Method for biosynthesizing fibronectin in lactobacillus plantarum and application of fibronectin
By constructing a fibronectin expression system in Lactobacillus plantarum that does not require the addition of an inducer, the problems of production complexity and high cost in existing technologies have been solved, realizing low-cost and green production of fibronectin with high purity and skin repair effects, which is suitable for cosmetics, medical device wound repair and functional foods.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-03-10
AI Technical Summary
In existing technologies, the production of fibronectin relies on inducible promoter plasmid systems, which require the addition of exogenous inducers, resulting in high production complexity and cost, and does not conform to the concept of green production.
A fibronectin expression system was constructed in Lactobacillus plantarum. The promoter of the plasmid was replaced with the constitutive promoter Pp11-1 to achieve the biosynthesis of fibronectin without the addition of an inducer. The protein was cultured in food-grade medium and purified by anion exchange chromatography.
The fibronectin produced using low-cost, green methods has high purity and high content, making it suitable for use in cosmetics, medical device wound repair, and functional foods, with significant skin repair effects.
Smart Images
Figure CN121627872A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of cosmetic technology and biotechnology, specifically relating to a method for biosynthesizing fibronectin in Lactobacillus plantarum and its application. Background Technology
[0002] Fibronectin is a large glycoprotein mainly produced by liver and vascular endothelial cells, and is widely found in animal plasma, various cell surfaces, and the cell matrix. Fibronectin plays a crucial role in cell adhesion, growth, migration, and differentiation, and participates in wound healing, embryonic development, and immune regulation, showing broad application prospects in medical, cosmetic, and skincare research fields.
[0003] Currently, there are two main sources of fibronectin: (1) Traditional animal blood extraction. Due to limitations in animal blood supply, high cost, pathogen contamination, and immunogenicity, this method is difficult to meet the needs of large-scale production and application. (2) Recombinant expression source. Using genetic engineering technology to express recombinant fibronectin in host cells is an important way to overcome the shortcomings of natural sources. Although recombinant DNA technology has made large-scale production of fibronectin possible, current recombinant expression systems have many drawbacks. Prokaryotic systems such as Escherichia coli are simple to operate and low in cost, but contain endotoxins, which increases the difficulty of purification processes; eukaryotic systems such as Pichia pastoris can undergo more complex modifications, but the process development is difficult, the fermentation cycle is long, and the glycosylation pattern is different from that of humans, which may affect protein activity or introduce immunogenicity.
[0004] Current technologies for the biosynthesis of fibronectin still rely on heterologous expression using inducible promoter plasmid systems, which require the addition of exogenous inducers. Whether it is IPTG, used in prokaryotic systems such as E. coli, or methanol, used in eukaryotic systems such as Pichia pastoris, these inducers are not only expensive but also have a certain degree of toxicity, increasing the complexity and cost of production and not conforming to the concept of green production.
[0005] Therefore, providing a method for the biosynthesis of fibronectin that is low in immunogenicity, low in cost, and requires no inducing agents has significant scientific value and market potential. Summary of the Invention
[0006] To address the shortcomings of existing technologies, the present invention aims to provide a method for the biosynthesis of fibronectin in *Lactobacillus plantarum* and its applications. This invention constructs a fibronectin expression system in *Lactobacillus plantarum* and selects a constitutive promoter suitable for protein expression through promoter engineering, enabling the biosynthesis of fibronectin without the addition of an inducer. This solves the problems of inducer dependence and the drawbacks of engineered strains in existing technologies, laying the foundation for the green industrial production of fibronectin. The greenly biosynthesized fibronectin can be applied to cosmetic skin repair, medical device wound repair, and functional foods and health products, demonstrating significant application value.
[0007] To achieve this objective, the present invention adopts the following technical solution:
[0008] In a first aspect, the present invention provides a method for biosynthesizing fibronectin in *Lactobacillus plantarum*, the method comprising:
[0009] (1) The coding sequence of fibronectin FN was inserted into the expression frame of pNZ8148 plasmid to obtain the recombinant plasmid PNZ8148-FN; the constitutive promoter fragment P was used. p11-1 Replacing the promoter in the pNZ8148-FN plasmid yielded the recombinant non-inducible fibronectin expression system pNZ8148-P. p11-1 -FN;
[0010] (2) The recombinant non-induced fibronectin expression system pNZ8148-P p11-1 -FN was introduced into competent cells of Lactobacillus plantarum, and after culturing, a recombinant Lactobacillus plantarum engineered strain expressing non-induced fibronectin was obtained.
