In-vitro separation and culture method of novel rumen epithelial cells with strong short-chain fatty acid absorption characteristic
By using specific labeling and flow cytometry to isolate rumen epithelial cells, the problem of rumen epithelial cell isolation and culture in existing technologies has been solved, achieving high-purity and stable Cg-like cell culture, supporting in-depth research on rumen metabolism and precise nutritional regulation.
Patent Information
- Application Number
- CN202511610722.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-05
- Publication Date
- 2026-03-06
AI Technical Summary
Existing technologies make it difficult to effectively isolate and culture rumen epithelial cells that specifically absorb short-chain fatty acids, thus hindering in-depth research into their unique role and functional characteristics in dairy cow rumen metabolism.
Double-positive cell populations were isolated from immortalized rumen epithelial cell lines using flow cytometry with specific antibodies against gap junction protein α1 (GJA1) and keratin 6A (KRT6A) and cultured in a specific medium to verify their short-chain fatty acid absorption function.
It has achieved the isolation and culture of Cg-like epithelial cells with high purity (≥90%) and good stability, which can significantly proliferate and maintain the high absorption characteristics of short-chain fatty acids. This supports in-depth analysis of rumen epithelial cell heterogeneity and SCFA transport mechanism, and provides a foundation for the development of precision nutrition regulation technology.
Smart Images

Figure CN121610441A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of cell biology technology, specifically relating to a novel method for the in vitro isolation and culture of rumen epithelial cells with strong short-chain fatty acid absorption properties. Background Technology
[0002] The rumen is the most important digestive organ in dairy cows. Feed is digested by microorganisms in the rumen, forming various metabolites that are then absorbed by the body. Short-chain fatty acids (SCFAs), as the main energy source for dairy cows, are among the most critical digestive metabolites. Rumen epithelial cells, as the main functional units for the absorption and transport of SCFAs, play an irreplaceable physiological role in the nutrient absorption and metabolic regulation of dairy cows. Therefore, elucidating the types, structures, and functions of key rumen epithelial cells, and revealing the mechanisms of SCFA absorption and metabolism, is of great significance for conducting precise nutritional regulation.
[0003] Traditional rumen epithelial cell studies, which typically use mixed populations of epithelial cells as research subjects, have significant limitations. Firstly, protein expression data from mixed cell populations reflect the average level of the population, making it difficult to accurately distinguish epithelial cell subpopulations with different functional characteristics. Secondly, the lack of effective separation methods masks the functional characteristics of cells that are specifically involved in SCFA absorption, hindering the accurate analysis of their unique roles in rumen metabolism.
[0004] In recent years, the emergence of single-cell transcriptomics technology has provided a powerful tool for identifying rumen epithelial cell subsets, revealing cellular diversity at the single-cell level. A recent study used this technology to identify a novel epithelial cell subset—Channel-gap-like Spinous Cells (Cg-like spinous cells)—characteristically expressing GJA1 and KRT6A proteins in the rumen tissue of lactating dairy cows. This subset showed significantly higher expression of the short-chain fatty acid transporter MCT1 and higher scores in short-chain fatty acid signaling pathways than other cell types, making it a key cell subtype for short-chain fatty acid uptake. While single-cell technology has successfully revealed the heterogeneity of rumen epithelial cells, the subsequent cell isolation and culture techniques are still immature, hindering in-depth functional and mechanistic studies of the identified cell subsets.
[0005] Given the dual challenges facing rumen epithelial cell research, no studies have yet provided detailed reports on rumen epithelial cell subtypes that specifically absorb SCFAs, hindering a deeper understanding of rumen epithelial cell heterogeneity and the mechanisms of SCFA absorption. Therefore, developing a novel in vitro isolation and culture method for rumen epithelial cells with strong short-chain fatty acid absorption properties is not only crucial for elucidating the physiological functions of rumen epithelium in ruminants but also provides essential technical support for developing precise nutritional regulation strategies. Summary of the Invention
[0006] This invention addresses the shortcomings of existing technologies by providing a novel method for the in vitro isolation and culture of rumen epithelial cells with strong short-chain fatty acid absorption properties. The method is characterized by the following steps: (1) Establishment of rumen epithelial cell line: Take the rumen tissue after cutting and cleaning, the rumen sac side tissue, digest it with trypsin-EDTA solution, purify it by differential adhesion method to obtain primary cells, and establish immortalized rumen epithelial cell line by transfection with lentiviral vector carrying SimianVirus 40 Large T Antigen (SV40T) and selection with puromycin; (2) Sorting of rumen epithelial cells with short-chain fatty acid absorption characteristics: Double-positive cell populations were sorted from the immortalized rumen epithelial cell line established in step (1) by flow cytometry using specific antibodies against gap junction protein alpha 1 (GJA1) and keratin 6A (KRT6A). (3) Culture of rumen epithelial cells with short-chain fatty acid absorption characteristics: The double-positive cells collected in step (2) were cultured in a customized initial culture medium and placed in a 37°C constant temperature incubator with a volume fraction of 5% CO2. After the cells were stable, the cell-specific culture medium was replaced, and the cells were cultured at a frequency of replacing the special culture medium every 48 hours thereafter. (4) Functional verification of rumen epithelial cells with short-chain fatty acid absorption characteristics: Rumen epithelial cell lines and double-positive cells in the logarithmic growth phase were selected and divided into control group and experimental group. After treatment with short-chain fatty acids, the expression of related absorption genes was detected.
