Pepper promoter CanASP28 and application thereof

Abstract

The invention relates to a pepper promoter CanASP28 and application thereof, and belongs to the technical field of gene engineering. The nucleotide sequence of the pepper promoter CanASP28 is shown as SEQ ID NO.5, and the pepper promoter CanASP28 can drive specific expression of anther in plants, can be used for creating male sterile lines, crop hybrid seed production and crop crossbreeding, can improve the seed purity and hybrid seed production and crossbreeding efficiency, and can be applied to the field of plant breeding. Therefore, an effective tool gene is provided for anther specific expression regulation and pollen expression regulation of pepper and other solanaceae crops.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a chili pepper promoter CanASP28 and its applications. Background Technology

[0002] Plant promoters are a class of DNA sequences that regulate the initiation of gene transcription, and their specific expression characteristics have important applications in crop genetic improvement. Anther-specific promoters can drive the specific expression of target genes in anther tissues and are widely used in the construction of male-sterile lines, hybrid seed production, pollen fertility regulation, and biosafety control. Currently, anther-specific promoters have been reported in crops such as rice, maize, and Arabidopsis thaliana, but they are still very scarce in pepper.

[0003] Currently, commonly used anther promoters are mostly derived from model plants or other crops, such as rice OsIPA and maize Zm13. However, these promoters have problems such as low expression efficiency, poor tissue specificity, and weak species adaptability in peppers, making it difficult to achieve precise anther-directed expression in peppers. This fails to meet the needs of precise regulation of pollen fertility in pepper hybridization breeding and greatly limits their application in pepper molecular breeding. Summary of the Invention

[0004] The purpose of this invention is to provide a chili pepper promoter CanASP28 and its applications, providing an effective tool gene for the creation of male-sterile lines in chili peppers, hybridization breeding, and pollen fertility regulation.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a chili pepper promoter CanASP28, which has the characteristic of anther-specific expression, and its nucleotide sequence is shown in SEQ ID NO.5.

[0006] The present invention also provides primer pairs for amplifying the anther-specific promoter CanASP28 of the pepper, the nucleotide sequences of which are shown in SEQ ID NO.6-7.

[0007] The present invention also provides an expression cassette with anther-specific expression characteristics, which contains the pepper promoter CanASP28.

[0008] The present invention also provides an expression carrier, the expression carrier comprising the expression cassette described above.

[0009] The present invention also provides a genetically engineered bacterium, wherein the genetically engineered bacterium contains the expression vector described above.

[0010] This invention also provides the application of the above-mentioned pepper promoter CanASP28, or expression cassette, or expression vector, or genetically engineered bacteria in driving anther expression.

[0011] This invention also provides the application of the above-mentioned pepper promoter CanASP28, expression cassette, expression vector, or genetically engineered bacteria in the creation of male-sterile lines.

[0012] This invention also provides the application of the above-mentioned chili promoter CanASP28, or expression cassette, or expression vector, or genetically engineered bacteria in crop seed production and / or breeding.

[0013] This invention also provides the role of the above-mentioned pepper promoter CanASP28, or expression cassette, or expression vector, or genetically engineered bacteria in regulating pollen fertility.

[0014] The present invention has the following technical effects and advantages: This invention is the first to identify the anther-specific promoter CanASP28 in chili peppers, which can drive anther-specific expression in plants. It can be used to create male-sterile lines, crop hybrid seed production, and crop hybrid breeding, and can improve seed purity, hybrid seed production, and hybrid breeding efficiency. Thus, it provides an effective tool gene for the regulation of anther-specific expression and pollen expression in chili peppers and other Solanaceae crops. Attached Figure Description

[0015] Figure 1 The results of qRT-PCR for the pepper promoter CanASP28 are shown in the figure. In the figure, 4R, 4S, and 4L are the root, stem, and leaf tissues of pepper after 4 weeks of growth, respectively; 10R, 10S, and 10L are the root, stem, and leaf tissues of pepper after 10 weeks of growth, respectively; FL1 and FL2 are the leaf tissues at the bud stage and full bloom stage, respectively; and FR1, FR2, FR3, and FR4 are the root tissues at the fruit setting stage, green ripening stage, color changing stage, and full ripening stage, respectively. Figure 2 Electrophoretic detection results for the chili pepper promoter CanASP28; Figure 3 The spectrum of the CanASP28-GUS vector; Figure 4 The colony PCR results for Escherichia coli DH5α strain are positive. Figure 5 The identification results are for T1 generation positive Arabidopsis thaliana plants; Figure 6 The results of GUS histochemical staining are for homozygous transgenic Arabidopsis thaliana lines. Detailed Implementation

[0016] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0017] In the test materials of this invention, the ST-8 variety of chili pepper was obtained from Huazhong Agricultural University; In the reagents of this invention, SuperScript TM II reverse transcriptase was purchased from Invitrogen, USA, and qPCR SYBR Green Master Mix was purchased from Nanjing Novizan Biotechnology Co., Ltd. In the instrument used in this invention, the Lightcycle 480 quantitative PCR instrument was purchased from Roche, Switzerland.

