Application of GhHB20 gene in regulation and control of drought stress resistance of cotton
By cloning and studying the GhHB20 gene and constructing recombinant vectors using gene editing technology, the overexpression or knockout of the GhHB20 gene in cotton was achieved, enhancing the cotton's resistance to drought stress, solving the technical problem of cotton's resistance to stress, and laying the foundation for cotton breeding.
Patent Information
- Application Number
- CN202610112434.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-27
- Publication Date
- 2026-03-06
AI Technical Summary
The lack of existing research on the association between the HD-Zip gene and cotton's resistance to drought stress has affected the improvement of cotton's ability to resist stress.
The molecular characteristics and functions of the GhHB20 gene were cloned and studied. Recombinant plant overexpression vectors were constructed using gene editing technology to overexpress or knock out the GhHB20 gene in order to regulate the drought stress resistance of cotton.
Overexpression of the GhHB20 gene enhanced the drought resistance of cotton, indicating that the GhHB20 gene plays an important regulatory role in the drought stress resistance of cotton, providing genetic resources and a breeding foundation for cotton stress resistance research.
Smart Images

Figure CN121610522A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and specifically relates to the application of the GhHB20 gene in regulating cotton's resistance to drought stress. Background Technology
[0002] Cotton belongs to the class Dicotyledonous plants, phylum Angiosperms, and is an annual herbaceous plant that prefers sunlight and heat and has a shrub-like growth habit. Currently, there are four cultivated cotton varieties worldwide: upland cotton, island cotton, Asian cotton, and wild cotton. Upland cotton has an extremely high yield, accounting for over 90% of the world's total cotton production, but its fiber quality is low. Island cotton has high fiber strength and longer fibers than upland cotton, but its yield is extremely low, accounting for only 8% of the world's total. As a highly marketable cash crop, cotton has a large industry and a complete industrial chain, and is widely used in textiles, defense, pharmaceuticals, and the automotive industry. Currently, 90% of my country's cotton is grown in Xinjiang, a region characterized by salinization and severe water shortage, requiring cotton varieties with high resistance to adverse conditions.
[0003] Drought is one of the most common abiotic stresses in plant growth and development. Plants can improve their drought tolerance through changes at different levels, including morphology, physiology, cellularity, and molecularity. HD-Zip transcription factors are transcription factors unique to higher plants discovered in recent years. These factors are classified into four subfamilies (family I, II, III, and IV) based on their gene conservation and structural characteristics. HD-Zip transcription proteins contain a highly conserved homeodomain (HD) and a leucine zipper domain (LZ). Studies have shown that in Arabidopsis thaliana, salt stress significantly increases the expression of HD-Zip class I genes such as AtHB-6, AtHB-12, and AtHB-21. AtHB13, a member of the Arabidopsis HD-Zip I subfamily, enhances drought tolerance by regulating the expression of AtJUB1. The ZmHOX32 gene in maize has also been shown to positively respond to drought stress and ABA induction.
[0004] However, there is currently a lack of research on the association between HD-Zip genes and cotton drought stress resistance. Therefore, exploring genes related to cotton drought stress resistance and studying their molecular characteristics and gene functions can lay the foundation for cotton stress resistance research, and is also of great significance for improving cotton drought stress resistance and increasing cotton yield. Summary of the Invention
[0005] To overcome the shortcomings of existing technologies, the primary objective of this invention is to provide the application of the GhHB20 gene in regulating cotton's resistance to drought stress. Experiments conducted in this invention have revealed that the GhHB20 gene has a regulatory function in cotton under drought stress, thus laying a solid foundation for research on cotton's resistance to stress and for plant breeding.
[0006] The second objective of this invention is to provide the application of the protein encoded by the GhHB20 gene in regulating cotton's resistance to drought stress.
[0007] A third objective of this invention is to provide the application of a recombinant plant overexpression vector containing the GhHB20 gene in regulating cotton's resistance to drought stress.
[0008] The fourth objective of this invention is to provide a method for breeding cotton varieties with enhanced resistance to drought stress.
[0009] To achieve the above objectives, the technical solution adopted by this invention is as follows:
[0010] The application of the GhHB20 gene in regulating cotton's resistance to drought stress, the nucleotide sequence of the coding region of the GhHB20 gene is shown in SEQ ID No. 1.
[0011] As a further improvement, the cotton is upland cotton.