[0007] Further, in the washing step of step (1), the washing reagent is 1×PBS, pH 7.4, containing 1000 IU / mL penicillin-G, 1 mg / mL streptomycin sulfate, 500 μg / mL gentamicin sulfate and 25 μg / mL amphotericin B; the specific operation of the digestion step is as follows: after adding trypsin to the tissue, it is placed in a constant temperature shaker at 37℃ and 150 rpm for 40 minutes to digest, and then stop culture medium (DMEM to fetal bovine serum volume ratio is 4:1) is added to stop digestion (trypsin volume: stop culture medium volume = 1:1); then, fresh trypsin solution is added every 5 minutes to digest and collect primary rumen epithelial cells; the concentration of the trypsin is 0.25% (0.25g trypsin dissolved in 100ml PBS) and the volume ratio of trypsin to tissue is 2:1.
[0008] Furthermore, the primary rumen epithelial cell culture medium consisted of basal medium DMEM: fetal bovine serum = 45 mL: 5 mL, and contained 200 IU / mL penicillin-G, 200 µg / mL streptomycin sulfate, 100 µg / mL gentamicin sulfate, 5 µg / mL amphotericin B, 5 µg / mL bovine insulin, 10 ng / mL epidermal growth factor, and 10 µM Y-27632.
[0009] Further, in step (1), the lentivirus transfection conditions are as follows: pGMLV-SV40T-PURO lentivirus is transfected into primary rumen epithelial cells for 18 hours under the condition of MOI=80; the rumen epithelial cell line culture medium consists of basic culture medium DMEM / F12: fetal bovine serum: 1× penicillin-streptomycin antibiotic = 45mL: 5mL: 1mL, and it is half-volume culture.
[0010] Further, in step (2), the steps for sorting rumen epithelial cells with short-chain fatty acid absorption characteristics by flow cytometry are as follows: rumen epithelial cell lines cultured to 80% confluence are washed three times with 1xPBS, digested with 0.25% trypsin for 3 minutes, then the digestion is terminated. The cells are centrifuged at 300xg for 5 minutes, and the supernatant is discarded. The cells are resuspended in 1mL of 1x flow cytometry antibody dilution buffer, and primary antibody (Alexa Fluor 647-labeled anti-GJA1 primary antibody, at a concentration of 10...) is added. 6 Add 0.4 μg of the drug to each cell for incubation; inject Alexa Fluor 488-labeled anti-KRT6A (keratin 6A) primary antibody at a dose of 10 μg / mL. 6Add 0.5 μg of the reagent to each cell and incubate at 4°C in the dark for 30 minutes. Centrifuge at 300 x g for 5 minutes and discard the supernatant. Wash the cells with 1 mL of 1x flow cytometry staining buffer, centrifuge at 300 x g for 5 minutes, and discard the supernatant twice. Resuspend the cells in 500 μL of flow cytometry staining buffer and filter through a 40 μm cell sieve. Set the sorting parameters on the flow cytometer, and use FSC / SSC gating to exclude debris and duplex cells. Finally, sort out the double-positive cell population that simultaneously expresses GJA1 and KRT6A. Seed the sorted double-positive cells into culture dishes. When the cells reach 80% confluence, they can be used for subsequent experiments or cryopreserved.
