Application of methylmalonyl coenzyme A mutase protein in preparation of medicine for treating eosinophilic nasal polyp

Abstract

The invention discloses an application of methylmalonyl coenzyme A mutase protein in preparation of a medicine for treating eosinophilic nasal polyp. The amino acid sequence of a small subunit PPA0595 of the methylmalonyl coenzyme A mutase protein is shown as SEQ ID NO: 1, and the amino acid sequence of a large subunit PPA0596 of the methylmalonyl coenzyme A mutase protein is shown as SEQ ID NO: 2. By inhibiting the phosphorylation level of nasal mucosa epithelial cells STAT3, eoxin-1 and eoxin-2 chemotactic factors of eoxin-1 and eoxin-2 are down-regulated, then infiltration of eoxin-1 is reduced, type II inflammatory reaction is relieved, the treatment effect on eoxin-1 and eoxin-2 is achieved, and a brand-new view angle and a brand-new target spot are provided for treatment of nasal polyp.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of methylmalonyl-CoA mutase protein in preparation of a drug for treating eosinophilic nasal polyps. BACKGROUND

[0002] Chronic rhinosinusitis (CRS) is a heterogeneous inflammatory disease caused by multiple factors occurring in the nasal and sinus mucosa. At present, according to whether there is a nasal polyp in the middle nasal meatus, it can be divided into two types, chronic rhinosinusitis without nasal polyps (CRSsNP) and chronic rhinosinusitis with nasal polyps (CRSwNP). Among them, CRSwNP is a benign edema of the sinus mucosa, with an incidence of 2.7%, and is more common in men and asthma patients; CRSwNP significantly affects the quality of life of patients, consumes a large amount of medical and health resources, and causes great spiritual and economic burden to the country and patients. CRSwNP is mainly manifested as type 2 immune response-based eosinophilic inflammation.

[0003] Clinically, nasal spray or oral glucocorticoid and other drug treatments are still the first-line treatment for CRSwNP, which can effectively relieve or eliminate the nasal symptoms of patients and reduce the size of nasal polyps, but some patients still have poor effects on hormone therapy. For these patients, surgical treatment is needed. Although surgical treatment can play a role in opening the sinus and unobstructed drainage, but still 20-50% of patients have postoperative recurrence. Although the incidence of eosinophilic inflammation is different between white people and Asian CRSwNP patients, eosinophilic inflammation is always associated with higher disease severity and poorer surgical prognosis in these two groups of people. Therefore, it is of important clinical translation significance to clarify the related factors of eosinophilia in CRSwNP and to develop new therapeutic drugs for nasal polyp eosinophilic inflammation.

[0004] Many cytokines, chemokines and immunoglobulins are involved in the migration, survival and activation of eosinophils in CRSwNP. Epithelial cell-derived eosinophil chemotactic proteins eotaxin-1 (CCL11) and eotaxin-2 (CCL24) play an important role in initiating and promoting type 2 immune response and eosinophilic inflammation in CRSwNP, but the specific regulatory mechanism of eotaxin-1 and eotaxin-2 secreted by epithelial cells still needs further study.

[0005] Propionibacterium acnes is a gram-positive bacterium of the genus Propionibacterium in the phylum Actinobacteria, which is a resident commensal of human skin and an opportunistic pathogen of skin inflammation. It can promote sebum secretion, stimulate keratinocytes to overproduce keratin, aggravate inflammation, and cause comedones and papules. It is also a resident bacterium of human nasal and sinus mucosa, which can be detected in 90% of nasal mucosa samples. There is no report on the role of P. acnes in regulating the inflammatory response of the nasal mucosa of CRSwNP patients, especially Eos-CRSwNP patients characterized by type 2 inflammation. SUMMARY

[0006] The application provides the application of methylmalonyl-CoA mutase protein in the preparation of a drug for treating eosinophilic nasal polyps, solves the treatment problem of respiratory tract inflammatory diseases, and discloses the difference in the colonization abundance of P. acnes in CRS and normal people, and for the first time finds that the methylmalonyl-CoA mutase protein of P. acnes can down-regulate eotaxin-1 (CCL11) and eotaxin-2 (CCL24) by inhibiting the STAT3 phosphorylation level of nasal mucosa epithelial cells, thereby providing a brand-new perspective and target for the treatment of nasal polyps.

[0007] To achieve the above object, the application adopts the following technical scheme: The application provides the application of methylmalonyl-CoA mutase protein in the preparation of a drug for treating eosinophilic nasal polyps, and the amino acid sequence of the small subunit PPA0595 of the methylmalonyl-CoA mutase protein is as shown in SEQ ID NO: 1, and the amino acid sequence of the large subunit PPA0596 is as shown in SEQ ID NO: 2.

[0008] In the above technical scheme, the methylmalonyl-CoA mutase protein is derived from P. acnes.

[0009] In the above technical scheme, the drug is one of a nebulizer, a spray, a suspension and an irrigation agent.

[0010] In the above technical scheme, the methylmalonyl-CoA mutase protein down-regulates eotaxin-1 and eotaxin-2 by inhibiting the STAT3 phosphorylation level of nasal mucosa epithelial cells, thereby reducing the infiltration of eosinophils and reducing type 2 inflammation, and thus achieving the treatment effect on eosinophilic nasal polyps.

[0011] In the above technical scheme, the preparation method of the methylmalonyl-CoA mutase protein is as follows: (1) The nucleotide sequence of the PPA0595 protein coding region is transferred to a vector to construct an expression vector; (2) the expression vector is transfected into engineering bacteria, and the transformed bacterial liquid is coated on a LB agar plate resistant to KanR, and the competent cells are picked up on the next day and transferred to a liquid culture medium for amplification; (3) plasmids are extracted from the amplified bacteria, and whether the coding fragment of the target gene is successfully inserted is identified; (4) the bacteria successfully constructed are transferred to a liquid culture medium for culture, and when the OD value is 0.5-0.8, IPTG is added for induction; (5) after induction is completed, the bacterial liquid is centrifuged to obtain a precipitate, which is washed and resuspended in Lysis buffer, and then lysed on ice and broken by ultrasonic; (6) the broken bacterial liquid is collected, centrifuged, and the supernatant is collected, which is the methylmalonyl-CoA mutase protein; (7) the methylmalonyl-CoA mutase protein is subjected to purification treatment.