[0012] As a further improvement, the regulation of cotton's resistance to drought stress includes: overexpressing the GhHB20 gene in cotton to obtain transgenic cotton with enhanced drought stress resistance; or knocking out the GhHB20 gene in cotton to obtain transgenic cotton with weakened drought stress resistance.
[0013] The application of the protein encoded by the GhHB20 gene in regulating cotton's resistance to drought stress, the amino acid sequence of which is shown in SEQ ID No. 2.
[0014] Application of recombinant plant overexpression vector containing GhHB20 gene in regulating cotton drought stress resistance, wherein the nucleotide sequence of the coding region of GhHB20 gene is shown in SEQ ID No. 1.
[0015] As a further improvement, the recombinant plant overexpression vector containing the GhHB20 gene is constructed by ligating the enzyme-digested plant overexpression vector pCAMBIA2300 with the GhHB20 gene.
[0016] A method for breeding a cotton variety with enhanced drought stress resistance includes the following steps:
[0017] (1) Construct a recombinant plant overexpression vector containing the GhHB20 gene; the nucleotide sequence of the coding region of the GhHB20 gene is shown in SEQ ID No. 1;
[0018] (2) The constructed overexpression recombinant vector was transformed into Agrobacterium to obtain the engineered Agrobacterium;
[0019] (3) The engineered Agrobacterium was transformed into cotton for overexpression to obtain cotton varieties with enhanced drought resistance.
[0020] As a further improvement, in step (1), a recombinant plant overexpression vector containing the GhHB20 gene is constructed. The specific process is as follows: the plant overexpression vector pCAMBIA2300 is digested with the restriction endonuclease KpnI, and then the GhHB20 gene is ligated with the digested plant overexpression vector to obtain the recombinant plant overexpression vector, named pCAMBIA2300-GhHB20.
[0021] As a further improvement, in step (2), the Agrobacterium is Agrobacterium strain GV3101.
[0022] As a further improvement, in step (3), Agrobacterium tumefaciens is transformed into cotton for overexpression. The specific process is as follows: using cotton shoot tips as explants, the explants are co-cultured with bacterial solutions containing activated Agrobacterium tumefaciens. Then, the explants are taken for rooting culture and screening and identification, so that the GhHB20 gene is overexpressed in cotton plants, thus obtaining cotton varieties with enhanced drought resistance.
[0023] The beneficial effects of the above-mentioned technical solution of the present invention include:
[0024] This invention successfully cloned the GhHB20 gene using upland cotton as the material, and systematically analyzed its molecular characteristics, expression patterns, and functions under abiotic stresses (drought and salt stress). The results showed that the full-length cDNA of the GhHB20 gene is 1023 bp, with an open reading frame (ORF) of 756 nucleotides encoding 251 amino acids, containing conserved HD and LZ domains. Tissue expression pattern analysis indicated that the GhHB20 gene was highly expressed in the roots, stems, and flowers of upland cotton. Salt and PEG treatments significantly increased the expression level of GhHB20 compared to the control, suggesting that GhHB20 may be involved in regulating the stress resistance response of upland cotton.
[0025] Furthermore, this invention utilizes gene editing technology to mutate and overexpress the GhHB20 gene. Results showed that after drought treatment, the GhHB20 mutant plants exhibited more severe wilting, lower leaf water content, a greater increase in malondialdehyde (MDA) content, and lower catalase activity compared to wild-type plants. Conversely, after overexpressing the GhHB20 gene and undergoing drought treatment, the overexpressing plants showed enhanced drought resistance, higher leaf water content, a smaller increase in MDA content, and higher catalase activity compared to wild-type plants.
[0026] Comprehensive research results indicate that GhHB20 mutation weakens the drought resistance of cotton, while overexpression of GhHB20 enhances it, suggesting that the GhHB20 gene plays a crucial regulatory role in cotton's drought stress resistance. Therefore, this invention, through cloning the upland cotton gene GhHB20 and exploring its expression under abiotic stress, and by studying its gene function using gene editing and overexpression technologies, can provide excellent genetic resources and basic materials for cotton stress resistance research, and also has broad application prospects in the field of cotton breeding. Attached Figure Description
[0027] Figure 1 The results of the protein conserved domain analysis of the GhHB20 gene in this invention;
[0028] Figure 2 The results show the relative expression levels of the GhHB20 gene in different cotton tissues in this invention.