[0011] Further, in step (3), when culturing the first collected double-positive cells, an initialization medium is used, the composition of which is basal medium DMEM-F12: fetal bovine serum: 1× penicillin-streptomycin antibiotic = 79mL: 20mL: 1mL; cell stability refers to cells with a cell adhesion rate ≥80% and normal morphology without shrinkage, which can grow steadily and normally go through the lag phase, logarithmic growth phase and stationary phase; the composition of the special medium used after cell stability and subsequent culture is basal medium DMEM-F12: fetal bovine serum: 1× penicillin-streptomycin antibiotic = 45mL: 5mL: 1mL.
[0012] Furthermore, the short-chain fatty acid treatment is characterized by adding a 10mM SCFA mixture (acetic acid:propionic acid:butyric acid = 65mM:25mM:10mM) to the culture medium and culturing at 37°C for 12 hours.
[0013] Furthermore, the specific primers for the short-chain fatty acid absorption-related genes GJA1, MCT1, AE2, NHE1, and HMGCS2 are as follows: GJA1 The upstream primer sequence (5'-3') is: SEQ ID NO.1: TGCTTGTCGTGTCATTGGTGTC, and the downstream primer sequence (5'-3') is: SEQ ID NO.2: GTAGTGTGGTAAGGATCGCTCTTTC; MCT1 The upstream primer sequence (5'-3') is: SEQ ID NO.3: CTGCACAACAGTTTCCCGTG, and the downstream primer sequence (5'-3') is: SEQ ID NO.4: CTGTCTGGCTGAACGGTCTT; AE2The upstream primer sequence (5'-3') is: SEQ ID NO.5: GGTCAAGGAGCAGCGTGTTAC, and the downstream primer sequence (5'-3') is: SEQ ID NO.6: CAGCACAGCAACAGGAACTTCTC; NHE1 The upstream primer sequence (5'-3') is: SEQ ID NO.7: GAAACCCGTACAGCAGCAAGC, and the downstream primer sequence (5'-3') is: SEQ ID NO.8: GCCATTGACAGGTGAGCACATC; HMGCS2 The upstream primer sequence (5'-3') is: SEQ ID NO.9: CCTTCCAGGATTCAGGCAACAC, and the downstream primer sequence (5'-3') is: SEQ ID NO.10: TTCCATCCAGTTGGCAGCATTG.
[0014] Secondly, the present invention also provides a novel rumen epithelial cell based on claims 1-11, which has a purity of ≥90% as determined by flow cytometry and can be stably passaged.
[0015] Thirdly, the present invention also provides a novel application of rumen epithelial cells in rumen epithelial cell heterogeneity, short-chain fatty acid absorption mechanisms, and screening of functional feed additives.
[0016] Preferably, the puromycin content in step (1) is 1 μg / mL; Preferably, the RT-qPCR in step (1) is to identify cells with stable passage ability by comparing the SV40T gene sequence, and to determine the establishment of immortalized bovine rumen epithelial cell lines.
[0017] Preferably, the antibody dilution buffer formulation used in step (2) for flow cytometry is 10 mL PBS + 0.5 g bovine serum albumin; Preferably, the staining buffer formulation used in step (2) for flow cytometry is: 1 mL PBS containing 0.03 mL fetal bovine serum; Preferably, in step (2), the flow cytometry is performed with sorting parameters set to a 70 μm nozzle and a 20 psi pressure.
[0018] Preferably, step (3) cell stabilization refers to digesting and counting cells from three parallel groups daily, plotting a growth curve with culture time on the x-axis and cell concentration on the y-axis, to ensure that the cells can normally experience the lag phase, logarithmic growth phase, and stationary phase. The initial cell seeding density is 10 cells per well. 4 When the cell count is 1, the cell enters the logarithmic growth phase on day 5 of culture.
[0019] The beneficial effects of this invention: The Cg-like epithelial cells isolated by this invention using specific markers (GJA1 / KT6A) have significant technical advantages and application value. The cell population, after flow cytometry sorting, achieves a purity of over 90%, exhibits stable proliferation, and maintains high absorption characteristics of short-chain fatty acids, demonstrating excellent experimental stability. This cell model can be used to deeply analyze rumen epithelial cell heterogeneity and SCFA transport mechanisms, construct a research system for rumen microecology and host interaction, and also provides a reliable in vitro evaluation platform for the development of precision nutrition regulation technology for ruminants and the screening of functional feed additives, possessing significant scientific research value and promising industrial application prospects. Attached Figure Description
[0020] Figure 1 It is rumen tissue.
[0021] Figure 2 They are primary rumen epithelial cells.