[0018] Example 1: Expression pattern of the chili pepper promoter CanASP28 I. RT-qPCR was used to demonstrate that the CanASP28 gene is a flower organ-specific highly expressed gene.

[0019] RNA extraction from pepper tissues: RNA was extracted from root tissues (4R), stem tissues (4S), and leaf tissues (4L) of pepper plants using the Trizol method. RNA was also extracted from root tissues (10R), stem tissues (10S), and leaf tissues (10L) after 10 weeks of growth, as well as from leaf tissues at the bud stage (FL1), full bloom stage (FL2), fruit set stage (FR1), green maturity stage (FR2), color change stage (FR3), and fully mature stage (FR4). Specific steps included: (1) Grind the plant tissue sample thoroughly in a mortar pre-cooled with liquid nitrogen.

[0020] (2) Take 500 µL of sample into a 2 mL centrifuge tube pre-cooled with liquid nitrogen, add 1 mL of Trizol, and mix using a vortex mixer. Vortex for 4 min at a frequency of 30 Hz.

[0021] (3) After adding 200 µL of chloroform, grind the sample with a grinder for 1 min at a frequency of 30 Hz and let it stand for 5 min.

[0022] (4) Centrifuge for 10 min using a low-temperature centrifuge (4℃, 12000 rpm / min).

[0023] (5) Take the supernatant into a new 2 mL centrifuge tube, add an equal volume of chloroform, grind with a grinder for 1 min at a frequency of 20 Hz, and let stand for 5 min.

[0024] (6) Centrifuge for 10 min using a low-temperature centrifuge (4℃, 12000 rpm / min).

[0025] (7) Take the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix by inverting the tube, and place it in a -20℃ refrigerator for 1 h.

[0026] (8) Centrifuge for 10 min using a low-temperature centrifuge (4℃, 12000 rpm / min).

[0027] (9) Discard the supernatant, add 1 mL of 75% ethanol, and rinse the precipitate by inverting the container. After a short centrifugation, discard the supernatant.

[0028] (10) After drying, add 50 µL of RNase-free ddH2O, dissolve completely, and store at -80℃. II. qRT-PCR Validation: Each sample at different developmental stages was subjected to at least two biological replicates, and each biological replicate in the qRT-PCR reaction was subjected to three technical replicates. First-strand cDNA was synthesized by reverse transcription of 1 µg total RNA using SuperScript™ II reverse transcriptase (Invitrogen). qRT-PCR reactions were performed in a Lightcycle 480 quantitative PCR instrument (Roche), and the qPCR reagent SYBR Green Master Mix was purchased from Novizan Biotechnology Co., Ltd. Sample homogenization was performed using the pepper internal control gene Actin, and the abundance of transcripts in the samples was relatively quantified using the double-Δ method. Primers and results are shown in Table 1 and [Table data missing]. Figure 1 As shown.

[0029] Table 1. Primers related to qRT-PCR Gene Primer sequence (5'-3') SEQ ID NO. CanASP28 F: GGCTCTTGTTTTCGTTGTCGT 1 R: TGGTGAACTTGCTTCACTTGC 2 Actin F: GAGGGTGAGTGAGCAGTTC 3 R: CTTCATCGTCATCTGCTGTC 4 The results showed that the pepper promoter CanASP28 is a flower organ-specific promoter with high expression.