[0029] Figure 3 The results show the relative expression levels of the GhHB20 gene under different abiotic stresses (salt and PEG) in this invention.
[0030] Figure 4 The results of the design of the knockout target and the determination of the editing type of the GhHB20 gene in this invention;
[0031] Figure 5 The results show the relative expression levels of the GhHB20 gene in wild-type and overexpression lines in this invention.
[0032] Figure 6 The results show the determination of drought resistance (including phenotype, relative moisture content, malondialdehyde content, and catalase activity) of cotton after GhHB20 gene mutation in this invention.
[0033] Figure 7 The results show the determination of drought resistance (including phenotype, relative moisture content, malondialdehyde content, and catalase activity) of cotton after overexpression of the GhHB20 gene in this invention. Detailed Implementation
[0034] The technical solution and technical effects of the present invention will be further described below with reference to specific embodiments and accompanying drawings. The following description is for illustrative purposes only and should not be construed as limiting the scope of protection of the present invention. Unless otherwise specified, the methods used in the following embodiments are conventional methods in the art.
[0035] In the following embodiments, the plant total RNA extraction kit and RNA reverse transcription kit were obtained from Beijing TransGen Biotech Co., Ltd., and were used according to the manufacturer's instructions. Unless otherwise specified, other reagents and raw materials used are conventional reagents or raw materials in the field and can be obtained from commercially available channels.
[0036] Example 1
[0037] This embodiment provides the application of the GhHB20 gene in regulating cotton's resistance to drought stress. The nucleotide sequence of the coding region of the GhHB20 gene is shown in SEQ ID No. 1; the amino acid sequence encoded by the GhHB20 gene is shown in SEQ ID No. 2; and the full length of the GhHB20 gene cDNA is shown in SEQ ID No. 3.
[0038] Specifically, in this embodiment, the cotton is upland cotton. Regulating the drought stress resistance of cotton includes: overexpressing the GhHB20 gene in cotton to obtain transgenic cotton with enhanced drought stress resistance; or knocking out the GhHB20 gene in cotton to obtain transgenic cotton with weakened drought stress resistance.
[0039] The technical effects achievable by the present invention will be described in detail below with reference to specific experimental examples.
[0040] Experimental Example 1: Cloning and Protein Domain Analysis of the GhHB20 Gene
[0041] This invention cloned the GhHB20 gene from the root tissue of upland cotton. The specific steps are as follows: RNA was extracted from the roots of upland cotton (specifically, Zhongmian 113) using a plant total RNA extraction kit, and then reverse transcribed into cDNA using an RNA reverse transcription kit. The obtained cDNA mixture was used as a template, and PCR amplification was performed using primers GhHB20-F and GhHB20-R (listed in Table 1). The PCR amplification program was: 94℃ for 45s, 60℃ for 45s, and 72℃ for 60s, for 30 cycles. The obtained PCR product was sequenced to confirm the target gene sequence. Further analysis of conserved domains of the target gene was performed using the NCBI CD-Search tool (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) to predict whether the GhHB20 gene protein contains a homeodomain (HD) and a leucine zipper domain (LZ).
[0042] Table 1. Primers for GhHB20 gene amplification
[0043] Primers Primer sequence 5'-3' GhHB20-F TCAACCATGAGAGCGTCAGTC (as shown in SEQ ID NO. 4) GhHB20-R TACATAATTAAGAACAATGTG (shown in SEQ ID NO. 5)
[0044] In the above experiments, the GhHB20 gene fragment was obtained by PCR amplification, and the target gene sequence was confirmed after cloning and sequencing. The results show that the GhHB20 gene was successfully cloned in this invention. The full-length cDNA of the GhHB20 gene is 1023 bp, and the open reading frame (ORF), i.e., the coding region, is 756 nucleotides long, encoding a total of 251 amino acids. Specifically, the coding region sequence of the GhHB20 gene is shown in SEQ ID NO. 1, the encoded amino acid sequence is shown in SEQ ID NO. 2, and the full-length cDNA of the GhHB20 gene is shown in SEQ ID NO. 3.
[0045] Furthermore, the conserved domains of the GhHB20 gene were analyzed using the CD-Search tool, and the results are as follows: Figure 1 As shown, amino acids 65-119 of the GhHB20 protein contain a conserved HD homology domain, and amino acids 120-160 contain a leucine zipper LZ domain, confirming that GhHB20 contains conserved HD and LZ domains and belongs to the cotton HD-Zip transcription factor.