[0022] Figure 3 It is composed of lentiviruses.
[0023] Figure 4 To demonstrate the presence of Cg-like cells in rumen epithelial cell lines.
[0024] Figure 5 The results are for flow cytometry sorting of Cg-like cells; P1 represents all cells, P5 represents the blank control, and P7 represents Cg-like cells.
[0025] Figure 6 This is the growth curve for Cg-like cells.
[0026] Figure 7 These are Cg-like cells that have grown to 80%-90% confluence.
[0027] Figure 8 This refers to the expression of genes related to short-chain fatty acids in Cg-like cells. Detailed Implementation
[0028] The technical solutions in the embodiments of the present invention will be clearly and completely described below. The described embodiments are merely the main embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0029] In the following examples, DMEM / DMEM-F12 culture medium, fetal bovine serum, and trypsin-EDTA digestion solution were from Gibco; PBS, penicillin-streptomycin mixture, paraformaldehyde, and DAPI staining agent were purchased from Biosharp; gentamicin and amphotericin B were purchased from Sangon Biotech; Triton X-100, Tween-20, and bovine serum albumin were purchased from Beijing Solarbio Biotechnology Co., Ltd.; pGMLV-SV40T-PURO lentivirus and puromycin were purchased from Shanghai Jiman Biotechnology Co., Ltd.; epidermal growth factor (EGF), bovine insulin, and Y27632 were purchased from MCE; RT-PCR kit, PrimeScript RT kit, and SYBR Premix Ex Taq II were purchased from TaKaRa; immunofluorescence mouse KRT6A antibody, rabbit GJA1 antibody, Alexa Fluor 647-labeled anti-mouse IgG secondary antibody, and Alexa Fluor 488-labeled anti-rabbit IgG secondary antibody were purchased from Wuhan Sanying Biotechnology Co., Ltd.; GJA1-Alexa Fluor 647 and KRT6A-Alexa... Fluor 488 was purchased from R&D Systems. 60mm and 100mm culture dishes, 6-well, 24-well, and 96-well plates, and 25cm culture flasks were purchased from WHB; coverslips and flow cytometry tubes were purchased from Beyotime; and hemocytometers were purchased from Thermo Fisher Scientific. Unless otherwise specified in the examples, experimental conditions were generally performed according to standard procedures or the recommendations of the reagent companies. Unless otherwise specified, all reagents and consumables used in the following examples are commercially available.
[0030] This invention provides a novel method for the in vitro isolation and culture of rumen epithelial cells with strong short-chain fatty acid absorption properties. The specific process is as follows: Example 1: Isolation and culture of rumen epithelial cells Sampling and cleaning: Take a 5cm × 5cm sample from the rumen abdominal sac of a healthy dairy cow, separate the serosal layer, wash in PBS buffer containing compound antibiotics until the solution is clear, and transport at 4°C (e.g., Figure 1 The PBS buffer formulation is 1×PBS, pH 7.4, containing 1000 IU / mL penicillin-G, 1 mg / mL streptomycin sulfate, 500 μg / mL gentamicin sulfate, and 25 μg / mL amphotericin B.
[0031] Primary rumen epithelial cell isolation and culture: In a laminar flow hood, the collected rumen tissue was aseptically cut into 5mm × 5mm pieces and washed three times with shaking in PBS containing compound antibiotics, 5 minutes each time. In a laminar flow hood, the collected rumen tissue was cut into 5mm pieces... 3Small pieces of tissue were washed three times with PBS buffer containing antibiotics (150 rpm, 5 minutes). Then, 0.25% trypsin-EDTA solution (trypsin to tissue volume ratio 2:1) was added to digest the tissue. Digestion was carried out at 37°C and 150 rpm for 40 minutes with shaking. Stop digestion was then initiated with stop medium (DMEM to fetal bovine serum volume ratio 4:1) (trypsin volume: stop medium volume ratio 1:1). Cells were collected. Digestion was continued every 5 minutes, collecting the digestion solution and stopping the digestion with stop medium until the digestion solution became slightly viscous. Digestion products were filtered through 70μm and 40μm cell sieves, centrifuged at 300×g for 5 minutes, and resuspended in primary rumen epithelial cell culture medium (the primary rumen epithelial cell culture medium consisted of basal medium DMEM: fetal bovine serum = 45mL: 5mL, and contained 200IU / mL penicillin-G, 200µg / mL streptomycin sulfate, 100μg / mL gentamicin sulfate, 5μg / mL amphotericin B, 5μg / mL bovine insulin, 10ng / mL epidermal growth factor, and 10μM Y-27632). Epithelial cells were purified using differential adhesion. After 1 hour of adhesion, the supernatant was transferred to a new culture dish. Cells adhering to the bottom of the dish (fibroblasts) were discarded, and the supernatant contained primary rumen epithelial cells. The cells were cultured at 37℃ and 5% CO2 for 2-3 days until the cell confluence reached 80% (e.g., ...). Figure 2 ).