[0012] In the above technical scheme, in step (1), the vector is a pET28a vector, and the insertion site is 5'NcoI / Xhol3'.

[0013] In the above technical scheme, in step (2), the engineering bacteria are BL21-DE3.

[0014] The present application has the following advantages: 1. The protein of the present application is derived from the common nasal cavity symbiotic bacteria Propionibacterium acnes, and has better effect and safety than bacterial preparations, and has small adverse reactions.

[0015] 2. The protein of the present application can be prepared by using Escherichia coli BL21-DE3, and is easy to obtain and can be produced in large quantities.

[0016] 3. The protein of the present application can down-regulate eotaxin-1 (CCL11) and eotaxin-2 (CCL24) by inhibiting the phosphorylation level of STAT3 of nasal mucosa epithelial cells, so as to be used for treating nasal polyps, and is suitable for various products such as nasal sprays, atomizing agents, nose drops and irrigation agents, and is convenient for administration and easy for patients to use. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 : The epithelial colonization of Propionibacterium acnes in CRSwNP patients, especially Eos-CRSwNP patients, is reduced. (A) 16s sequencing is used to detect the colonization abundance of Propionibacterium acnes in the nasal mucosa of each group. (B) RT-PCR is used to detect the abundance of Propionibacterium acnes in the nasal mucosa of each group. (C) FISH staining shows the colonization site of Propionibacterium acnes and the abundance difference in the nasal mucosa specimens of each group.

[0018] Figure 2Propionibacterium acnes was negatively correlated with the level of type II inflammation in the nasal mucosa. The levels of inflammatory factor proteins in the nasal mucosa were detected using the ELISA method, and correlation analysis was performed with the abundance of 16S rRNA from Propionibacterium acnes.

[0019] Figure 3 Propionibacterium acnes inhibits the release of eosinophil chemokines CCL11 and CCL24 from primary nasal mucosal epithelial cells and the Bease-2b cell line. (A) RT-PCR showed that Propionibacterium acnes inhibited the mRNA expression of CCL11 and CCL24 in primary nasal mucosal epithelium. (B) RT-PCR showed that Propionibacterium acnes inhibited the mRNA expression of CCL11 and CCL24 in the Bease-2b cell line.

[0020] Figure 4 : Methylmalonyl-CoA mutase, a protein component of Propionibacterium acnes, inhibits the expression of CCL11 and CCL24 in nasal mucosal epithelial cells. (A) Chromatographic peak diagram of Propionibacterium acnes protein. (B) Regulation of RNA levels of CCL11 and CCL24 in nasal mucosal epithelial cells by chromatographically separated protein components. (C) RT-PCR shows that the mRNA levels of CCL11 and CCL24 in primary nasal mucosal epithelium decreased after administration of methylmalonyl-CoA mutase.

[0021] Figure 5 Methylmalonyl-CoA mutase, a protein component of Propionibacterium acnes, inhibits the phosphorylation level of STAT3 in nasal mucosal epithelial cells. Western blotting showed that methylmalonyl-CoA mutase downregulated the phosphorylation of STAT3 in nasal mucosal epithelial cells.

[0022] Figure 6 Methylmalonyl-CoA mutase, a protein component of Propionibacterium acnes, inhibits the level of nasal mucosal inflammation in HDM-induced model mice. (A) RT-PCR was used to detect the expression levels of type II inflammatory factors in the nasal mucosa of mice in each group. (B) Glycogen staining (top) and HE staining (bottom) demonstrated that methylmalonyl-CoA mutase can improve nasal mucosal inflammation. Detailed Implementation

[0023] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below in conjunction with specific embodiments. This invention can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the inventive concept to those skilled in the art. This invention will be defined only by the claims.

[0024] The test methods or test methods described in the following examples are all conventional methods unless otherwise specified; the reagents and materials are all obtained from conventional commercial channels or prepared by conventional methods unless otherwise specified.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0026] On the basis of previous histopathology, cell biology, molecular biology, in vitro cell culture and in vivo animal experiments, the present application proposes the potential therapeutic effect of P. acnes and its main active ingredient methyl malonyl coenzyme A mutase protein on CRSwNP eosinophilic inflammation, and uses engineering bacteria to prepare the target protein in large quantities through genetic engineering technology, thereby proving that methyl malonyl coenzyme A mutase protein can be used to prepare a drug for treating nasal polyps.

[0027] The present study was approved by the Ethics Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, and each patient signed a written informed consent form before enrollment. In the CRS study, 65 control subjects, 74 Eos CRSwNP patients, 56 Non-Eos CRSwNP patients, and 44 CRSsNP patients were enrolled. The diagnosis of CRSsNP and CRSwNP was made according to the 2012 European Rhinologic Society (ERS) and European Position Paper on Nasal Polyposis (EPOS). CRSwNP was classified as eosinophilic when the percentage of tissue eosinophils in the total inflammatory cells was more than 10%. The control group was composed of patients who underwent septoplasty for anatomic variation without other diseases in the nasal cavity. Oral corticosteroids and intranasal steroid sprays were stopped at least 3 months and 1 month before surgery. Anti-leukotriene drugs were stopped at least 1 month before enrollment. Subjects who developed an acute upper respiratory tract infection and an acute asthma attack within 4 weeks of study inclusion and subjects who received immunotherapy were excluded. In addition, subjects with post-nasal polyps, fungal sinusitis, cystic fibrosis, primary ciliary dyskinesia, immunodeficiency, systemic vasculitis, or gastroesophageal reflux disease were excluded from the study because these specific diseases have their own unique pathophysiological characteristics. None of the study subjects had a history of aspirin sensitivity.