[0046] Experimental Example 2: Tissue Expression and Gene Expression Analysis of GhHB20 Gene under Abiotic Stress
[0047] Using the main cultivated variety of upland cotton (Gossypium hirsutum) "Zhongmian 113" as the experimental material, roots, stems, leaves, petals, stamens, and fibers were collected as test samples at the cotton maturity stage; the collected materials were rapidly frozen in liquid nitrogen. The expression of the GhHB20 gene in different tissues and organs was analyzed by real-time quantitative PCR (qRT-PCR). Each experiment was repeated three times, and 2... -∆∆Ct The relative expression levels of the GhHB20 gene in different tissues of upland cotton were obtained by calculation.
[0048] Further, seeds of Zhongmian 113 were sterilized in 10wt% H2O2 and cultured in 1 / 2 MS medium for 7 days. The resulting seedlings were then subjected to salt (400mM NaCl) treatment and PEG 6000 (20%) drought simulation treatment, respectively. Specifically, cotton seedlings were transferred to MS medium containing 400mM NaCl and MS medium containing 20wt% polyethylene glycol 6000 (PEG 6000) for culture. Samples were collected at 0 (CK group), 1, 3, 6, 12, and 24 h, respectively. The expression of the GhHB20 gene under different stresses was analyzed by real-time quantitative PCR (qRT-PCR). Each experiment was repeated three times, and 2... -∆∆Ct The relative expression levels of upland cotton samples under different abiotic stresses (salt and PEG) were calculated using a computational method.
[0049] This experiment analyzed the expression of the GhHB20 gene in different tissues and organs using quantitative real-time PCR (qRT-PCR), and the results are as follows: Figure 2 As shown, the GhHB20 gene is highly expressed in cotton roots and stems, followed by fibers, while only a small amount is expressed in leaves, petals and stamens.
[0050] The expression of the GhHB20 gene in upland cotton under salt and PEG stress is as follows: Figure 3 As shown. Figure 3 In the table, A represents the expression analysis after salt stress; B represents the expression analysis after PEG stress. Statistical analysis of the experimental results was performed. **p < 0.01 indicates a significant difference between groups, and the same applies below.
[0051] Depend on Figure 3 It was found that the expression level of the GhHB20 gene initially increased and then slightly decreased after salt stress treatment, reaching its maximum at 6 hours post-treatment, followed by a slight decrease, with an overall upward trend. Under PEG-simulated drought conditions, the expression level also showed an upward trend, with a sharp increase at 3 hours post-treatment, a slight decrease at 6 hours, and then a gradual increase. These results indicate that salt and PEG-simulated drought treatments significantly promote the expression level of GhHB20.
[0052] Experimental Example 3: Gene Editing and Overexpression Vector Construction and Identification of Transgenic Plants
[0053] To verify the function of the GhHB20 gene, this invention simultaneously constructed a GhHB20 knockout mutant and an overexpression vector. The specific steps are as follows:
[0054] On one hand, single-stranded guide RNAs (sgRNAs) specifically targeting the target gene GhHB20 were designed using the CRISPR-P 2.0 online website. Two target sites were designed, as shown in Table 2, namely sgRNA1 and sgRNA2. The selected sgRNAs were biosynthesized and cloned into the pRGEB32 binary plasmid vector system to obtain the recombinant vector pRGEB32-GhHB20.
[0055] Table 2. GhHB20 gene target design
[0056] sgRNAs Sequence 5'-3' sgRNA1 TGCCCTCCTCAACTCTTCCA (shown as SEQ ID NO. 6) sgRNA2 TTGCAGTTGGCTAAGGACTT (shown in SEQ ID NO. 7)
[0057] On the other hand, the plant overexpression vector (pCAMBIA2300) was digested with the restriction endonuclease KpnI, and the PCR amplified fragment of the GhHB20 gene obtained in Experiment 1 was ligated with the digested overexpression vector to construct the recombinant overexpression vector pCAMBIA2300-GhHB20.