[0032] (3) Establishment of rumen epithelial cell line: Primary rumen epithelial cells were cultured at a density of 5 × 10⁶ cells per well. 4 Cells were seeded at a density of 1,000 cells per well in 24-well plates and cultured overnight. Then, at an MOI of 80, the cells were inoculated with pGMLV-SV40T-PURO lentivirus (e.g., ...). Figure 3 Half-volume transfection was performed for 18 hours, at which point the culture medium was replaced with rumen epithelial cell line medium (rumen epithelial cell line medium components: basal medium DMEM-F12: fetal bovine serum: 1× penicillin-streptomycin antibiotic = 45mL: 5mL: 1mL). Then, the medium was replaced with full-volume rumen epithelial cell line medium for continued culture. When cell confluence reached 70-80%, stable transfected lines were selected using 1μg / mL puromycin. The medium was changed every 3-4 days until the control group cells died completely. Positive cells were expanded and cultured to establish immortalized rumen epithelial cell lines. Detection was performed using RT-PCR. SV40T Gene expression verification of immortalization effect: After cells were cultured for another 48-72 hours, RNA was extracted from the cells using the Trizol method, reverse transcribed into cDNA, and the expression of the SV40T gene was detected. The SYBR Green qPCR system was used. SV40TSpecific primers (SV40T(Co)-qF: SEQ ID NO.11: TGGAAACCAAGTGCGACGAC, SV40T(Co)-qR: SEQ ID NO.12: CGGCGAAGATAGCGGCATTA) were used, and the expression level was analyzed by the 2-ΔΔCt method to prove that a stable rumen epithelial cell line was obtained.
[0033] Example 2: Cg-like cell sorting and culture Verification of the presence of Cg-like cells in rumen epithelial cell lines: Rumen epithelial cell lines were seeded onto coverslips (5 × 10⁶ cells per well). 4 (10 cells) When the confluence reaches 60-70%, fix with 4% paraformaldehyde for 15 minutes, wash three times with PBS for 5 minutes each time; add 0.1% Triton X-100 for permeabilization for 10 minutes, wash three times with PBS for 5 minutes each time; add blocking solution containing 5% bovine serum albumin and 0.1% Tween-20 for 1 hour, wash three times with PBS for 5 minutes each time. Add primary antibodies (mouse KRT6A antibody, diluted 1:500; rabbit GJA1 antibody, diluted 1:500) and incubate overnight at 4°C; add secondary antibodies (Alexa Fluor 647-labeled anti-mouse IgG secondary antibody, diluted 1:1000; Alexa Fluor 488-labeled anti-rabbit IgG secondary antibody, diluted 1:500) and incubate at room temperature in the dark for 1 hour; stain the nuclei with DAPI for 5 minutes, then mount and observe. The results showed that rumen epithelial cell lines contained cells that simultaneously expressed KRT6A and GJA1, namely Cg-like cells (e.g., Figure 4 ).
[0034] Flow cytometry sorting of Cg-like cells: Rumen epithelial cell lines cultured to 80% confluence were washed three times with 1xPBS, digested with 0.25% trypsin for 3 minutes, and then centrifuged at 300xg for 5 minutes, discarding the supernatant. Cells were resuspended in 1 mL of 1x flow cytometry antibody dilution buffer (10 mL PBS + 0.5 g bovine serum albumin), and primary antibody (…) was added. GJA1-Alexa Fluor 647, per 10 6 Add 0.4 μg of the drug to each cell for incubation; KRT6A-Alexa Fluor 488, at a dosage of 10... 6Add 0.5 μg of the reagent to each cell and incubate at 4°C in the dark for 30 minutes. Centrifuge at 300 x g for 5 minutes and discard the supernatant. Wash the cells with 1 mL of 1x flow cytometry staining buffer, centrifuge at 300 x g for 5 minutes, discard the supernatant, and repeat twice. Resuspend the cells in 500 μL of flow cytometry staining buffer (1 mL PBS containing 0.03 mL fetal bovine serum) and filter through a 40 μm cell sieve. Set the sorting parameters on the flow cytometer (70 μm nozzle, 20 psi sheath pressure), and use FSC / SSC gating to exclude debris and duplex cells. Finally, sort out the double-positive cell population that simultaneously expresses GJA1 and KRT6A, i.e., Cg-like cells (e.g., ...). Figure 5 ).