[0028] The present application provides the use of methyl malonyl coenzyme A mutase protein in the preparation of a drug for treating eosinophilic nasal polyps. The amino acid sequence of the small subunit PPA0595 of methyl malonyl coenzyme A mutase protein is shown in SEQ ID NO: 1, and the amino acid sequence of the large subunit PPA0596 is shown in SEQ ID NO: 2.

[0029] The amino acid sequence of the small subunit PPA0595 of methyl malonyl coenzyme A mutase protein is: (SEQ ID NO: 1) MTDPDNLASKSVEDRMPEELSLAGDFPKVTHEQWEEAVLKVLNRGRPEGKELNIEQGMKRLEPTTVDGIQIEPMYRRQDAPEKLGVPGVPPFTRGTTIREGGMDAWDVRALHEDPDVAFTKKAVIADLERGVTSLWLRVGADAIKPEDIAGDLKDVLLDLAKVEVSSRDDQEAAAQALLDVYIESKIDADKLSFNLGLDPIGFAALNGGNPDLSGMAEWVKKTENYKNSRPFVVDATIYHNAGAGDVHELAWAVATGVEYVRAFIEQGLTAEQAFDSINFRVTATHDEFLTISRLRALRTLWNRVGEVFEVPAAKRGARQEAVTSWRELTRDDPYVNILRGTIATFGAAVGGAEAVTTLPFDAAIGLPKSDFSRRIARNTGIILAEESNIGRANDPAGGSFYVEALTKKLEDAGWAEFQAVEAAGGMAAALTGDHVRTELDKLNTERAKRLATRKQPITAVSEFPLLDAKSVETKPYPAAPAREGLEWHRDAEVFEALVDRSATCPERPKVFLACLGTRRDFGPREGFSAPVWHIAGMETPECEGGTTEEVVKAFKESGADIADLCSNAKTYAAQGLEVAKALKEAGAKLVYLSGAFKEFGDDAAEAEKVIDGRIYLGMDVVDVLTATLDTLGVAK The amino acid sequence of the large subunit of methylmalonyl-CoA mutase protein PPA0596 is as follows: (SEQ ID NO: 2) MTTLPRFDSINLGDSPVPADAQEQFARLAAAAGEQEPWTTPEQIPVGHLYSEDVYGDMDWLDTYAGLPPFTHGPYATMYAFRPWTIRQYAGFSTAKESNAFYRRNLAAGQKGLSVAFDLPTHRGYDSDNPRVPGDVGMAGVAVDSILDMRELFAGIPLDRMSVSMTMNGAVLPILALYVVTAEEQGAKPEQLAGTIQNDILKEFMVRNTYIYPPLPSMRIISDIFAYTSANMPKWNSISISGYHMQEAGATADIEMAYTLADGVDYIRAGESVGLQVDQFAPRLSFFWAIGTNFFMEVAKMRAARMLWAKLVHQFNPKNPKSMSLRTHSQTSGWSLTAQDVYNNVIRTCVEAMGATQGHTQSLHTNSLDEAIALPTDFSARIARNTQLFIQQESGTCRVIDPWSGSAYVEKLTLELARKAWAHIQEVEKAGGMAKAIEKGIPKMRIEEAAARTQARIDSGRQPLIGVNKYRLDEEEPLEVLKVDNTQVLKEQKAKLEQLRANRDEEACQAALEKITWAAANPDPSDPDRNLLKLCIDAGRADASVGEMSDAMEKVFGRYTAQIRTIEGVYSKAAGNSESTKKVHELIKQFEEKEGRRPRIMIAKMGQDGHDRGQKVVATAYADLGMDVDVGPLFQTPEETARQAVEGDVHVVGVSSLAAGHLTLVPALRKELDKLGRSDIMIVVGGVIPTQDFDELRKDGAAAIYPPGTVIPDAAVELMEKLLAAHNDD Preferably, the methylmalonyl-CoA mutase protein is derived from P. acnes.

[0030] Preferably, the medicament is one of a nebulizer, a spray, a suspension, an irrigation.

[0031] Preferably, the methylmalonyl-CoA mutase protein down-regulates the STAT3 phosphorylation level of nasal mucosa epithelial cells, and reduces the infiltration of eosinophils by down-regulating the chemotactic factors eotaxin-1 and eotaxin-2, and thus reduces the type II inflammatory response, thereby achieving the therapeutic effect on eosinophilic nasal polyps.

[0032] Experimental process I. Collection of nasal mucosal tissue, epithelial cells, and nasal lavage fluid In the CRS study, lesioned ethmoid sinus mucosa from CRSsNP patients, polyp tissue from CRSwNP patients, and inferior turbinate mucosa from controls were collected. As previously described, human nasal mucosal epithelial cells (HNECs) were scraped from polyps in CRSwNP patients, middle nasal meatus from CRSsNP patients, and controls using a sterile professional curette (Arlington Scientific, Springville, Utah). (1–2) × 10⁶ cells were scraped from each specimen. 6 To ensure that over 95% of the cells are epithelial cells, verification is required using indirect immunofluorescence staining with anti-pan cytokeratin (Abcam, Cambridge, UK) antibody.

[0033] II. Cell Culture 1. Primary Nasal Epithelial Cell (HNEC) Air-Liquid Interfacial Culture: Nasal epithelial cells were scraped from the nasal passages of normal volunteers and seeded in six-well plates coated with type I rat tail collagen (Sigma-Aldrich, USA). The cells were cultured in a 37°C, 5% CO2 incubator. When the cells reached 80-90% cell differentiation, they were digested with 0.5% trypsin, passaged, and seeded into 0.4 μm transwell chambers. Cells were cultured until day 21 when they were fully differentiated. The cells were then treated with the following substances: type II cytokine (IL-13), inactivated Propionibacterium acnes, and methylmalonyl-CoA mutase.

