragment of 702 bp (SEQ ID NO.2); the conserved SSU region of the 18S small subunit was amplified using primers NS1 / NS4, yielding a sequence fragment of 805 bp (SEQ ID NO.3); the β-tubulin gene (TUB) was amplified using primers Bt2a / Bt2b, yielding a sequence fragment of 421 bp (SEQ ID NO.4); and the TEF transcription factor was amplified using primers EF1-983F / EF1-2218R, yielding a sequence fragment of 790 bp (SEQ ID NO.5). Information on the primers used to amplify these DNA fragments is shown in Table 6.

[0079] Table 6 Primer Information

[0080]

[0081] SEQ ID NO.1:

[0082] CTATGTTTATTCAACCACTGTTGCTTCGGCGGGCCCGTCTTTATTGACCGCCGGAGGATCGTCAAAACGTCCTCTGGTCTGCGCCCGTCGGTGGCCAACTACTCCAAATTCATCACCAAACGTGTCAATATCTGAATGTTATATTAAATAAAGCAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGCATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCTCAAGCCCCCGGCTTGGTGTTGGACGGTTGGTGGGACCTCTTTGTAGGACCTAGCCCCTCCCAAAGACAATGACGGCGGCCTCGTTGGACCCCCGGTACACTGAGTTCTTCACGGAGCACGTACTGGATCAGGGCTCGCGGGACACGGTCTG;

[0083] SEQ ID NO.2:

[0084] ;

[0085] SEQ ID NO.3:

[0086] ;

[0087] SEQ ID NO.4:

[0088] GCACAGCTCTGACTCGATCACAGGCAGATTATCTCGGGCGAGCATGGTCTTGATGGCTCTGGAGTGTAAGATCATTGCATATTCCTTCAGGACGAATCTGGACTGACAATTGCAGCTACGCTGGCACCTCAGACCTTCAACTTGAGCGCATGAATGTCTACTTCAATGAGGTAACTATCAAGAATCATTTGTACCGAACCAGCCTCTAACCCGACTAGGCATCTGGTAACAAATATGTTCCCCGTGCAGTCCTCGTGGACCTAGAACCCGGTACCATGGATGCTGTCCGTGCTGGTCCATTCGGTCAACTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGAGCGGTGCTGGTAAGGATACACAGTCGGGAATTTGGAATGACATTAATAACACGGAAATCAGGAAACAACTGGGCCAAGG;

[0089] SEQ ID NO.5:

[0090] .

[0091] After sequencing, the GenBank database was searched to determine the taxonomic position of the strain. Then, reliable sequences were extracted using MEGA software and compared with known species sequences on the NCBI website. The taxonomic position of the isolated fungi was identified based on the comparison results.

[0092] Table 7 shows the sequence similarity comparison results of strain SGSF1379, displaying the five strains with the most similar sequences to strain SGSF1379, along with their accession numbers and similarity. These five most similar strains all belong to the Herpotrichiellaceae family, specifically four different genera within this family. Except for LSU and SSU, the similarity of the other three sequences is below 93%. The most similar strains corresponding to LSU and SSU belong to... Minimelanolocus spp . and Thysanorrhea spp . Two genera are identified, but strain SGSF1379 does not conform to the morphological characteristics of either genera. The hyphae of strain SGSF1379 are transparent, septate, and branched; the conidia are transparent, colorless, septate, oval to club-shaped, with rounded ends and no truncation, and are significantly smaller and different in shape from the two genera mentioned above. Therefore, strain SGSF1379 does not meet the morphological characteristics of these two genera and does not belong to them. Based on the morphological and molecular biological identification results, strain SGSF1379 can be identified as a new species belonging to the family Chaetomaceae. Strain SGSF1379 has been deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20252444, deposit date November 3, 2025, at Wuhan University, Wuhan, China.

[0093] Table 7. Results of sequence similarity comparison of strain SGSF1379

[0094]

[0095] Note: Strain accession number data are from the NCBI website.

[0096] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A strain of Herpotrichiellaceae, SGSF1379, characterized in that, The accession number is CCTCC NO: M 20252444.

2. The application of strain SGSF1379 of claim 1 in inhibiting the growth of Fusarium, characterized in that, The Fusarium species is Fusarium oxysporum (Fusarium oxysporum) Fusarium oxysporum Fusarium solani ( Fusarium solani ) or Fusarium moniliforme ( Fusarium proliferatum ).

3. The application according to claim 2, characterized in that, The application utilizes the fermentation extract of strain SGSF1379 to inhibit the growth of Fusarium.

Images