[0035] Example 3: In vitro culture of Cg-like cells (1) Plotting Cg-like cell growth curves: The first collected Cg-like cells were cultured in the initial culture medium, and then 10 cells were grown per well. 4 Cells were seeded at a density of 1,000 cells per well in culture plates, with 3 parallel wells per day, and incubated at 37°C in a 5% CO2 incubator. Starting from the day of seeding (recorded as day 0), samples were taken at fixed times each day, and 3 parallel wells at the corresponding time points were collected. After discarding the old culture medium, the cells were washed 3 times with PBS, digested with 0.25% trypsin until the cells detached from the cell wall, and then the digestion was stopped by adding an equal volume of special culture medium and pipetting to form a single-cell suspension. Cells were counted using a hemocytometer, and the data from the parallel wells were recorded daily. A scatter plot was plotted using GraphPad Prism with culture time on the x-axis and average cell concentration on the y-axis, marking each growth stage (lag phase, logarithmic growth phase, stationary phase) and error bars. The resulting cell growth curves conformed to the cell growth pattern: 0-4 days were the lag phase, 5-9 days were the logarithmic growth phase, and day 10 was the stationary phase (e.g., ...). Figure 6 ).
[0036] (2) Passage of Cg-like cells: Take Cg-like cells that have grown to 80%-90% confluence (e.g., Figure 7 Discard the old culture medium, wash three times with PBS, add an appropriate amount of 0.25% trypsin-EDTA digestion solution, incubate at 37°C until the cells detach from the cell wall, add serum-containing culture medium to stop digestion, pipette to prepare a single-cell suspension, centrifuge (300xg, 5 minutes) and discard the supernatant, resuspend the cells with fresh culture medium, seed them into new culture dishes at an appropriate ratio, and place them in an incubator for continued culture.
[0037] (3) Cryopreservation and thawing of Cg-like cells: After digestion and centrifugation according to the passage procedure, the cells were resuspended in cryopreservation solution (DMSO: fetal bovine serum = 1 mL: 9 mL) and the cell concentration was adjusted to 1 × 10⁻⁶.6 -1×10 7 Cells were aliquoted into cryovials at a density of 1 / mL and sequentially refrigerated at 4°C for 30 minutes, frozen at -20°C for 1 hour, and then at -80°C overnight before being transferred to liquid nitrogen for long-term storage. Upon thawing, the cryovials were removed from the liquid nitrogen and quickly placed in a 37°C water bath with rapid shaking until completely thawed. Under aseptic conditions, the cell suspension was transferred to centrifuge tubes, an appropriate amount of preheated culture medium was added, and the cells were centrifuged (300xg, 5 minutes). The supernatant was discarded, and the cells were resuspended in fresh, dedicated culture medium. The cells were then seeded into culture dishes and incubated in a 37°C, 5% CO2 incubator. After 24 hours, the culture medium was replaced to remove residual DMSO.
[0038] Example 4: Validation of Cg-like cell function (1) Cell treatment: Cg-like cells (experimental group) and rumen epithelial cell line (control group) obtained by sorting were seeded into 6-well plates (seedling density 1×10⁶ cells / well). 5 (10 mM SCFA mixture (acetic acid:propionic acid:butyric acid = 65:25:10)) After the cells adhered to the culture medium, 10 mM SCFA mixture was added and cultured at 37°C for 12 hours.
[0039] (2) RNA extraction and reverse transcription: Discard the culture medium, add 1 mL of Trizol to each well to lyse the cells, and let stand at room temperature for 5 minutes; add 0.2 mL of chloroform, shake vigorously for 15 seconds, and centrifuge at 12,000 g for 15 minutes at 4℃; aspirate the supernatant, add an equal volume of isopropanol to precipitate the RNA, wash with 75% ethanol and dissolve in 20 μL of DEPC water; take 1 μg of RNA and reverse transcribe it using the PrimeScript RT kit (Takara, catalog number RR037A) under the following conditions: 42℃ for 30 minutes, 85℃ for 5 seconds, and store at 4℃.