[0030] Example 2: Acquisition and Analysis of the Chili Promoter CanASP28 Based on the pepper genome database (Sol Genomics Network), the promoter sequence of approximately 1500 bp upstream of the CanASP28 gene was obtained. PCR primers for amplifying the nucleotide sequence of the pepper promoter CanASP28 were designed, and the primer sequences are shown in Table 2. PCR amplification was performed using genomic cDNA extracted from ST-8 pepper variety using the CTAB method as a template. The PCR amplification system was 50 μL, including 25 μL of 2×Phanta Max Buffer, 1 μL of 10 mmol / L dNTP mix, 1 μL of Phanta Max Super-Fidelity DNA Polymera, 2 μL of genomic cDNA, 2 μL of CanASP28-F primer, 2 μL of CanASP28-R primer, and the remainder being deionized water. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min, followed by 95℃ denaturation for 30 s → 55℃ annealing for 30 s → 72℃ extension for 45 s, for a total of 35 cycles, and a final extension at 72℃ for 2 min, yielding the pepper promoter CanASP28 sequence (as shown in SEQ ID). As shown in NO.5, the electrophoresis detection results are as follows: Figure 2 As shown; SEQ ID NO.5: Table 2 Primers for amplifying the CanASP28 promoter in chili peppers name Primer sequence (5'-3') SEQ ID NO. F gtcgactctagaggatccccCTTGAAGTGAGTATCGTTGAATC 6 R acataagggactgaccacccCTTAAATTGATTTGATTTGTTGATT 7 The chili pepper promoter CanASP28 was extracted and purified using a DNA purification kit (Wuhan Jingyanchen Biotechnology Co., Ltd.). The vector plasmid pCAMBIA1305-GUS was digested with enzymes in a 20 μL volume, including 2 μL of 10×CutSmartBuffer, 1 μL of SmaI, 5 μL of pCAMBIA1305-GUS, and the remainder deionized water. The chili pepper promoter CanASP28 and pCAMBIA1305-GUS (linearized plasmid) were ligated using homologous recombination. The ligation reaction volume was 6 μL, including 3 μL of 2 x Exmax Universal CloneMix, 1 μL of purified product, and 2 μL of the digested plasmid. The reaction was carried out at 37 °C for 30 min in a PCR instrument to obtain the recombinant vector CanASP28::GUS.

[0031] After transforming the recombinant vector CanASP28::GUS into Escherichia coli DH5α strain, colony PCR was performed for positive identification. Plasmids were extracted from positive single colonies and sequenced by Beijing Qingke Biotechnology Co., Ltd. The results are as follows: Figures 3-4 As shown.

[0032] The results showed that the sequencing results were completely consistent with the expected vector sequence, indicating that the vector was successfully constructed.

[0033] Example 3: Arabidopsis transformation of the pepper promoter CanASP28 The CanASP28::GUS plasmid, which was correctly sequenced in Example 2, was transformed into Agrobacterium GV3101 strain. Arabidopsis thaliana was transformed using the Agrobacterium-mediated flower-dip method to obtain T1 generation Arabidopsis thaliana seeds. The specific steps included: (1) Scale-up culture: Take 3 mL of LB liquid medium (Kan + Rif resistance), add 60 μL of preserved Agrobacterium bacterial solution, and culture in a shaker at 28℃ and 220 r / min for 16 h. (2) Induction: Prepare 50 mL of induction solution (50 μL Rif, 50 μL Kan, 10 μL As, 1 mL Mes, 48.89 mL LB liquid medium). Take 500 μL of bacterial solution and add it to 50 mL of induction solution, and culture in a shaker at 28℃ and 220 r / min for 16 h. (3) Resuspension: Centrifuge the induced bacterial solution at 4000 r / min for 10 min, discard the supernatant, add an equal volume of 5% sucrose solution, vortex to mix, and adjust the OD600 value to 0.8 for later use. (4) Arabidopsis treatment: Cut off the existing pods of Arabidopsis and remove diseased plant debris. (5) Flower soaking: Add silwetL-77 to the resuspension bacterial solution to achieve a mass fraction of 0.05%, and stir evenly. Place Arabidopsis horizontally and insert the entire inflorescence into the bacterial solution, shaking the inflorescence for 30-60 seconds. After the flower soaking is completed, place the plant horizontally in a tray and culture in the dark overnight, followed by normal light culture (22℃, 60% humidity, 16 / 8h photoperiod). One week after the first flower soaking, perform the second flower soaking. After the Arabidopsis matures, collect the seeds into a clean 2mL centrifuge tube. These are T1 generation Arabidopsis seeds, and mix them for seed collection.

[0034] The collected seeds (T1 generation) were dried in a 37℃ oven for 12 hours to remove impurities. In a clean bench, the Arabidopsis seeds were treated with 75% ethanol for 5 minutes, followed by anhydrous ethanol for 5 minutes. The seeds were then transferred to sterile filter paper and allowed to dry before being spread on 1 / 2 MS medium (plant Kan resistance). The seeds were incubated at 4℃ in the dark for 48 hours, then transferred to a tissue culture room (22℃, 70% humidity, 16 / 8h photoperiod) under normal light for 10 days. The growth of the Arabidopsis seedlings was observed. Seedlings showing normal growth and green leaves were considered potential positive candidates and transplanted into nutrient soil for cultivation in a growth chamber (22℃, 60% humidity, 16 / 8h photoperiod).

