Enhanced specific promoter and application thereof

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to an enhanced specific promoter and application thereof. In order to solve the problems that the safety of ICP6 wild herpes virus is poor, the replication ability of ICP6 defective virus is poor, and the oncolytic effect needs to be improved, the invention provides a core starting element, the nucleotide sequence of which is as shown in SEQ ID NO.5; or a nucleic acid molecule which has one or more base insertion, deletion and / or substitution mutation in a nucleotide sequence shown in SEQ ID NO.5 and still has a promoter function. The core promoter element or promoter can specifically express the ICP6 gene in tumor cells infected with the herpes simplex virus, so that the replication capacity of the recombinant oncolytic virus is improved, the oncolytic activity and tumor selectivity of the recombinant oncolytic virus are improved, and the core promoter element or promoter also shows relatively good safety in a mouse model; the method is suitable for developing oncolytic viruses or virus vectors.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biomedical technology, and particularly relates to an enhanced specific promoter and application thereof. BACKGROUND

[0002] Oncolytic virus (OV) is a kind of virus that can selectively infect and kill tumor cells, while being relatively harmless to normal cells. As a new cancer treatment method, OV therapy shows broad clinical application prospects by directly or indirectly inducing tumor cell apoptosis and immune response through the natural characteristics of the virus.

[0003] The mechanism of OV is complex and diverse, mainly including the following aspects: (1) Selective replication: tumor cells usually have abnormally active signal pathways, such as RAS, EGFR, etc., which can provide a suitable replication environment for OV. (2) Direct killing of tumor cells: OV can cause cell lysis and death after replication in tumor cells. (3) Inducing immune response: the tumor antigens released by OV after lysis of tumor cells can stimulate the host's immune system to fight against tumors, causing innate immunity and adaptive immunity. (4) Remodeling of tumor microenvironment: OV can improve the inhibitory tumor microenvironment and enhance the anti-tumor ability of immune cells.

[0004] To enhance the safety of oncolytic viruses, oncolytic viruses based on herpes virus as a backbone, such as T-VEC, G47Δ, CAN-3110, delete or lack key virulence genes, including ICP34.5, ICP6, ICP47. Studies have shown that cell necrosis after HSV-1 virus infection depends on the interaction between RIP3 and viral protein ICP6 (ribonucleotide reductase subunit 1, nucleotide reductase subunit 1). This pathway does not depend on the known TNF and Toll-like receptor. Wild-type virus infection induces RIP3 to bind to substrate MLKL, while ICP6-deficient virus cannot effectively induce the formation of RIP3 / MLKL complex and necrosis. Expression of viral ICP6 in host cells can directly activate the RIP3 / MLKL signaling pathway, leading to cell necrosis. Animal experiments in vivo found that the deficiency of RIP3 leads to uncontrolled reproduction of HSV-1 virus and animal death. Clinical studies have found that herpes virus-induced encephalitis is associated with the interaction between RIP3 and ICP6 genes. Herpes virus with inactivated ICP6 has been shown to have better safety in glioma treatment and exhibit lower pathogenicity, but the deletion of ICP6 function impairs the virus replication ability, so it is considered that specific activation of the expression of this gene in tumors is expected to retain the replication activity of the virus in tumors under the premise of ensuring the safety of oncolytic viruses, and achieve better therapeutic effect.

[0005] Malignant glioma is the most common and most malignant primary brain tumor in adults, accounting for 60% of all primary brain tumors. Although various treatments such as surgery, radiotherapy, chemotherapy and targeted therapy have been applied in clinical practice, the disease has three characteristics of easy recurrence, easy drug resistance and poor prognosis, and the five-year survival rate is only 6.8%, which seriously threatens human life and health. In recent years, the application of oncolytic viruses in the treatment of brain glioma has become a research hotspot, and some preclinical and clinical studies have shown certain efficacy. However, there are still problems such as the persistence of treatment effect in the process of oncolytic virus treatment, and further development and optimization of oncolytic viruses for the treatment of brain glioma are needed.