[0040] (3) qPCR detection: The total reaction volume was 20 μL, and the components and contents of the system are shown in the table below: The specific primer sequences are shown in the table below: Reaction program: 95°C for 30 seconds, 40 cycles (95°C for 5 seconds, 60°C for 30 seconds).
[0041] Melting curve analysis: The relative gene expression levels were calculated using the 2^-ΔΔCt method. Results showed that the expression levels of GJA1, MCT1, AE2, NHE1, and HMGCS2 were increased in the Cg-like cell group compared to the control group, confirming that this cell subset possesses strong SCFA uptake characteristics (e.g., Figure 8 (As shown).
[0042] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A novel method for in vitro isolation and culture of rumen epithelial cells having strong absorption characteristics of short-chain fatty acids, characterized by, The method comprises the following steps: (1) Establishing a rumen epithelial cell line: take the cut and washed rumen tissue from the side of the rumen abdominal sac, digest with trypsin-EDTA solution, purify the primary cells by differential adhesion method, transfect with a simian virus 40 large T antigen (SV40T) carrying lentiviral vector, and screen with puromycin to establish an immortalized rumen epithelial cell line; (2) Sorting of rumen epithelial cells with short-chain fatty acid absorption characteristics: label with gap junction protein alpha 1 (GJA1) and keratin 6A (KRT6A) specific antibodies, and sort the double-positive cell population from the immortalized rumen epithelial cell line established in step (1) by flow cytometry; (3) Culture of rumen epithelial cells with short-chain fatty acid absorption characteristics: collect the double-positive cells in step (2) and place them in a 5% CO2, 37℃ constant temperature incubator for static culture; after the cell state is stable, replace the cell-specific culture medium, and subsequently replace the specific culture medium every 48 hours; (4) Functional verification of rumen epithelial cells with short-chain fatty acid absorption characteristics: select the rumen epithelial cell line and double-positive cells in the logarithmic growth phase, divide them into a control group and an experimental group, detect the expression of related absorption genes after short-chain fatty acid treatment.
2. The method for in vitro isolation and culture of novel rumen epithelial cells having strong absorption properties of short-chain fatty acids according to claim 1, characterized by, The washing reagent in the washing step of step (1) is 1×PBS, pH 7.4, containing 1000 IU / mL penicillin-G, 1 mg / mL streptomycin sulfate, 500 μg / mL gentamicin sulfate, and 25 μg / mL amphotericin B; the specific operation of the digestion step is to add trypsin to the tissue and place it in a 37℃, 150 rpm constant temperature shaker for 40 minutes of digestion, then add the termination medium (DMEM and fetal bovine serum in a volume ratio of 4:1) to terminate (trypsin volume: termination medium volume = 1:1); then add new trypsin solution every 5 minutes to digest and collect the primary rumen epithelial cells; the trypsin protease concentration is 0.25% (0.25 g trypsin is dissolved in 100 ml PBS) and the volume ratio of trypsin to tissue is 2:
1.
3. The method for in vitro isolation and culture of novel rumen epithelial cells having strong absorption characteristics of short-chain fatty acids according to claim 1, characterized by, The primary rumen epithelial cell culture medium consists of 45 mL of basal medium DMEM and 5 mL of fetal bovine serum, and contains 200 IU / mL penicillin-G, 200 µg / mL streptomycin sulfate, 100 μg / mL gentamicin sulfate, 5 μg / mL amphotericin B, 5 μg / mL bovine insulin, 10 ng / mL epidermal growth factor, and 10 μM Y-27632.
4. The method for in vitro isolation and culture of novel rumen epithelial cells having strong absorption characteristics of short-chain fatty acids according to claim 1, characterized by, In step (1), the lentivirus transfection conditions: pGMLV-SV40T-PURO lentivirus transfection of primary rumen epithelial cells for 18 hours at MOI=80; the rumen epithelial cell line culture medium contains 45 mL of DMEM / F12 basic medium, 5 mL of fetal bovine serum, and 1 mL of 1× penicillin-streptomycin double-antibiotic agent, and is cultured in half volume.