[0058] Next, the constructed recombinant vector pRGEB32-GhHB20 and recombinant overexpression vector pCAMBIA2300-GhHB20 were introduced into Agrobacterium tumefaciens strain GV3101, respectively. Subsequently, cotton was transformed using the Agrobacterium-mediated transformation method. The specific transformation steps were as follows: using the shoot tips of Zhongmian 113 as explants, Agrobacterium culture containing the aforementioned recombinant vector pRGEB32-GhHB20 and recombinant overexpression vector pCMBIA2300-GhHB20 were activated and cultured to OD. 600 The concentration was 0.4-0.5 to obtain activated Agrobacterium tumefaciens bacterial solution; the explants were then co-cultured with the activated Agrobacterium tumefaciens bacterial solution for 2 days, and then the explants were placed in the shoot tip meristem induction medium for about 30 days to induce budding. Finally, they were transferred to the rooting medium to obtain transgenic seedlings.
[0059] After obtaining transgenic seedlings, genomic DNA was extracted from leaves and amplified by PCR using primers for the CAS9 nuclease (CAS9-F and CAS9-R) as shown in Table 3 to preliminarily identify gene-edited transgenic plants. Based on positive CAS9 screening, PCR amplification was performed again using gene-specific primers (GhHB20-GSF and GhHB20-GSR) as shown in Table 3. The amplified products were then subjected to high-throughput sequencing. Successfully edited lines were propagated and homozygous generations were performed. Next-generation leaf DNA was extracted and amplified again by PCR using primers GhHB20-GSF and GhHB20-GSR. The products were then subjected to high-throughput sequencing. PCR products from homozygous lines were ligated into a T-vector for first-generation sequencing to identify the gene editing types at both target sites.
[0060] Table 3. Primers for GhHB20 gene editing detection
[0061] Primers Primer sequence 5'-3' CAS9-F TGAGCTTGCCACGTGTGTTA (shown in SEQ ID NO. 8) CAS9-R TTTGTTGGTCGCCGTTAGGA (shown in SEQ ID NO. 9) GhHB20-GSF CTCCATGAAGATCAAAATCAT (as shown in SEQ ID NO. 10) GhHB20-GSR TAGTTTCTTCAAGGCGTCATA (shown in SEQ ID NO. 11) CaMV 35S-F GACGCACAATCCCACTATCC (shown as SEQ ID NO. 12)
[0062] The results of the GhHB20 gene knockout target design and editing type determination are as follows: Figure 4 As shown. Figure 4 In the table, A represents the screening results of PCR amplification using primers for CAS9 nuclease; B represents the design of the GhHB20 gene editing target and the editing mutation types of the three mutants.
[0063] In this experiment, after obtaining transgenic seedlings, PCR amplification was performed using primers for the CAS9 nuclease. The results of screening for transgenic lines are as follows: Figure 4 As shown in A, the results indicate that this invention preliminarily identified five transgenic lines. Further, based on the positive CAS9 screening, gene-specific primers were used again for PCR amplification, and the amplified products were sequenced to identify the editing type of the target. The results of the GhHB20 gene editing target design and mutant editing mutation types are shown in Figure [Figure number missing]. Figure 4 As shown in B, the results indicate that three cotton mutant lines were finally obtained, named ghhb20-mr1, ghhb20-mr2 and ghhb20-mr3, respectively. First-generation sequencing results show that the editing types of the three mutants are deletions of one or more bases.
[0064] Similarly, the overexpressing plants were also propagated and multiplied. For identification, PCR amplification and screening were first performed using CaMV 35S-F primers on the vector and GhHB20-GSR primers for the GhHB20 gene. Then, the relative expression level of the GhHB20 gene in wild-type plants and overexpressing lines was analyzed by real-time quantitative PCR (qRT-PCR).
[0065] Experiments showed that PCR amplification using CaMV 35S-F primers and GhHB20 gene primers yielded five overexpressing transgenic lines, named ghhb20-oe1, ghhb20-oe2, ghhb20-oe3, ghhb20-oe4, and ghhb20-oe5. The relative expression levels of the GhHB20 gene in wild-type cotton 113 and the overexpressing lines were then investigated using quantitative real-time PCR (qRT-PCR), with results as follows: Figure 5 As shown, the results indicated that the expression level of the GhHB20 gene was significantly increased in the five overexpression lines ghhb20-oe1, ghhb20-oe2, ghhb20-oe3, ghhb20-oe4 and ghhb20-oe5 (p < 0.01).