[0011] (3) Cultivate the engineered strain of Lactobacillus plantarum and isolate and purify the recombinant fibronectin from the culture medium.
[0012] The probiotic *Lactobacillus plantarum* is a very unique strain that, through engineering modification, expresses fibronectin, solving the following technical problems: compatibility with current gene manipulation techniques, facilitating genetic engineering; lack of typical or known virulence factors; and, after domestication, *Lactobacillus plantarum* has a short fermentation cycle and low industrial production costs. *Lactobacillus plantarum* expresses fibronectin using a protein expression system that does not require the addition of inducing agents, and is cultured using food-grade culture media, making it not only non-toxic and harmless, reducing production costs, but also enabling green production.
[0013] Preferably, the coding sequence of the fibronectin FN is shown in SEQ ID NO:1.
[0014] In this invention, fibronectin FN is selected from specific functional fragments of human fibronectin. Using the *Lactobacillus plantarum* system, codon optimization is performed based on the codon preference of lactic acid bacteria. The online codon optimization tool used is GenSmart™ codon optimization (Version Beta 1.0), available at: https: / / www.genscript.com.cn / tools / gensmart-codon-optimization. A sequence with recognition sequences for NcoⅠ and HindⅢ restriction enzymes at both ends of the sequence is designed to obtain the amino acid coding sequence of recombinant human fibronectin shown in SEQ ID NO:1.
[0015] Preferably, the constitutive promoter fragment P p11-1 The sequence is shown in SEQ ID NO:4.
[0016] In this invention, the constitutive promoter P p11-1 It was obtained by artificially synthesizing the promoter based on the endogenous promoter P11 of Lactobacillus plantarum WCFS1.
[0017] Preferably, the Lactobacillus plantarum is a plant-derived skin-repairing probiotic DF-2506 (Lactiplantibacillus plantarum), which is deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC NO:63780 and deposit date of September 10, 2023.
[0018] In this invention, Lactobacillus plantarum does not secrete endotoxins, is free of antibiotic labeling, and does not require the addition of chemical inducers, thus avoiding the risk of inducer residues. At the same time, the production cycle is short, and the expressed recombinant protein can be directly used in cosmetics and beauty fields without removing the pyrogen.
[0019] Preferably, the culture conditions for the engineered strain of *Lactobacillus plantarum* are as follows: the engineered strain of *Lactobacillus plantarum* is inoculated into MRS liquid medium and cultured for 14-16 h (e.g., 14 h, 15 h, or 16 h), and then transferred to MRS liquid medium at an inoculation rate of 1.5-2.5% (e.g., 1.5%, 2%, or 2.5%) and cultured for 16-20 h (e.g., 16 h, 17 h, 18 h, 19 h, or 20 h).
[0020] Preferably, the method for separating and purifying recombinant fibronectin includes: collecting bacterial cells in the culture medium, performing ultrasonic disruption, centrifuging to collect the cell disruption supernatant, heating in a water bath, centrifuging to collect the supernatant, and purifying the supernatant using anion exchange chromatography.
[0021] Preferably, the steps of the anion exchange chromatography method include: equilibrating the anion exchange column with an equilibration buffer until the conductivity and A280 absorbance values remain unchanged; loading the supernatant onto the anion exchange column; equilibrating the anion exchange column with PBS solution at pH 7.2-7.4 (e.g., 7.2, 7.3, or 7.4) until the UV A280 absorbance and conductivity values drop to their minimum and no longer change; eluting and collecting the recombinant fibronectin with PBS solution containing 290-300 mM NaCl (e.g., 290 mM, 295 mM, or 300 mM) at pH 7.2-7.4 (e.g., 7.2, 7.3, or 7.4).
[0022] Preferably, the equilibration buffer comprises, by concentration: 18-20 mM Tris-HCl (e.g., 18 mM, 19 mM, or 20 mM, etc.), 190-200 mM NaCl (e.g., 190 mM, 195 mM, or 200 mM, etc.), and a pH of 7.2-7.4 (e.g., 7.2, 7.3, or 7.4, etc.).
[0023] Preferably, the chromatography packing material of the anion exchange column is BestPoly 30Q.