[0034] 2. Bacterial Culture: Spread 200 μL of frozen Propionibacterium acnes glycerol evenly onto a Columbia blood culture dish. Incubate at 37°C for 3-4 days until distinct colonies appear. Pick a single colony and inoculate it into 1 ml of broth. Incubate overnight at 37°C. The next day, inoculate into an Erlenmeyer flask containing 50 ml of broth. Incubate at 37°C and 220 rpm for one day until the bacteria reach the logarithmic growth phase. Centrifuge at 4000 rpm for 5 min to precipitate the bacteria. Wash three times with PBS, resuspend in an equal volume of PBS, and aliquot into 1 ml Eppendorf tubes. Store at -80°C for long-term preservation.

[0035] 3. Expression and purification of methylmalonyl-CoA mutase protein: The nucleotide sequence of the coding region of PPA0595 protein was obtained from NCBI and transformed into the pET28a vector (insertion site 5'NcoI / Xhol 3') to construct an expression vector. The vector was chemically transfected into BL21-DE3 competent cells. The transformed bacterial culture was plated on KanR-resistant LB agar plates. The next day, competent cells were picked and transferred to 2 ml of liquid culture medium for amplification. Plasmids were extracted from the amplified bacteria, and PCR was performed using upstream and downstream primers to confirm successful insertion of the target gene coding fragment.

[0036] The upstream primer is shown in SEQ ID NO: 3, and is: TTAAGAAGGAGATATACCATGGGC. The downstream primer is shown in SEQ ID NO: 4, and is: GCCGGATCTCAGTGGTGGTGGTGGTGGTGCTC.

[0037] The bacteria with successful construction were transferred to 100 ml of liquid medium for culture, and when the OD value was 0.5-0.8, IPTG (0.5 mM) was added for induction at 16°C for 16 h. The bacterial solution was centrifuged (4000 rpm, 10 min) to obtain a precipitate, which was washed with PBS three times and resuspended in 20 ml of Lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, and the pH was adjusted to 8.0 using a NaOH solution). Lysis was performed on ice for 30 min, followed by ultrasonic crushing on ice, with a pause of 5 s after 5 s of ultrasonic, for a total of 10 min. The crushed bacterial solution was collected and centrifuged at 12000 rpm at 4°C for 10 min. The supernatant and the precipitate were collected separately, and each was taken for gel running, and Coomassie brilliant blue staining proved successful protein expression. Subsequently, the methylmalonyl-CoA mutase protein recombinant protein was purified using the Biyun Tian His protein purification kit, and a 3 kDa size ultrafiltration tube was used to replace the buffer with PBS, and the sample was diluted to a final concentration of 2 ug / ul, and stored at -80°C for subsequent experiments.

[0038] III. RNA extraction: The culture medium was directly discarded, and an appropriate amount of TRIzol reagent (e.g., 1 mL / 10^6-10^7 cells) was added, and lysis was performed by repeated blowing.

[0039] It was collected into a 1 ml EP tube and left to stand at room temperature (15-30°C) for 5 min.

[0040] 0.2 mL of chloroform was added to each 1 mL of TRIzol, the tube cap was tightly closed, and the tube was shaken vigorously by hand for 15 s, and left to stand at room temperature for 2-3 min.

[0041] Centrifugation was performed at 4°C at 12000 x g for 15 min. At this time, the solution was divided into three layers: a lower red phenol-chloroform phase, an intermediate layer, and an upper colorless aqueous phase. The RNA was present in the upper aqueous phase (about 50% of the total volume).

[0042] The upper aqueous phase was carefully transferred to a new RNase-free centrifuge tube (do not suck into the intermediate layer).

[0043] An equal volume of 70% ethanol (prepared with RNase-free water) was added to the aqueous phase, and mixed well.

[0044] The mixture was transferred to the provided adsorption column.

[0045] Centrifuge at room temperature, >8000xg, 15-30s, discard flow-through.

[0046] Add wash solution I (containing isothiocyanate, which can effectively remove protein and inhibit RNase), centrifuge, discard the waste liquid.

[0047] Add wash solution II (ethanol-diluted buffer, used to remove salt), centrifuge, discard the waste liquid. This step can be repeated once to thoroughly clean.

[0048] High-speed centrifugation of empty column (e.g. 13000xg, 2min) to completely remove residual ethanol.

[0049] Transfer the adsorption column to a new RNase-free collection tube.

[0050] Add 30-50μL RNase-free water to the center of the adsorption membrane, and stand at room temperature for 2min.

[0051] Centrifuge at >8000xg for 1-2min, and the liquid in the collection tube is the purified total RNA.

[0052] Immediately place on ice or store in a -80°C refrigerator.

[0053] Use Nanodrop to take 1μL of RNA solution for detection.

[0054] Check the A260 / A280 and A260 / A230 ratios.

[0055] A260 / A280: The ideal value is between 1.8-2.1. Less than 1.8 indicates protein contamination; more than 2.1 may indicate RNA degradation or isothiocyanate residue.

[0056] A260 / A230: The ideal value should be greater than 2.0. Less than 2.0 indicates salt or organic solvent (such as ethanol, guanidine salt) contamination.

[0057] The RNA obtained is then reverse transcribed to obtain DNA using the Novozyme reverse transcription reagent, and then qPCR is detected using the Novozyme fluorescent quantitative PCR reagent, and the data is analyzed using graphpad prism.

[0058] The following Figures 3-6 The expression levels of cytokine mRNA were detected using this technology in the following experiments to explore whether PPA0595 can regulate the expression of these genes.