[0066] Experiment Example 4: Drought Treatment and Physiological Data Analysis
[0067] Wild-type cotton (WT) of Zhongmian 113 and cotton mutants (ghhb20-mr1, ghhb20-mr2 and ghhb20-mr3) obtained in Experiment 3, as well as overexpressing cotton (ghhb20-oe1, ghhb20-oe2 and ghhb20-oe3), were cultured normally in a smart greenhouse (25-26℃, 14h light / 10h darkness). After 20 days of growth, normal watering (Mock) and natural drought (Drought) treatments were applied, respectively. After 14 days of treatment, plant phenotypes were observed, and the relative water content (RWC), malondialdehyde (MDA) content and catalase (CAT) activity of leaves were measured.
[0068] Specifically, for the relative water content test, fresh leaves were cut from the plant, and the fresh weight (FW) was recorded immediately. Each leaf was then soaked in distilled water in the dark for 8 hours, and its swelling weight (TW) was measured. After drying the samples to a fixed weight at 65°C, the dry weight (DW) was recorded. The formula for calculating relative water content (RWC) is: RWC (%) = (FW - DW) / (TW - DW) × 100%. Additionally, malondialdehyde (MDA) content and catalase (CAT) activity were determined using MDA and CAT assay kits. For this part of the experiment, three biological replicates were used, with each replicate containing leaves from at least 15 plants corresponding to data for each category.
[0069] The results of the determination of drought resistance in cotton after GhHB20 gene mutation are as follows: Figure 6 As shown. Figure 6In the table, A represents the phenotypes of wild-type plants (WT) and GhHB20 gene mutants ghhb20-mr1 and ghhb20-mr2 after 14 days of normal watering (Mock) and drought stress (Drought); B to D represent the relative water content (RWC), malondialdehyde (MDA) content, and catalase (CAT) activity of cotton leaves cultured under normal and water-deficient conditions, respectively, for wild-type plants (WT) and GhHB20 gene mutants ghhb20-mr1, ghhb20-mr2, and ghhb20-mr3. Figure 6 In this study, data are expressed as mean plus the standard deviation of three independent experiments, and statistical analysis was performed using one-way ANOVA.
[0070] like Figure 6 As shown, wild-type cotton and three mutant lines were subjected to drought treatment. After 14 days of treatment, the mutant cotton plants showed more severe wilting compared to the wild-type cotton plants (A). Furthermore, the relative leaf water content (RWC) was measured. It was found that under normal irrigation conditions, the relative leaf water content of both types was almost the same, but after drought treatment, the relative leaf water content of the transgenic cotton plants decreased significantly (B). Further analysis of malondialdehyde (MDA) content and catalase (CAT) activity in the leaves of wild-type cotton and the three mutant lines under normal and drought conditions showed that under normal conditions, the MDA content of transgenic cotton was lower than that of wild-type cotton; after drought treatment, the MDA content of both types increased, but the increase was greater in transgenic cotton (C). In addition, after drought treatment, the catalase activity of the mutant cotton was lower than that of the wild-type cotton (D), reflecting a weakened ability to scavenge hydrogen peroxide.
[0071] Furthermore, the results of the drought resistance test of cotton after GhHB20 gene overexpression are as follows: Figure 7 As shown. Figure 7 In the table, A represents the phenotypes of wild-type plants (WT) and GhHB20 overexpression lines ghhb20-oe1 and ghhb20-oe2 after 14 days of normal watering (Mock) and drought stress (Drought); B to D represent the relative water content (RWC), malondialdehyde (MDA) content, and catalase (CAT) activity of leaves of wild-type plants (WT) and GhHB20 overexpression lines ghhb20-oe1, ghhb20-oe2, and ghhb20-oe3 cultured under normal and water-deficient conditions, respectively. Figure 7 In this study, data are expressed as mean plus the standard deviation of three independent experiments, and statistical analysis was performed using one-way ANOVA.
[0072] like Figure 7As shown, after drought treatment, the overexpression lines ghhb20-oe1 and ghhb20-oe2 exhibited less wilting compared to wild-type cotton plants (A). Physiological data indicated that, compared to wild-type cotton plants, the overexpression plants had higher leaf water content, less increase in malondialdehyde content, and higher catalase activity (B-D).
[0073] The combined data show that the drought resistance of cotton plants is weakened after GhHB20 mutation, while the drought resistance of overexpressing plants is enhanced after GhHB20 gene overexpression, indicating that the GhHB20 gene plays an important regulatory role in the drought stress of cotton.