[0006] Survivin, a member of the apoptosis inhibitor protein family, is highly expressed in various tumor and embryonic tissues, including glioma, osteosarcoma, breast cancer, colorectal cancer, ovarian cancer, pancreatic cancer, melanoma, bladder cancer, and lung cancer, and is closely related to tumor cell differentiation, proliferation, and metastasis. Survivin exhibits high tumor specificity, indicating that survivin initiation is a broad-spectrum tumor-specific promoter. Therefore, using a survivin promoter to specifically initiate the ICP6 gene, driving its specific expression in tumor cells, can, to some extent, restore the oncolytic activity of the virus itself, enhancing its ability to lyse tumor cells while avoiding damage to normal cells. However, when using a survivin promoter to initiate the ICP6 gene, the initiation activity of different survivin initiation elements varies significantly. Therefore, the development of a specific promoter for the ICP6 gene has important practical significance.

[0007] This application aims to provide a novel promoter modified with the Survivin promoter, which can specifically regulate key virulence genes of HSV, improve the oncolytic effect of HSV, and thus prepare a novel oncolytic virus with better efficacy. Summary of the Invention

[0008] The technical problem to be solved by this invention is that the existing wild-type ICP6 herpesvirus has poor safety, while the replication ability of the defective ICP6 virus is poor, and the oncolytic effect needs to be improved.

[0009] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: a core promoter element is provided, the nucleotide sequence of which is shown in SEQ ID NO.5; or a nucleic acid molecule that has one or more base insertions, deletions and / or substitution mutations in the nucleotide sequence shown in SEQ ID NO.5, and still has promoter function.

[0010] Nucleotide sequence of the core promoter element SUR5 (SEQ ID NO:5)

[0011] GCCTCTCAAAGTGTTGGGATTACAGGCGTGAGCCACTGCACCCGGCCTGCACGCGTTCTTTGAAAGCAGTCGAGGGGGCGCTAGGTGTGGGCAGGGACGAGCTGGCGCGGCGTCGCTGGGTGCACCGCGACCACGGGCAGAGCCACGCGGCGGGAGGACT ACAACTCCCGGCACACCCCGCGCCGCCCCGCCTCTACTCCCAGAAGGCCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGC.

[0012] More preferably, the nucleotide sequence of the above-mentioned core initiation element is shown in SEQ ID NO.6.

[0013] Nucleotide sequence of the core promoter element mfSUR in SEQ ID NO.6

[0014] .

[0015] The present invention also provides a promoter comprising the above-described core startup element.

[0016] The present invention also provides the use of the above-mentioned core initiation element and promoter in the preparation of recombinant oncolytic virus.

[0017] Furthermore, the present invention also provides a recombinant carrier containing the aforementioned core initiation element and promoter.

[0018] Furthermore, the recombinant vector is a plasmid vector or a viral vector. The viral vector is at least one selected from herpesvirus, adenovirus, vaccinia virus, myxoma virus, measles virus, Newcastle disease virus, vaccinia virus, reovirus, and Coxsackie virus. Preferably, the viral vector is a herpesvirus vector.

[0019] Furthermore, the plasmid vector is the pGL3-basic plasmid.

[0020] The present invention also provides an antitumor drug, which is prepared by adding pharmaceutically acceptable auxiliary components to the above-mentioned recombinant carrier.

[0021] Furthermore, the tumor is a tumor that highly expresses Survivin. Preferably, it is at least one of glioma, osteosarcoma, melanoma, breast cancer, head and neck cancer, lung cancer, colorectal cancer, pancreatic cancer, liver cancer, or bladder cancer. More preferably, it is glioma.

[0022] The present invention also provides a method for preparing the above-mentioned recombinant vector, comprising the following steps:

[0023] a) Obtain the promoter with the nucleotide sequence described in SEQ ID NO. 6;

[0024] b) Insert the promoter into an oncolytic virus vector to regulate the expression of the ICP6 gene;

[0025] c) Construct and package an oncolytic virus vector containing a promoter with a nucleotide sequence as shown in SEQ ID NO.6 using genetic engineering techniques.