[0059] The following Figures 2-5 The qPCR experiments of the following GUSB: (F) GTCTGCGGCATTTTGTCGG (SEQ ID NO: 5) (R) CACACGATGGCATAGGAATGG (SEQ ID NO: 6) CCL11: (F) CCCCTTCAGCGACTAGAGAG (SEQ ID NO: 7) (R) TCTTGGGGTCGGCACAGAT (SEQ ID NO: 8) CCL24: (F) ACATCATCCCTACGGGCTCT (SEQ ID NO: 9) (R) CTTGGGGTCGCCACAGAAC (SEQ ID NO: 10) IV. Protein extraction: Discard the culture medium and gently rinse the adherent cells twice with pre-cooled PBS. Aspirate the PBS.

[0060] Centrifuge to collect the cell pellet and resuspend and wash once with pre-cooled PBS. Centrifuge again. Add an appropriate amount of pre-cooled lysis buffer according to the cell amount (e.g. 100-200 µL per well for a 6-well plate). Ensure that the lysis buffer completely covers the cells. Incubate on ice for 15-30 min, occasionally shaking the dish or pipetting to ensure complete lysis. Scrape the cell lysate with a pre-cooled cell scraper and transfer it to a pre-cooled 1.5 mL centrifuge tube using a pipette. Centrifuge at 3000 rpm at 4°C for 10 min. Carefully transfer the supernatant (i.e. the solution containing total protein) to a new pre-cooled centrifuge tube. Do not aspirate the bottom pellet. Aliquot and store at -80°C to avoid repeated freeze-thaw cycles.

[0061] Weigh an appropriate amount of tissue (50-100 mg) and rinse in pre-cooled PBS. Cut the tissue into as small pieces as possible using scissors or a knife. Place the tissue pieces into a pre-cooled centrifuge tube and add lysis buffer. Use an electric homogenizer to homogenize on ice until no obvious chunks remain. The subsequent steps are the same as for cell samples, i.e. centrifugation, collection of supernatant, and aliquoting and storage.

[0062] Determine the protein concentration by the BCA method. Mix A and B solutions in the proportions specified in the kit instructions according to the number of standard and sample quantities.

[0063] Add samples: In a 96-well plate, add the following in order: Standards: Dilute the BSA standard in gradient (e.g. 0, 125, 250, 500, 750, 1000, 1500 µg / mL) using diluent, 25 µL per well.

[0064] Test sample: Dilute with lysis buffer (e.g. 1:10), add 25 μL per well.

[0065] Blank: Add 25 μL lysis buffer.

[0066] Working solution: Add 200 μL BCA working solution per well, mix gently.

[0067] Cover the plate and incubate at 37°C for 30 min. Measure the absorbance of each well at 562 nm with a microplate reader. Calculate the protein concentration of each test sample according to the standard curve.

[0068] V. Experimental process Figure 1 A: Collect the nasal lavage fluid of patients with eosinophilic chronic rhinosinusitis with nasal polyps (n=10), non-eosinophilic chronic rhinosinusitis with nasal polyps (n=16), and the control group (n=10), and send them for 16s sequencing. Plot the bacteria at the genus level. The results show that the abundance of P. acnes is significantly reduced in patients with eosinophilic chronic rhinosinusitis with nasal polyps, suggesting that P. acnes may be related to eosinophilic inflammation.

[0069] Figure 1 B: Each person is a statistical point, count the abundance of P. acnes in the three groups and perform statistical test. The results show that the abundance of P. acnes is the lowest in patients with eosinophilic chronic rhinosinusitis with nasal polyps, and it is statistically significant.

[0070] Figure 1 C: Paraffin-embedded sections of the control group, nasal polyp tissue of patients with eosinophilic chronic rhinosinusitis with nasal polyps, and nasal polyp tissue of patients with non-eosinophilic chronic rhinosinusitis with nasal polyps are cut, then deparaffinized and hydrated: sequentially treated with xylene and gradient ethanol to remove paraffin and rehydrate the tissue. Then immerse the sample in PBS containing 0.5% Triton X-100 and treat at room temperature for 10-15 min for permeation, then rinse with PBS for 3 times. Treat with RNAse A to degrade RNA and prevent non-specific binding of the probe to RNA. Dehydrate the treated sample sequentially through 70%, 85%, and 100% ethanol gradient, each for 2 min, then air dry. Prepare P. acnes specific probe and bacterial universal probe and hybridization buffer mixture. Heat the probe mixture in a 73-75°C water bath for 5-10 min, then immediately place it on ice to prevent renaturation. Then immerse the paraffin-embedded sample in preheated denaturation solution (usually 70% formamide / 2xSSC) at 73-75°C for 2-5 min. After denaturation, immediately dehydrate the sample in pre-cooled 70%, 85%, and 100% ethanol gradient, each for 2 min, then air dry. Add the denatured probe mixture to the target area of the denatured sample.

[0071] Carefully place the coverslip on top, seal the edges with Parafilm to prevent evaporation of the hybridization solution. Place the sample in a pre-heated humidified chamber and incubate overnight at 37°C (approximately 14-16h). The next day carefully remove the coverslip.

[0072] Hybridized sections are washed in 50% formamide / 2xSSC at 42-50°C for 3 times, 5-10 min each. Then washed in lxSSC at 42-50°C for 3 times, 5-10 min each. Sections are removed and air dried.

[0073] Directly mount with anti-fluorescence quenching mounting medium with DAPI. Place the sample under a fluorescence microscope for observation. Analyze the number, location and color of signals.

[0074] The results show that the P. acnes specific staining is significantly reduced in the eosinophilic nasal polyp tissues, demonstrating that P. acnes colonization is reduced in the nasal mucosa of patients with eosinophilic chronic rhinosinusitis with nasal polyps.