[0024] Secondly, the present invention provides a nucleic acid molecule that encodes fibronectin FN and a constitutive promoter P. p11-1 The coding sequence of the fibronectin FN is shown in SEQ ID NO:1, and the constitutive promoter fragment P... p11-1 The sequence is shown in SEQ ID NO:4.
[0025] Thirdly, the present invention provides a recombinant plasmid vector containing the nucleic acid molecule described in the second aspect, wherein the vector backbone of the recombinant plasmid vector is pNZ8148-FN plasmid.
[0026] Fourthly, the present invention provides a recombinant non-induced fibronectin expression strain, wherein the strain is *Lactobacillus plantarum*, and the *Lactobacillus plantarum* contains the recombinant plasmid vector described in the third aspect; the *Lactobacillus plantarum* is a plant-derived skin repair probiotic DF-2506, and the *Lactobacillus plantarum* is deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC NO:63780 and accession date of September 10, 2023.
[0027] Fifthly, the present invention provides a recombinant fibronectin, which is prepared by the method for biosynthesizing fibronectin in Lactobacillus plantarum as described in the first aspect.
[0028] Sixthly, the present invention provides the application of the recombinant fibronectin described in the fifth aspect in the fields of cosmetics, pharmaceuticals, medical devices, functional foods, or health products.
[0029] The numerical range described in this invention includes not only the point values listed above, but also any point values within the numerical ranges not listed above. Due to space limitations and for the sake of brevity, this invention will not exhaustively list all the specific point values included in the range.
[0030] Compared with the prior art, the present invention has the following beneficial effects:
[0031] (1) Using Lactobacillus plantarum as the substrate bacteria to produce recombinant fibronectin has the advantages of being easy to genetically engineer, not containing typical or known virulence factors, having a short fermentation cycle, and low industrial production cost.
[0032] (2) No exogenous inducer is needed during the expression of fibronectin, and food-grade culture medium is used for cultivation, which is non-toxic and harmless, thus achieving green production.
[0033] (3) The recombinant fibronectin obtained has the characteristics of high purity and high content, and has a significant skin repair effect. Attached Figure Description
[0034] Figure 1 This is the result of SDS-PAGE electrophoresis detection of the purity of recombinant fibronectin.
[0035] Figure 2 This is the result of an experiment on the effect of recombinant fibronectin on promoting cell migration.
[0036] Figure 3 It is the result of the transepidermal water loss (TEWL) value of the skin. Detailed Implementation
[0037] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.
[0038] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0039] Example 1
[0040] This embodiment provides a method for non-induced expression of fibronectin in Lactobacillus plantarum.
[0041] 1. Construction of a recombinant non-induced fibronectin expression system.
[0042] The fibronectin FN gene was synthesized (FN sequence shown in SEQ ID NO:1), and inserted into the NcoI and HindIII restriction sites of plasmid pNZ8148 to construct the recombinant plasmid pNZ8148-FN. Then, using the recombinant plasmid pNZ8148-FN template, PCR amplification was performed on pNZ8148FN-F / pNZ8148FN-R using primers (pNZ8148FN-F sequence shown in SEQ ID NO:2, pNZ8148FN-R sequence shown in SEQ ID NO:3) to obtain the linear fragment pNZ-FN. The linear fragment pNZ-FN was then combined with the constitutive promoter fragment P synthesized from the gene. p11-1 Assembly (P) p11-1 (The sequence is shown in SEQ ID NO:4), thus obtaining the recombinant non-induced fibronectin expression system pNZ8148-P. p11-1 -FN.
[0043] Table 1
[0044]
[0045] 2. Construction of recombinant strains without induced fibronectin expression.