5. The method for in vitro isolation and culture of novel rumen epithelial cells having strong absorption properties of short-chain fatty acids according to claim 1, characterized by, In step (2), the step of sorting rumen epithelial cells with short-chain fatty acid absorption characteristics by flow cytometry is as follows: the rumen epithelial cell line cultured to 80% confluence is washed with 1x PBS for 3 times, digested with 0.25% trypsin for 3 minutes, and then the digestion is terminated, centrifuged at 300xg for 5 minutes, and the supernatant is discarded; the cells are resuspended with 1 mL of 1x flow cytometry antibody dilution buffer (10 mL of PBS + 0.5 g of bovine serum albumin), and the primary antibody (fluorescein AlexaFluor 647 labeled anti-GJA1 primary antibody, 0.4 μg per 10 6 cells) and the fluorescein Alexa Fluor 488 labeled anti-KRT6A (keratin 6A) primary antibody (0.5 μg per 10 6 cells) are added for incubation; the incubation is performed at 4°C in the dark for 30 minutes, centrifuged at 300xg for 5 minutes, and the supernatant is discarded; the cells are washed with 1 mL of 1x flow cytometry staining buffer, centrifuged at 300xg for 5 minutes, and the supernatant is discarded twice; the cells are resuspended with 500 uL of flow cytometry staining buffer (0.03 mL of fetal bovine serum in 1 mL of PBS) and filtered through a 40-μm cell strainer; the sorting parameters (70-μm nozzle, 20-psi sheath pressure) are set on the flow cytometer, and the debris and doublet cells are excluded by FSC / SSC gating, and finally the double-positive cell population expressing both GJA1 and KRT6A is sorted out; the double-positive cells obtained by sorting are inoculated in a culture dish; and when the cells reach 80% confluence, they are used for subsequent experiments or cryopreserved.
6. The method for in vitro isolation and culture of novel rumen epithelial cells having strong absorption properties of short-chain fatty acids according to claim 1, characterized by, In step (3), the initial culture medium is used when the first collection of double-positive cells is cultured, and the components are 79 mL of DMEM-F12 basic medium, 20 mL of fetal bovine serum, and 1 mL of 1× penicillin-streptomycin double-antibiotic agent; cell stabilization refers to cells with a cell adhesion rate of ≥80% and normal morphology without shrinkage, which can grow stably and normally experience the lag phase, logarithmic growth phase, and stationary phase; the specific culture medium used after cell stabilization and subsequent culture contains 45 mL of DMEM-F12 basic medium, 5 mL of fetal bovine serum, and 1 mL of 1× penicillin-streptomycin double-antibiotic agent.
7. The method for in vitro isolation and culture of novel rumen epithelial cells with strong absorption properties of short-chain fatty acids according to claim 1, characterized in that, Short-chain fatty acid treatment refers to the addition of 10 mM SCFA mixed solution (acetic acid: propionic acid: butyric acid = 65 mM: 25 mM: 10 mM) to the culture medium and incubation at 37°C for 12 hours.
8. The method for in vitro isolation and culture of novel rumen epithelial cells having strong absorption properties of short-chain fatty acids according to claim 1, characterized by, The specific primers of short-chain fatty acid absorption-related genes GJA1, MCT1, AE2, NHE1, and HMGCS2 are as follows: GJA1 upstream primer sequence (5'-3'): SEQ ID NO. 1 : TGCTTGTCGTGTCATTGGTGTC, downstream primer sequence (5'-3'): SEQ ID NO. 2: GTAGTGTGGTAAGGATCGCTCTTTC; MCT1 upstream primer sequence (5'-3'): SEQ ID NO. 3: CTGCACAACAGTTTCCCGTG, downstream primer sequence (5'-3'): SEQ ID NO. 4: CTGTCTGGCTGAACGGTCTT; AE2 upstream primer sequence (5'-3'): SEQ ID NO. 5: GTGTCAAGGAGCAGCGTGTTAC, downstream primer sequence (5'-3'): SEQ ID NO. 6: CAGCACAGCAACAGGAACTTCTC; NHE1 upstream primer sequence (5'-3'): SEQ ID NO. 7: GAAACCCGTACAGCAGCAAGC, downstream primer sequence (5'-3'): SEQ ID NO. 8: GCCATTGACAGGTGAGCACATC; HMGCS2 Upstream primer sequence (5'-3'): SEQ ID NO. 9: CTCTTCCAGGATTCAGGCAACAC, downstream primer sequence (5'-3'): SEQ ID NO. 10: TTCCATCCAGTTGGCAGCATTG.
9. A novel rumen epithelial cell based on claims 1-11, characterized by, The cell has a purity of ≥90% and can be stably subcultured.
10. The cell obtained in claims 1-12 is used in rumen epithelial cell heterogeneity, short-chain fatty acid absorption mechanism, and functional feed additive screening.