[0035] To detect T1 generation transgenic Arabidopsis thaliana, DNA was extracted from individual T1 generation Arabidopsis thaliana plants. The CanASP28 promoter fragment of the target gene was used for PCR identification. The nucleotide sequences of the positive identification primers are shown in Table 3. The PCR system was 10 μL, including 5.0 μL of 2×EasyTaq PCR SuperMix, 0.5 μL of M13-47, 0.5 μL of GUS-R, 1.0 μL of the target gene, and the remainder being deionized water. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min, followed by 95℃ denaturation for 200 s → 55℃ annealing for 20 s → 72℃ extension for 50 s, for a total of 35 cycles, and a final extension at 72℃ for 1 min. The nucleotide sequences of the positive identification primers are shown in Table 3. The PCR identification results are as follows: Figure 5 As shown, the results indicate that T1 generation Arabidopsis thaliana seedlings with the CanASP28 promoter successfully transformed into pepper were obtained.

[0036] Seeds from individual T1 generation positive seedlings were collected to obtain T2 generation seeds. T2 generation seeds were spread on 1 / 2 MS medium (Kan resistant). Lines with a positive-to-negative seedling segregation ratio of 3:1 were considered monoclonal positive lines. These were transplanted and seeds were collected individually to obtain T3 generation seeds. T3 generation seeds were spread on 1 / 2 MS medium (Kan resistant). Lines with all positive seedlings were considered homozygous transgenic Arabidopsis lines and were transplanted into nutrient soil.

[0037] Table 3 Positive identification primers name Primer sequence (5'-3') SEQ ID NO. M13-47 CGCCAGGGTTTTCCCAGTCACGAC 8 Gus-R CTGAATGCCCACAGGCCG 9 Example 4: Histochemical staining of the GUS reporter gene The homozygous transgenic Arabidopsis lines obtained in Example 3 were subjected to GUS histochemical staining and incubated overnight at 37°C in the dark. After staining, the staining was removed with 75% alcohol, with the alcohol being replaced every 12 hours, until the material became translucent. The results are as follows: Figure 6 As shown.

[0038] The results showed that GUS signaling was specifically expressed only in anthers and not in other tissues, indicating that the pepper promoter CanASP28 can be specifically expressed in floral organs.

[0039] As can be seen from the above embodiments, this invention provides the application of the pepper promoter CanASP28 in driving anther expression. The pepper promoter CanASP28 of this invention can drive anther-specific expression in plants and can be used to create male-sterile lines, for crop hybrid seed production, and for crop hybrid breeding. It can improve seed purity, hybrid seed production, and hybrid breeding efficiency, thereby providing an effective tool gene for the regulation of anther-specific expression and pollen expression in peppers and other Solanaceae crops.

[0040] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A Capsicum annuum promoter, CanASP28, characterized in that, The pepper promoter CanASP28 has the characteristic of anther-specific expression, and its nucleotide sequence is shown as SEQ ID NO.

5.

2. A primer pair for amplifying the pepper anther-specific promoter CanASP28 of claim 1, characterized in that, The nucleotide sequences of the primer pair are shown as SEQ ID NO. 6-7.

3. An expression cassette comprising, The expression cassette has the characteristic of anther-specific expression, and contains the pepper promoter CanASP28 of claim 1.

4. An expression vector, characterized by, The expression vector comprises the expression cassette of claim 3.

5. A genetically engineered bacterium, characterized by, The genetically engineered bacteria comprise the expression vector of claim 4.

6. Application of the pepper promoter CanASP28 of claim 1 or the expression cassette of claim 3 or the expression vector of claim 4 or the genetically engineered bacteria of claim 5 in driving anther expression.

7. Application of the pepper promoter CanASP28 of claim 1 or the expression cassette of claim 3 or the expression vector of claim 4 or the genetically engineered bacteria of claim 5 in creating male sterile lines.

8. Application of the pepper promoter CanASP28 of claim 1 or the expression cassette of claim 3 or the expression vector of claim 4 or the genetically engineered bacteria of claim 5 in crop seed production and / or breeding.

9. Role of the pepper promoter CanASP28 of claim 1 or the expression cassette of claim 3 or the expression vector of claim 4 or the genetically engineered bacteria of claim 5 in regulating pollen fertility.

Images