[0046] The activated *Lactobacillus plantarum* (a strain unique to Guangzhou Dongfang Biotechnology Co., Ltd., specifically the plant-derived skin-repairing probiotic DF-2506, deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC NO:63780 and accession date September 10, 2023) was inoculated at a ratio of 0.8% into 120 mL of MRS + 2.5% glycine liquid medium and incubated statically at 37℃ until OD... 600 The concentration was approximately 0.5. After standing on ice for 10-15 min, the cells were centrifuged at 3500 rpm for 10 min at 4°C to collect the bacterial cells. The bacterial cells were washed three times thoroughly with 30 mL of pre-cooled (0-4°C) 0.15 mmol / L MgCl2 solution, and centrifuged at the same temperature as above. The bacterial cells were then washed three times with 30 mL of pre-cooled (0-4°C) 35% PEG 1500 solution, and centrifuged at 4°C for 4500 rpm for 10 min. Finally, the bacterial cells were resuspended in 0.8 mL of pre-cooled (0-4°C) 35% PEG 1500 solution, and aliquoted into 150 μL tubes to obtain competent *Lactobacillus plantarum* cells. 150 μL of plasmid pNZ8148-Pp was then added to the tube. 11-1-FN was added to competent cells of *Lactobacillus plantarum*, and after incubation on ice for 10 min, the cells were rapidly transferred to a pre-cooled (0-4℃) electroporation cuvette for electroporation. The electroporation conditions were 2.0 kV, 400 Ω, and 25 μF, with an electroporation time of approximately 10 ms. After electroporation, 0.8 mL of fresh MRS medium was added, and the cells were incubated at 37℃ for 2 h. An appropriate amount of the bacterial culture was then spread onto a solid culture dish containing 10 μg / mL chloramphenicol-resistant MRS medium and incubated upside down at 37℃ for 18 h. Single colonies were then picked and cultured in liquid MRS medium containing 10 μg / mL chloramphenicol-resistant MRS medium to obtain the recombinant *Lactobacillus plantarum* engineered strain that does not express induced fibronectin.
[0047] 3. Culture of recombinant strains without induced fibronectin expression.
[0048] Superior colonies of selected *Lactobacillus plantarum* engineered strains were inoculated into 25 mL of MRS liquid medium and cultured at 37°C and 220 rpm for 16 h. Then, a 2% inoculum was transferred to 1250 mL of MRS liquid medium, and 250 mL of 50% sterile glucose solution was added. The culture was then incubated at 37°C and 220 rpm for 18 h. The cells were centrifuged at 12000 rpm for 5 min at room temperature, and the cell pellet (wet weight cells) was collected. The pellet was resuspended by shaking in 400 mL of pH 7.4 buffer (20 mM Tris-HCl, 200 mM NaCl). The cells were then sonicated on ice and centrifuged at 12000 rpm for 15 min. The cell lysis supernatant was collected and incubated in a 50°C water bath for 1 h, then centrifuged at 12000 rpm for 15 min to remove contaminating proteins. The supernatant was purified by anion exchange chromatography.
[0049] The specific method is as follows: An anion exchange column (BestPoly 30Q chromatography packing material) was equilibrated with pH 7.4 buffer (20 mM Tris-HCl, 200 mM NaCl) until the conductivity and A280 absorbance remained constant. The sample loading flow rate was set to 25 mL / min. After sample loading, the anion exchange column was equilibrated again with pH 7.4 PBS solution until the UV A280 absorbance and conductivity reached their minimum and no longer changed. Finally, the protein was eluted with PBS solution containing 300 mM NaCl and pH 7.4, and the corresponding protein was collected. The purity of recombinant fibronectin was detected by SDS-PAGE electrophoresis. The results are shown below. Figure 1 As shown, a high-purity recombinant fibronectin stock solution can be obtained.
[0050] Comparative Example 1
[0051] This comparative example provides a method for inducible expression of fibronectin in *Lactobacillus plantarum*. The only difference between this method and Example 1 is that the promoter used in constructing the recombinant inducible fibronectin expression system is P. p11-2 promoter P p11-2 The base sequence is (SEQ ID NO:5).
[0052] ATATTACAGCTCCAGATCAGATCTGCTCGGGGAGTTGTTGACACGCGCAGCAAGGCATGATATAATCTCGGTATAGCGAGTTTAGGTTTGCGAAGATTAGATCTAGCGCTATAGTTGTTGACAGAATGGACATACTATGATATATTGTTGCTATAGCG ATTATAAGGAGGCACTCA.
[0053] Comparative Example 2
[0054] This comparative example provides a method for inducible expression of fibronectin in *Lactobacillus plantarum*. The only difference between this method and Example 1 is that the promoter used in constructing the recombinant inducible fibronectin expression system is P. p11-3 promoter P p11-3 The base sequence is (SEQ ID NO:6).
[0055] ATATTACAGCTCCAGATCAGATCTACCAGACAAGTTGTTGACAGGCAGCCATCTCTATGGTAAAATGTTGGTATAGCGAGTTTAGGTTTGCGAAGATTAGATCTAGCGCTATAGTTGTTGACAGAATGGACATACTATGATATATTGTTGCTATAGCG ATTATAAGGAGGCACTCA.