[0026] The beneficial effects of this invention are as follows:

[0027] This invention specifically targets wild-type natural or recombinant oncolytic viruses of ICP6, and through screening and modification, obtains a specific promoter that can specifically express the ICP6 gene in tumor cells, thereby improving the replication ability of recombinant oncolytic viruses, enhancing their oncolytic activity and tumor selectivity. It also shows good safety in mouse models and is suitable for the development of oncolytic viruses or viral vectors. Attached Figure Description

[0028] Figure 1 Flow cytometry was used to detect the expression of survivin protein in different human or murine glioma cells.

[0029] Figure 2 The luciferase reporter gene assay was used to detect the initiation activity of different truncated survivin promoters. In the figures, A compares the initiation activity of different truncated survivin elements in U87MG tumor cells; B compares the initiation activity of different truncated survivin elements in U251 tumor cells; C compares the initiation activity of different truncated survivin elements in A172 tumor cells; and D compares the initiation activity of different truncated survivin elements in GL261 tumor cells.

[0030] Figure 3 Comparison of initiation activities between the optimal truncated initiator element (SUR5) and the synthetic initiator element (mfSUR) in glioma cells and normal cells. * indicates p < 0.05; ns indicates no significant difference.

[0031] Figure 4 A comparison of oncolysis of the mfSUR-specifically initiated herpes simplex virus strains OV6S-mfSUR and OV6S-basic, MOI = 0.5. In this comparison, A represents the oncolysis of the OV6S-basic strain 48 hours after infection of U87MG tumor cells; B represents the oncolysis of the OV6S-mfSUR strain 48 hours after infection of U87MG tumor cells.

[0032] Figure 5 The cell viability of glioma cells treated with herpes simplex virus OV6S-mfSUR was determined by the CCK8 assay. * indicates p<0.05; ** indicates p<0.01; *** indicates p<0.001; **** indicates p<0.0001.

[0033] Figure 6 Pharmacodynamic results of the specifically modified OV6S-mfSUR strain in a U87MG glioma subcutaneous xenograft model in nude mice. * indicates p<0.05; ** indicates p<0.01.

[0034] Figure 7 Pharmacodynamic results of the specifically modified OV6S-mfSUR strain in an immunocompetent mouse GL261 glioma orthotopic model. ** indicates p<0.01, **** indicates p<0.0001. Detailed Implementation

[0035] This invention provides a synthetically produced promoter element (mutant fusion surivivin, mfSUR), the nucleotide sequence of which is shown in SEQ ID NO.6. This sequence contains a truncated survivin promoter element (shown in SEQ ID NO.5) and an enhancer nucleic acid sequence, exhibiting tumor-specific promoter activity. It can specifically initiate the expression of target genes in various glioma cells, while exhibiting low or no promoter activity in normal cells.

[0036] The mfSUR described in this invention is produced by replacing the promoter of the type I herpes simplex virus (ICP6) gene with a survivin promoter element using gene editing technology, followed by further processing and modification. This enables the specific replication of the ICP6 gene in tumor cells and enhances its oncolytic ability. Based on this, this invention prepares a novel oncolytic herpesvirus OV6S-mfSUR containing the aforementioned core promoter element.

[0037] In obtaining the mfSUR, this invention selected promoter elements of different lengths located upstream of the survivin gene in the nucleotide sequence: SUR1 is 2000 bp in length, and its nucleotide sequence is shown in SEQ ID NO:1; SUR2 is 1500 bp in length, and its nucleotide sequence is shown in SEQ ID NO:2; SUR3 is 1000 bp in length, and its nucleotide sequence is shown in SEQ ID NO:3; SUR4 is 650 bp in length, and its nucleotide sequence is shown in SEQ ID NO:4; and SUR5 is 319 bp in length, and its nucleotide sequence is shown in SEQ ID NO:5. This invention has found that the survivin promoter exhibits polymorphism in tumors, frequently undergoing base mutations, such as C at position -241 to T, G at position -31 to C, or A at position -1547 to G. Existing data indicate that these mutated promoter elements are positively correlated with high expression of the survivin gene in cancer and disease progression.