[0075] Figure 2 : Collect the sequencing sample of the nasal mucosa tissue of patients with eosinophilic chronic rhinosinusitis with nasal polyps. Cut the nasal mucosa tissue into 100 mg size tissue blocks, grind them in a 2 mm steel bead grinder (4°C, 60 Hz, 1 min) for 5 times, centrifuge at 4°C 1500 rpm for 5 min to collect the protein supernatant for Elisa detection of cytokine levels, as follows: Prepare 4 Doctor's Elisa kits (IL5, Eotaxin-1, IL17A, IFN-γ), dilute the standard according to the gradient. Add 100ul of standard of 500pg / ml, 250pg / ml, 125pg / ml, 62.5pg / ml, 31.3pg / ml, 15.6pg / ml, 7.8pg / ml to a row of 7 holes in turn. Add 100ul of shampoo to each hole in turn. Then add the enzyme-labeled plate with a sealing film, react at 37°C for 90min. After the reaction, shake off the liquid in the enzyme-labeled plate, and then tap a few times against the blotting paper. Do not clean.

[0076] The prepared biotin anti-human (IL5, Eotaxin-1, IL17A, IFN-γ) antibody working solution was added in turn (100ul per well, except for TMB blank color development wells). The enzyme-labeled plate was covered with a sealing film, and 37°C reaction was carried out for 60 min. 1X washing buffer was washed for 3 times, each time soaking for about 1 min (at least 300ul of washing solution per well). The prepared ABC working solution was added in turn (100ul per well, except for TMB blank color development wells). The enzyme-labeled plate was covered with a sealing film, and 37°C reaction was carried out for 30 min. 1X washing buffer was washed for 5 times, each time soaking for about 1-2 min (at least 300ul of washing solution per well). TMB color developing solution was added in turn (90ul per well), and 37°C reaction was carried out for 15-20 min in the dark. The stop solution was added in turn (100ul per well), at which time the blue color turned to yellow. The O.D. value was measured at 450nm by using an enzyme-labeled instrument. According to the formula in the instruction, the curve was fitted, and the corresponding concentration was found on the coordinate according to the absorbance value of the sample. Correlation detection was carried out with the sequencing propionibacterium acnes abundance, and it was found that it was negatively correlated with IL5 and Eotaxin-1, and had no correlation with type I inflammatory factors, indicating that propionibacterium acnes may be involved in the regulation of type II inflammation.

[0077] Figure 3 According to the method of cell culture, the collected nasal mucosa primary epithelial cells (a) and Beas2b (b) cell lines were cultured. When the cells grew to 70% density in the 12-well plate, the serum-free medium was replaced, the IL13 modeling group was given propionibacterium acnes inactivated bacteria for intervention, the non-modeling group was given propionibacterium acnes inactivated bacteria for intervention, 24h after administration, the modeling group was given IL13 (20ng / ml) for 6h for type II inflammation modeling. Then the cells were collected. Specifically as follows: the culture medium was directly sucked and discarded, 1ml TRIzol reagent was added and repeatedly blown and lysed. It was collected into a 1.5ml ep tube. 0.2ml chloroform was added per 1ml TRIzol, the tube cap was tightly covered, and the hand was shaken vigorously for 15s, and it was room temperature for 2-3min.

[0078] 4°C, 12000xg, centrifugation for 15min. At this time, the solution was divided into three layers: the lower red phenol-chloroform phase, the middle layer and the upper colorless water phase. RNA exists in the upper water phase (about 50% of the total volume).

[0079] The upper water phase was carefully transferred to a new RNase-free centrifuge tube (do not suck to the middle layer).

[0080] An equal volume of 70% ethanol (prepared with RNase-free water) was added to the water phase and mixed well.

[0081] The mixed solution was transferred to the provided adsorption column.

[0082] Centrifuge at room temperature, >8000xg, 15-30s, discard the flow-through.

[0083] Add wash solution I (containing isothiocyanate, which can effectively remove protein and inhibit RNase), centrifuge, discard the waste liquid.

[0084] Add wash solution II (ethanol diluted buffer, used to remove salt), centrifuge, discard the waste liquid. This step can be repeated once to thoroughly clean.

[0085] High-speed centrifugation of empty column (e.g. 13000xg, 2min) to completely remove residual ethanol.

[0086] Transfer the adsorption column to a new RNase-free collection tube.

[0087] Add 30-50μL RNase-free water to the center of the adsorption membrane, and stand at room temperature for 2min.

[0088] Centrifuge at >8000xg for 1-2min, and the liquid in the collection tube is the purified total RNA.

[0089] Use Nanodrop to detect 1μL of RNA solution. After determining the quality, use Novozyme reverse transcription reagent (HiScript II Q RT SuperMix for qPCR) for reverse transcription, conditions are 50℃ for 15min, 85℃ for 5s. Then obtain cDNA, and use Novozyme qPCR reagent (Q713) for fluorescent quantitative PCR to detect the expression level of chemokines CCL11 and CCL24. The experimental results are shown in Figure 3 A and Figure 3 B, which prove that the up-regulation of chemokine expression caused by IL13 is inhibited under the intervention of P. acnes inactivated bacteria, indicating that P. acnes inactivated bacteria can inhibit the expression of eosinophil chemokines.

[0090] Figure 4A: 50ml of P. acnes was cultured to logarithmic phase, 5000rpm, 10min centrifugation, and the precipitate was collected. 5ml of PBS was used for resuspension, and 1mg / ml of lysozyme was added. The mixture was incubated at 37°C for 1h, 5000rpm, centrifugation for 10min, and the precipitate was collected. 5ml of PBS was used for resuspension, and the mixture was ultrasonically lysed on ice, with a power of 200w, 5s of ultrasonic lysis, 5s of pause, and 20min of lysis. The precipitate was removed by centrifugation at 12000rpm for 5min, and the protein supernatant was collected. The collected supernatant was separated by a (PLRP / S, 300 Å, 5mm, 26150mm; Polymer Labs) chromatographic column, with a solution of (A, 0.1% TFA in water; B, 0.05% TFA in acetonitrile / isopropanol solution, 1:1 v / v), and elution with a linear gradient of compound, specifically 5% B solution at 5min after injection, 40% B solution at 15min, and 100% B solution at 75min. According to the molecular weight and lipid solubility of the protein, the supernatant protein can be roughly divided into 5 main components, and the proteins in the five components were recovered respectively.