[0056] Comparative Example 3
[0057] This comparative example provides a method for inducible expression of fibronectin in *Lactobacillus plantarum*. The only difference between this method and Example 1 is that the promoter used in constructing the recombinant inducible fibronectin expression system is P. p11-4 promoter P p11-4 The base sequence is (SEQ ID NO:7).
[0058] ATATTACAGCTCCAGATCAGATCTGTTGTGAGAGTTGTTGACAAAGAAGCCGGGTTTTGGTATAATGGGCGTATAGCGAGTTTAGGTTTGCGAAGATTAGATCTAGCGCTATAGTTGTTGACAGAATGGACATACTATGATATATTGTTGCTATAGCG ATTATAAGGAGGCACTCA.
[0059] Comparative Example 4
[0060] This comparative example provides a method for non-induced expression of fibronectin in Lactobacillus plantarum. The only difference between this method and Example 1 is that, when constructing the recombinant non-induced fibronectin expression strain, the Lactobacillus plantarum subsp. plantarum CGMCC 1.2437 (China General Microbiological Culture Collection Center) is used.
[0061] Comparative Example 5
[0062] This comparative example provides a method for non-induced expression of fibronectin in Lactobacillus plantarum. The only difference between this method and Example 1 is that Lactobacillus plantarum CGMCC 1.3 (China General Microbiological Culture Collection Center) is used when constructing the recombinant non-induced fibronectin expression strain.
[0063] Test Example 1
[0064] This test case was used to determine the purity and content of protein.
[0065] 1. Protein purity detection: SEC-HPLC method.
[0066] (1) Chromatographic conditions: Tosoh TSKgel G3000SWXL column (7.8×300 mm, 5 μm), mobile phase was 20 mmol / L pH 6.8 PBS buffer; column temperature was 20℃; flow rate was 0.5 mL / min; detection wavelength was 280 nm; injection volume was 50 μL; recording time was 40 min.
[0067] (2) Sample preparation: The recombinant fibronectin stock solution prepared in each example and comparative example was filtered through a 0.22 μm filter membrane and used as the sample to be tested.
[0068] (3) Detection: Each sample to be tested is injected and analyzed under the set chromatographic conditions (each sample is injected in parallel 3 times).
[0069] (4) Purity Calculation: Collect the chromatogram and use software to integrate all peaks in the chromatogram. Protein purity (%) = (peak area of target protein peak / total peak area of all peaks) 100%.
[0070] 2. Protein content detection: The protein concentration test kit from Jebes Biotechnology was used for detection.
[0071] (1) Prepare BCA working solution according to the volume ratio of BCA reagent A to BCA reagent B of 50:1, mix thoroughly and set aside.
[0072] (2) Prepare a 0.5 mg / mL fibronectin standard solution using PBS solution containing 300 mM NaCl and pH 7.4 as solvent; add 0, 1, 2, 4, 8, 12, 16, and 20 μL to the standard wells of a 96-well plate, and make up to 20 μL with PBS solution.
[0073] (3) Add 20 μL of the recombinant fibronectin stock solution prepared in the examples and comparative examples to the sample wells of the 96-well plate.
[0074] (4) Add 200 μL of BCA working solution to each well and place at 37°C for 30 minutes.
[0075] (5) Measure the absorbance of each sample at a wavelength of 562 nm. Based on the test data of each standard well, plot a standard curve with absorbance as the ordinate and concentration as the abscissa, and calculate the protein concentration based on the standard curve. The test results are shown in Table 2.
[0076] Table 2
[0077]
[0078] Table 2 shows that the fibronectin expression content and purity of engineered strains constructed using different promoters or strains differed significantly. When P was used... p11-1 When constructing engineered bacteria using the promoter and Lactobacillus plantarum with accession number GDMCC NO:63780, the fibronectin content was higher and the amount of other proteins was lower.
[0079] A comparison of the results of Example 1 with those of Comparative Examples 1-3 shows that promoter P p11-1 It exhibits the best overall expression effect; a comparison of the results of Example 1 and Comparative Examples 4-5 shows that P is selected in this application. p11-1 The promoter of Lactobacillus plantarum (accession number GDMCCNO:63780) is more suitable for the efficient expression of fibronectin.