[0038] Therefore, we artificially synthesized the above-mentioned nucleic acid fragment mfSUR, which contains an enhancer sequence and a SUR5 truncated mutant sequence.

[0039] The promoter provided by this invention is tumor-specific and can be used to construct other oncolytic virus drugs, including oncolytic herpesviruses (such as adenovirus, vaccinia virus, myxoma virus, measles virus, Newcastle disease virus, vaccinia virus, reovirus, Coxsackie virus, etc.). The constructed oncolytic herpesviruses can specifically proliferate in tumor cells, while replicating at a reduced rate in normal cells, effectively killing tumor cells and inhibiting tumor growth, demonstrating efficacy, safety, and specificity.

[0040] SEQ ID NO:1 nucleotide sequence:

[0041]

[0042] SEQ ID NO:2 nucleotide sequence:

[0043]

[0044] SEQ ID NO:3 nucleotide sequence:

[0045] CCTCTTATCTCTGGCCATAGAACCAGAGAAGTGAGTGGATGTGATGCCCAGCTCCAGAAGTGACTCCAGAACACCCTGTTCCAAAGCAGAGGACACACTGATTTTTTTTTTAATAGGCTGCAGGACTTACTGTTGGTGGGACGCCCTGCTTTGCGAAGGGAAAGGAGGAGTTTGCCCTGAGCACAGGCCCCCACCCTCCACTGGGCTTTCCCCAGCTCCCTTGTCTTCTTATCACGGTAGTGGCCCAGTCCCTGGCCCCTGACTCCAGAAGGTGGCCCTCCTGGAAACCCAGGTCGTGCAGTCAACGATGTACTCGCCGGGACAGCGATGTCTGCTGCACTCCATCCCTCCCCTGTTCATTTGTCCTTCATGCCCGTCTGGAGTAGATGCTTTTTGCAGAGGTGGCACCCTGTAAAGCTCTCCTGTCTGACTTTTTTTTTTTTTTTAGACTGAGTTTTGCTCTTGTTGCCTAGGCTGGAGTGCAATGGCACAATCTCAGCTCACTGCACCCTCTGCCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGTTGGGATTACAGGCATGCACCACCACGCCCAGCTAATTTTTGTATTTTTAGTAGAGACAAGGTTTCACCGTGATGGCCAGGCTGGTCTTGAACTCCAGGACTCAAGTGATGCTCCTGCCTAGGCCTCTCAAAGTGTTGGGATTACAGGCGTGAGCCACTGCACCCGGCCTGCACGCGTTCTTTGAAAGCAGTCGAGGGGGCGCTAGGTGTGGGCAGGGACGAGCTGGCGCGGCGTCGCTGGGTGCACCGCGACCACGGGCAGAGCCACGCGGCGGGAGGACTACAACTCCCGGCACACCCCGCGCCGCCCCGCCTCTACTCCCAGAAGGCCGCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGC。

[0046] SEQ ID NO: 4 Nucleotide sequence:

[0047] CCCTGTTCATTTGTCCTTCATGCCCGTCTGGAGTAGATGCTTTTTGCAGAGGTGGCACCCTGTAAAGCTCTCCTGTCTGACTTTTTTTTTTTTTTTAGACTGAGTTTTGCTCTTGTTGCCTAGGCTGGAGTGCAATGGCACAATCTCAGCTCACTGCACCCTCTGCCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGTTGGGATTACAGGCATGCACCACCACGCCCAGCTAATTTTTGTATTTTTAGTAGAGACAAGGTTTCACCGTGATGGCCAGGCTGGTCTTGAACTCCAGGACTCAAGTGATGCTCCTGCCTAGGCCTCTCAAAGTGTTGGGATTACAGGCGTGAGCCACTGCACCCGGCCTGCACGCGTTCTTTGAAAGCAGTCGAGGGGGCGCTAGGTGTGGGCAGGGACGAGCTGGCGCGGCGTCGCTGGGTGCACCGCGACCACGGGCAGAGCCACGCGGCGGGAGGACTACAACTCCCGGCACACCCCGCGCCGCCCCGCCTCTACTCCCAGAAGGCCGCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGC。