[0091] Figure 4 B: The recovered 5 protein components were replaced with PBS solution using the suspension evaporation method. Then each component was used to stimulate the Beas2b cell line to determine which component the protein that can down-regulate the expression of eosinophil chemotactic factor is mainly in. The results show that it is mainly in component 4 and component 5.

[0092] Figure 4 C: The proteins in each component were identified by mass spectrometry, and the proteins that were mainly present in components 4 and 5 and less present in components 1, 2 and 3 were selected. Finally, 7 proteins that may be involved in regulating the secretion of eosinophil chemotactic factor were determined from P. acnes. The recombinant proteins of the 7 proteins were obtained by protein overexpression and purification method, and the intervention was carried out in cultured Beas2b cells for 24h. Then IL13 (20ng / ml) was used to stimulate type II inflammation. The results show that the group given PPA0595 inhibited the up-regulation of CCL11 and CCL24 by IL13, and the rest of the proteins could not inhibit the expression of CCL11 and CCL24 up-regulated by IL13. It is indicated that PPA0595 is the target protein that mediates P. acnes to inhibit eosinophil chemotactic factor.

[0093] Figure 5 : Beas2b cells were cultured in 6-well plates, and when the cells grew to 80% density, PPA0595 protein was added for stimulation for 3h, and then IL13 was added for stimulation for 3h. The control group was added with PBS, and then the cell protein was collected for WB detection of the phosphorylation level of the target pathway protein. Specifically: Discard the culture medium, gently rinse the adherent cells twice with pre-chilled PBS, and aspirate the PBS. Place the culture dish on ice.

[0094] Harvest the cells by centrifugation, resuspend and wash once with pre-chilled PBS, and centrifuge again. Add an appropriate amount of pre-chilled lysis buffer according to the cell amount (e.g., 120 μL per well for a 6-well plate). Ensure that the lysis buffer completely covers the cells. Incubate on ice for 15-30 min, and occasionally shake the dish or flick it to ensure complete lysis. Scrape the cell lysate with a pre-chilled cell scraper, and transfer it to a pre-chilled 1.5 mL centrifuge tube using a pipette. Centrifuge at 3000 rpm at 4°C for 10 min. Carefully transfer the supernatant (i.e., the solution containing total protein) to a new pre-chilled centrifuge tube. Do not aspirate the bottom precipitate. Store the aliquoted sample at -80°C to avoid repeated freeze-thaw cycles. Then mix the sample solution with 5x protein loading buffer and incubate in a 95°C metal bath for 10 min.

[0095] Use the ACE precast gel and the matching fast running buffer solution (fill a suitable container with 0.8 L of distilled water, add 41.852 g of 3-morpholinopropanesulfonic acid to the solution, add 4.101 g of sodium acetate to the solution, add 3.722 g of disodium ethylenediaminetetraacetate dihydrate to the solution, and add distilled water to bring the volume to 1 L), load the sample, load 20 ug of protein loading amount per well of the 15-well precast gel (load 3 replicates per group, for a total of 12 wells), and load one protein marker at each end. Perform electrophoresis at a constant voltage of 140 V for 45 min. Protein transfer Transfer the proteins separated in the gel to a solid support (PVDF).

[0096] "Sandwich" assembly, place the following in order in the transfer solution: Cathode (black plate) → sponge → filter paper → gel → PVDF membrane (which needs to be activated in ethanol for 15 s in advance) → filter paper → sponge → anode (white plate), ensure that there are no air bubbles between the layers, and that the gel is tightly attached to the membrane.

[0097] Place the "sandwich" in the transfer tank, and add pre-chilled transfer solution. Place an ice box outside the tank to cool it.

[0098] Wet transfer: constant current, set the time according to the protein molecular weight (300 mA, 60 min).

[0099] After the transfer is complete, quickly seal the membrane with blocking solution for 20 min to block the non-specific binding sites on the membrane.

[0100] Dilute the specific primary antibody (internal reference, phosphorylated STAT3) with the antibody dilution solution according to the recommended ratio. Incubate the membrane with the primary antibody solution at 4°C overnight (or at room temperature for 2 h), and place it on a shaker.

[0101] The membrane was removed from the primary antibody and washed with TBST buffer for 3 times, 5-10 min each time, to wash away the unbound primary antibody.

[0102] The HRP-labeled secondary antibody (such as anti-mouse or anti-rabbit IgG) was diluted according to the recommended proportion of the antibody diluent.

[0103] The membrane was incubated with the secondary antibody solution at room temperature for 1 h on a shaker.

[0104] Wash with TBST buffer for 3 times, 5-10 min each time, to thoroughly wash away the unbound secondary antibody.

[0105] Subsequently, exposure was performed, and A and B liquids in hypersensitive ECL chemiluminescence reagent were mixed in equal proportions.

[0106] The membrane was removed with tweezers, and the excess liquid was absorbed. The mixed ECL working solution was evenly dropped on the protein side of the membrane, and incubated in the dark for 5-10 s. Exposure and image acquisition were performed using the Bio-Rad chemiluminescence imaging system. Finally, the results were analyzed using ImageJ. Using Western Blot, the change in the phosphorylation level of the key phosphorylated protein STAT3 of eosinophil chemotactic factor CCL11 and CCL24 after PPA0595 intervention was detected, and the results showed that PPA0595 could inhibit the phosphorylation level of STAT3. It is proved that PPA0595 can inhibit the expression of CCL11 and CCL24 by inhibiting the phosphorylation of STAT3.

[0107] Figure 6 For animal experiments, the experimental process is as follows: 1. Female C57BL / 6 mice (5-6 weeks old) were purchased from Wuhan Hubei Experimental Animal Research Center. The mice were raised in the SPF condition animal room to ensure a 12 h light / dark cycle environment.