[0074] In summary, the present invention cloned the GhHB20 gene from upland cotton. GhHB20 encodes 251 amino acids, and the protein contains conserved HD and LZ domains, belonging to the HD-Zip I class of transcription factors. Tissue expression analysis showed that the expression level of the GhHB20 gene was high in cotton roots and stems, followed by fibers; after treatment with salt and PEG, the expression level of GhHB20 was significantly increased. By constructing gene editing and overexpression vectors and transforming cotton, three mutant lines and five overexpression lines were obtained. After drought treatment, it was found that the drought resistance of the mutant cotton was weakened, while the drought resistance of the overexpression cotton was enhanced, indicating that the GhHB20 gene plays an important regulatory role in the drought stress resistance of cotton.
[0075] Therefore, this invention clones the upland cotton gene GhHB20, explores its expression differences under abiotic stress, and studies the function of the GhHB20 gene in cotton under drought stress using gene editing and overexpression technologies. This can lay a solid material foundation for the study of cotton stress resistance and cotton breeding technology.
[0076] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. These modifications or substitutions do not cause the essence of the corresponding technical solutions to depart from the spirit and scope of the present invention.
Claims
1. Application of GhHB20 gene in regulating cotton drought stress resistance, characterized in that, The nucleotide sequence of the coding region of the GhHB20 gene is shown as SEQ ID No.
1.
2. The use of GhHB20 gene in regulating drought stress resistance of cotton according to claim 1, characterized in that, The cotton is Gossypium hirsutum.
3. The use of GhHB20 gene in regulating drought stress resistance of cotton according to claim 1, characterized in that, The method for regulating drought stress resistance of cotton comprises: overexpressing the GhHB20 gene in cotton to obtain transgenic cotton with enhanced drought stress resistance; or knocking out the GhHB20 gene in cotton to obtain transgenic cotton with weakened drought stress resistance.
4. The application of the coding protein of GhHB20 gene in regulating cotton drought stress resistance, characterized in that, The amino acid sequence of the encoded protein of the GhHB20 gene is shown as SEQ ID No.
2.
5. The application of the recombinant plant overexpression vector containing the GhHB20 gene in regulating the drought stress resistance of cotton, characterized in that, The nucleotide sequence of the coding region of the GhHB20 gene is shown as SEQ ID No.
1.
6. The application of the recombinant plant overexpression vector containing the GhHB20 gene in regulating drought stress resistance of cotton according to claim 5, characterized in that, The recombinant plant overexpression vector containing the GhHB20 gene is constructed by connecting the plant overexpression vector pCAMBIA2300 after enzyme digestion with the GhHB20 gene.
7. A method of breeding a drought stress enhanced cotton variety, characterized in that, The method comprises the following steps: (1) constructing a recombinant plant overexpression vector containing the GhHB20 gene; the nucleotide sequence of the coding region of the GhHB20 gene is shown as SEQ ID No. 1; (2) transforming the constructed overexpression recombinant vector into Agrobacterium to obtain Agrobacterium engineering bacteria; (3) transforming the Agrobacterium engineering bacteria into cotton for overexpression to obtain a cotton variety with enhanced drought stress resistance.
8. The method of breeding a drought stress enhanced cotton variety according to claim 7, wherein, In step (1), the recombinant plant overexpression vector containing the GhHB20 gene is constructed by using the restriction enzyme KpnI to digest the plant overexpression vector pCAMBIA2300, and then connecting the GhHB20 gene with the digested plant overexpression vector, so as to obtain the recombinant plant overexpression vector, which is named as pCAMBIA2300-GhHB20.
9. The method of breeding a drought stress enhanced cotton variety according to claim 7, wherein, In step (2), the Agrobacterium is Agrobacterium strain GV3101.
10. The method of breeding a drought stress enhanced cotton variety according to claim 7, wherein, In step (3), the Agrobacterium engineering bacteria are transformed into cotton for overexpression, and the specific process is as follows: taking the cotton stem tip as the explant, co-culturing the explant with the bacterial liquid containing the activated Agrobacterium engineering bacteria, then taking the explant for rooting culture and screening and identification, so as to overexpress the GhHB20 gene in the cotton plant, and thus the cotton variety with enhanced drought stress resistance is obtained.