[0048] SEQ ID NO: 5 Nucleotide sequence:

[0049] GCCTCTCAAAGTGTTGGGATTACAGGCGTGAGCCACTGCACCCGGCCTGCACGCGTTCTTTGAAAGCAGTCGAGGGGGCGCTAGGTGTGGGCAGGGACGAGCTGGCGCGGCGTCGCTGGGTGCACCGCGACCACGGGCAGAGCCACGCGGCGGGAGGACT ACAACTCCCGGCACACCCCGCGCCGCCCCGCCTCTACTCCCAGAAGGCCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGC.

[0050] Furthermore, the present invention provides a novel tumor-specific replicating herpes simplex virus. The specific preparation method includes: using gene editing technology to replace the original promoter sequence of the ICP6 gene with the promoter element of the aforementioned specific promoter sequence. The herpes simplex virus containing the ICP6 gene can be a wild-type herpes simplex virus, or a virus in which any gene segment (except the ICP6 gene and the ICP6 gene promoter) has been removed from the genome of the wild-type herpes simplex virus, but is not limited to this. It can be any herpes simplex virus containing a specific promoter ICP6 gene obtained by those skilled in the art through conventional techniques.

[0051] The OV6S-mfSUR described in this invention is a further modification of the YD06 recombinant strain (OV6S-basic) with the ICP34.5 and ICP47 genes knocked out. The YD06 recombinant strain (OV6S-basic) was obtained by gene editing of the type I herpes simplex virus strain YD06 (accession number: CCTCC NO: V202271) isolated in our laboratory, as shown in the specific method in patent CN117660367A.

[0052] The tumor-specific replication-innovative strain OV6S-mfSUR of this invention has stronger cell infection, intracellular replication and lysis capabilities than laboratory standard strains, and can effectively infect a variety of human and mouse cells, making it suitable for the development of oncolytic viruses or viral vectors.

[0053] The ability of a virus to kill tumor cells can be quantified by counting surviving cells after infecting cells with the same MOI (multiplicity of infection), or by using methods such as flow cytometry (FACS), MTT, and CCK-8 assays. It can also be determined through in vivo experiments, such as measuring the reduction in tumor volume induced by viral administration. To determine the characteristics of the virus of this invention, the modified herpes simplex virus YD06 recombinant strain (OV6S-basic) was used as a control.

[0054] In order to develop an oncolytic herpesvirus with enhanced replication performance, this invention prepared a recombinant strain that uses the survivin tumor-specific promoter to initiate the expression of the ICP6 gene. The strain was obtained through three rounds of purification and screening.

[0055] The specific implementation of the present invention will be further explained and described below through examples, but this does not mean that the scope of protection of the present invention is limited to the scope described in the examples.

[0056] The animal experimental methods and materials used in the embodiments described have been approved by the Medical Ethics Committee of West China Hospital of Sichuan University, and the instruments and materials used in the experiments are all commercially available products.

[0057] Example 1: Detection of survivin protein expression in different human or mouse cells

[0058] The human glioma cells used in this embodiment were U87MG, U251, and A172, and the mouse glioma cells were GL261. 1 x 10-1 cells in the logarithmic growth phase were taken from each of these cells. 7 The samples were placed in flow cytometry tubes, and blank control group, isotype control group, and survivin antibody detection group were set up. Flow cytometry detection was performed using survivin monoclonal antibody (Cat No. 66495-1-Ig) and isotype control antibody (mouse-derived IgG1).

[0059] Experimental results are as follows Figure 1 The results showed that glioma cells U87MG, U251, A172, and GL261 all highly expressed survivin protein, indicating that the survivin promoter has strong initiation activity in glioma cells.