[0108] 2. The mice were divided into Con group, PPA0595 group, papin group, and papin+PPA0595 group, with 10 mice in each group. 20 μL of sterile PBS (10 μL per nostril) or 20 μg of PPA0595 protein (Val46-Asp218, R&D company) dissolved in 20 μL of sterile PBS (10 μL per nostril) was used to drop nose of the corresponding group of mice. The nose drops were started from the 1st to the 15th day. The papin modeling group of mice was added with 1 mg / ml of papin 20 μL (10 μL per nostril) at 4-6 and 11-15 days. The mice were sacrificed on the 18th day, and the dissected mouse nasal cavity structures were treated with decalcification and then paraffin-embedded.

[0109] 3. Coronal sections, thickness of 4 pm. By immunohistochemical staining, and glycogen staining to detect eosinophil infiltration and epithelial cupping severity. Under a microscope, the respiratory sinus mucosa was dissected, total RNA was extracted for quantitative RT-PCR analysis. The mRNA expression levels of IL4, IL5, IL13, CCL11, CCL24 were detected by RT-PCR.

[0110] Wherein the primer sequence (mouse sample) is as follows: IL4: (F) GGTCTCAACCCCCAGCTAGT (SEQ ID NO: 11) (R) GCCGATGATCTCTCTCAAGTGAT (SEQ ID NO: 12) IL5: (F) GCAATGAGACGATGAGGCTTC (SEQ ID NO: 13) (R) GCCCCTGAAAGATTTCTCCAATG (SEQ ID NO: 14) IL13: (F) TGAGCAACATCACACAAGACC (SEQ ID NO: 15) (R) GGCCTTGCGGTTACAGAGG (SEQ ID NO: 16) CCL11: (F) GAATCACCAACAACAGATGCAC (SEQ ID NO: 17) (R) ATCCTGGACCCACTTCTTCTT (SEQ ID NO: 18) CCL24: (F) TCTTGCTGCACGTCCTTTATT (SEQ ID NO: 19) (R) GCATCCAGTTTTTGTATGTGCC (SEQ ID NO: 20) Experimental results: Figure 6 A is the result of qPCR detection of key TH2 inflammatory factors after extracting RNA from mouse nasal mucosa after modeling, the results show that the level of TH2 inflammation in mouse nasal mucosa increases after HDM modeling, and the level of inflammatory factors decreases after treatment with PPA0595 protein, especially the eosinophil chemotactic factor is significantly inhibited, which proves that the protein is effective in vivo. Figure 6 B is the mouse nasal septum HE staining picture, which proves that the use of the protein can reduce the nasal mucosa cupping and immune cell infiltration caused by HDM.

[0111] In summary, the methylmalonyl-CoA mutase of P. acnes is isolated, purified and proved to down-regulate the expression of eotaxin-1 (CCL11) and eotaxin-2 (CCL24) of nasal mucosa epithelial cells by inhibiting the phosphorylation level of STAT3, and then reduce the infiltration of eosinophils and reduce the type II inflammatory response. The content of eotaxin-1 and eotaxin-2 in the nasal secretions of Eos-CRSwNP patients is significantly negatively correlated with the colonization abundance of P. acnes, and the inactivated P. acnes and the purified methylmalonyl-CoA mutase can inhibit the release of eotaxin-1 and eotaxin-2 from epithelial cells to inhibit eosinophilic inflammation in vitro cell experiments and in vivo animal experiments.

[0112] Obviously, the above examples are only examples for clearly illustrating but not limitation to the embodiments. Other different forms of changes or variations can be made on the basis of the above description for those skilled in the art. Here, all the embodiments are not required to be exhausted, and the obvious changes or variations derived therefrom are still within the protection scope of the present application.

Claims

1. Use of a methylmalonyl-CoA mutase protein in the preparation of a medicament for treating eosinophilic nasal polyps, wherein a small subunit PPA0595 amino acid sequence of the methylmalonyl-CoA mutase protein is shown as SEQ ID NO: 1, and a large subunit PPA0596 amino acid sequence of the methylmalonyl-CoA mutase protein is shown as SEQ ID NO:

2.

2. Use according to claim 1, characterized in that: The methylmalonyl-CoA mutase protein is derived from Propionibacterium acnes.

3. Use according to claim 1, characterized in that: The medicament is one of a nebulizer, a spray, a suspension, and an irrigation.

4. Use according to claim 1, characterized in that: The methylmalonyl-CoA mutase protein down-regulates eotaxin-1 and eotaxin-2, which are eosinophil chemotactic factors, by inhibiting the phosphorylation level of STAT3 in nasal mucosa epithelial cells, thereby reducing the infiltration of eosinophils and reducing the inflammatory response of type II, and thus achieving a therapeutic effect on eosinophilic nasal polyps.

5. The use according to claim 1, characterized in that: The preparation method of the methylmalonyl-CoA mutase protein comprises the following steps: (1) transferring a nucleotide sequence of a PPA0595 protein coding region to a vector to construct an expression vector; (2) transfecting the expression vector into an engineering bacterium, and then spreading the transformed bacterial liquid on a KanR-resistant LB agar plate, and picking a competent state on the next day and transferring it to a liquid culture medium for amplification; (3) extracting a plasmid from the amplified bacteria to identify whether the coding fragment of the target gene is successfully inserted; (4) transferring the bacteria constructed successfully to a liquid culture medium for culture, adding IPTG for induction when the OD value is 0.5-0.8; (5) after the induction is completed, centrifuging the bacterial liquid to obtain a precipitate, washing, resuspending in Lysis buffer, lysing on ice, and ultrasonic crushing; (6) collecting the crushed bacterial liquid, centrifuging, and collecting the supernatant, which is the methylmalonyl-CoA mutase protein; (7) purifying the methylmalonyl-CoA mutase protein.

6. Use according to claim 5, characterized in that: In step (1), the vector is a pET28a vector, and the insertion site is 5'NcoI / Xhol 3'.

7. Use according to claim 5, characterized in that: In step (2), the engineering bacterium is BL21-DE3.

Images