[0080] Test Example 2
[0081] Assay on the effect of recombinant fibronectin on promoting cell migration.
[0082] This test case uses the recombinant fibronectin prepared in Example 1 to perform a cell migration assay.
[0083] (1) Inoculate well-grown HaCaT cells into 6-well plates, 6 × 10⁶ cells per well. 5 Incubate at 37℃ and 5% CO2 for 24±2 h. Discard the old culture medium and add 2 mL of medium containing 10 μg / mL mitomycin C to each well, incubating at 37℃ for 2 h to inhibit cell proliferation. Use a sterile pipette tip to make a vertical scratch at the bottom of the 6-well plate; after scratching, gently wash twice with PBS.
[0084] (4) Set up sample wells and normal control wells. Add 2 mL of fresh culture medium to each normal control well; add 2 mL of fresh culture medium containing 10 ppm of recombinant fibronectin prepared in Example 1 to each sample well. Place the 6-well plate back into the incubator and continue to incubate at 37°C and 5% CO2 for 48 h. Take pictures at 0 h, 16 h, 24 h and 48 h after drug administration and record the scratch area.
[0085] (5) Calculate the cell migration promotion rate. Cell migration promotion rate = [scratch area of sample well - scratch area of normal control well] / scratch area of normal control well 100%. The results are shown in Table 3.
[0086] Table 3
[0087]
[0088] The results showed that recombinant fibronectin had a significant cell migration effect.
[0089] Test Example 3
[0090] Security testing.
[0091] (1) Ten volunteers aged 20-45 with healthy skin were selected as trial subjects.
[0092] (2) Sample preparation: The recombinant fibronectin prepared in Example 1 was diluted with pure water to a 100 ppm solution and used as the sample to be tested.
[0093] (3) Using the closed patch test method, 0.025 mL of the test sample was placed in the patch tester (with deionized water as a reference), and low-sensitivity adhesive tape was applied to the flexor side of the subject's forearm. The test sample was removed after 24 h, and the skin reaction was observed at 0.5 h, 24 h, and 48 h after removal. The results were recorded according to the skin reaction grading standard in the "Cosmetic Safety Technical Specifications" (2015 edition). The results are shown in Table 4.
[0094] Table 4
[0095]
[0096] The results showed that recombinant fibronectin passed the safety evaluation and had no irritant or sensitizing effect on the human body.
[0097] Test Example 4
[0098] TEWL value test of skin after cosmetic surgery.
[0099] (1) Sample preparation: The recombinant fibronectin prepared in Example 1 was diluted with pure water to a 22 ppm solution and dispensed into 5 mL / bottle for later use.
[0100] (2) Volunteer recruitment: 13 healthy women aged 26-58 were recruited as subjects.
[0101] (3) Testing: After the subjects' faces were cleansed, a dermatologist performed a standardized procedure using a medical roller. After the procedure, 5 mL of the sample was applied to the left cheek (product side) and 5 mL of purified water was applied to the right cheek (control side). Subsequently, all subjects used the same mild moisturizing skin care products and avoided sun exposure and other irritating products.
[0102] Transepidermal water loss (TEWL) values were measured using a transepidermal water loss meter at the following times: preoperative (D0), postoperative 0 min (D0T0), postoperative 30 min (D030min), postoperative 1 day (D1), postoperative 3 days (D3), postoperative 7 days (D7), and postoperative 14 days (D14). The experimental results are as follows: Figure 3 As shown, Figure 3 Shows the average change in skin TEWL Paired t-tests and rank-sum tests were used to analyze the differences between baseline and follow-up time point values of the mean skin TEWL. Statistical differences were determined by... The results indicate that recombinant fibronectin has excellent soothing and repairing effects.
[0103] In summary, this invention constructs a fibronectin expression system in *Lactobacillus plantarum* and selects a constitutive promoter suitable for *Lactobacillus plantarum* protein expression through promoter engineering, enabling the biosynthesis of fibronectin without the addition of an inducer. This solves the problems of inducer dependence and drawbacks of engineered strains in existing technologies, laying the foundation for the green industrial production of fibronectin. The recombinant fibronectin disclosed in this invention exhibits good biological activity, promotes cell migration, and demonstrates excellent effects in soothing and repairing human skin, showing broad application prospects in cosmetics, pharmaceuticals, functional foods, and health products.
[0104] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.
Claims
1. A method for biosynthesis of fibronectin in Lactobacillus plantarum, characterized by, The method comprises: (1) The coding sequence of fibronectin FN is inserted into the expression frame of pNZ8148 plasmid to obtain recombinant plasmid pNZ8148-FN; the constitutive promoter fragment P p11-1 The promoter in the pNZ8148-FN plasmid is replaced to obtain recombinant inducible-free fibronectin expression system pNZ8148-P p11-1 -FN; (2) The recombinant fibronectin-free expression system pNZ8148-P p11-1 FN into Lactobacillus plantarum competent cells, and after culture, a recombinant fibronectin-free expression Lactobacillus plantarum engineering strain is obtained. (3) Culturing the Lactobacillus plantarum engineering strain to obtain recombinant fibronectin from the culture solution.
2. The method of biosynthesis of fibronectin in Lactobacillus plantarum according to claim 1, characterized by, The coding sequence of the fibronectin FN is shown in SEQ ID NO: 1; Preferably, said constitutive promoter fragment P p11-1 The sequence of P is shown in SEQ ID NO:
4.
3. The method of biosynthesis of fibronectin in Lactobacillus plantarum according to claim 1 or 2, characterized in that, The Lactobacillus plantarum is a plant-derived skin repair probiotic DF-2506, and the Lactobacillus plantarum is preserved in the Guangdong Microbial Culture Collection Center, located at No. 59, Building 5, 100, Martyrs' Road, Guangzhou, with a preservation number of GDMCC NO: 63780 and a preservation date of September 10, 2023.
4. The method for biosynthesis of fibronectin in Lactobacillus plantarum according to any one of claims 1-3, characterized by, The culture conditions of the Lactobacillus plantarum engineering strain are as follows: the Lactobacillus plantarum engineering strain is inoculated into MRS liquid medium and cultured for 14-16 h, and then transferred into MRS liquid medium at an inoculation amount of 1.5-2.5% and cultured for 16-20 h.
5. The method of biosynthesis of fibronectin in Lactobacillus plantarum according to any one of claims 1-4, characterized by, The method for separating and purifying the recombinant fibronectin comprises: collecting the bacterial cells in the culture solution, performing ultrasonic crushing, centrifuging to collect the cell crushing supernatant, water bath heating, centrifuging to collect the supernatant, and purifying the supernatant by anion exchange chromatography; Preferably, the steps of the anion exchange chromatography method comprise: using an equilibrium buffer to balance the anion exchange column until the conductivity value and A280 absorbance value are constant; loading the supernatant into the anion exchange column; using a PBS solution with a pH of 7.2-7.4 to balance the anion exchange column until the ultraviolet A280 absorbance value and the conductivity value are at a minimum and no longer change; and using a PBS solution containing 290-300 mM NaCl with a pH of 7.2-7.4 to elute and collect the recombinant fibronectin; Preferably, the equilibrium buffer comprises, in terms of concentration: 18-20 mM Tris-HCl, 190-200 mM NaCl, and a pH of 7.2-7.4; Preferably, the chromatographic filler of the anion exchange column is BestPoly 30Q.
6. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes fibronectin FN and a constitutive promoter P p11-1 The sequence of the coding sequence of the fibronectin FN is shown in SEQ ID NO: 1 and the sequence of the constitutive promoter fragment P p11-1 is shown in SEQ ID NO:
4.
7. A recombinant plasmid vector, characterized in that, The recombinant plasmid vector contains the nucleic acid molecule of claim 6, and the vector backbone of the recombinant plasmid vector is pNZ8148-FN plasmid.
8. A recombinant acellular fibronectin matrix-derived scaffold strain, characterized in that, The strain is Lactobacillus plantarum, which contains the recombinant plasmid vector of claim 7; the Lactobacillus plantarum is a plant-derived skin repair probiotic DF-2506, and the Lactobacillus plantarum is preserved in the Guangdong Microbial Culture Collection Center, located at No. 59, Building 5, 100, Martyrs' Road, Guangzhou, with a preservation number of GDMCC NO: 63780 and a preservation date of September 10, 2023.
9. A recombinant fibronectin, characterized in that, The recombinant fibronectin is prepared by the method for biosynthesizing fibronectin in Lactobacillus plantarum according to any one of claims 1-5.
10. The recombinant fibronectin of claim 9 for use in the field of cosmetics, medical devices, functional foods, or health products.