[0060] Example 2: Comparison of the starting activity of survivin starting elements with different truncated forms

[0061] The different truncated promoter elements of survivin used in this embodiment were determined based on current research on promoter structures (including core promoter regions, positive regulatory regions, negative regulatory regions, and enhancers), resulting in SUR1, SUR2, SUR3, SUR4, and SUR5 promoter elements with different truncated sites. The truncated sites of SUR1 are -1936 to +64 bp, SUR2 are -1436 to +64 bp, SUR3 are -936 to +64 bp, SUR4 are -586 to +64 bp, and SUR5 are -255 to +64 bp.

[0062] In this embodiment, the plasmid used for detecting the activity of different truncated survivin promoters was the pGL3-basic plasmid, in which the multiple cloning site region is located upstream of the firefly luciferase gene. The pGL3-basic plasmid was digested with restriction endonucleases XhoI and HindIII, and then the nucleotide fragments of the aforementioned SUR1, SUR2, SUR3, SUR4, and SUR5 promoter elements were ligated to the digested pGL3-basic plasmid to construct plasmid vectors pGL3-SUR1, pGL3-SUR2, pGL3-SUR3, pGL3-SUR4, and pGL3-SUR5, respectively. Sequencing confirmed successful construction.

[0063] The specific operating method is as follows:

[0064] (1) U87MG, U251, and A172 cells were seeded into 96-well plates, with 5 × 10⁶ cells per well. 4 100 GL261 cells were seeded into each well of a 96-well plate. 4 Each cell was cultured overnight at 37°C.

[0065] (2) Grouping:

[0066] ①Control

[0067] ②pGL3-basic(100ng)

[0068] ③pGL3-SUR1(100ng)

[0069] ④pGL3-SUR2(100ng)

[0070] ⑤ pGL3-SUR3(100ng)

[0071] ⑥ pGL3-SUR4 (100ng)

[0072] ⑦ pGL3-SUR5(100ng)

[0073] After transfecting each cell group with the plasmids from the above groups using PEI for 24 hours, the expression of the firefly luciferase gene was detected. The initiation activity of each promoter element was compared by calculating the relative bioluminescence activity. The results are as follows: Figure 2 As shown.

[0074] Figure 2 The results showed that all truncated promoter elements could initiate the expression of firefly luciferase in both human glioma cells U87MG, U251, and A172, and murine glioma cells GL261, with the SUR5 promoter element exhibiting the strongest activity in initiating firefly luciferase expression. Subsequent experiments in this invention used the SUR5 promoter element and its optimized counterparts to construct a specific promoter for the oncolytic herpesvirus ICP6 gene.

[0075] We optimized the SUR5 promoter element, which exhibits the strongest initiation activity, by mutating C at position -241 to T and G at position -31 to C, and fusing it with an enhancer sequence to obtain the mfSUR sequence (SEQ ID NO. 6). This mfSUR sequence was then constructed into the PGL3 vector, and the initiation activities of mfSUR and SUR5 promoter elements were compared in human and murine glioma cells and normal astrocytes. The results are as follows: Figure 3 As shown. Figure 3 The results showed that the mfSUR sequence exhibited stronger initiation activity than the SUR5 element in tumor cells, while showing no significant difference compared to SUR5 in normal cells. This indicates that the mfSUR sequence promoter possesses excellent tumor-specific initiation activity.

[0076] Example 3: Comparison of oncolytic activity of mfSUR-specifically activated herpes simplex virus strains OV6S-mfSUR and OV6S-basic.

[0077] Constructing the herpes simplex virus OV6S-mfSUR strain: approximately 150 bp of genomic sequence was selected upstream and downstream of the ICP6 promoter of the herpes simplex virus OV6S-basic strain. The upstream sequence (UP1) is shown in SEQ ID NO:7.

[0078] SEQ ID NO:7 nucleotide sequence:

[0079] GTTGTCATTCTGGAAGGCGTGGTGTGGCGCCCCGGTGAGTGGCGGGCATGCGCGTG AGCGTAGCAAACGCCCGCCCACACAACGCTCCGCCCCCAACCCCTTCCCCGCTGTCAC TCGTTGTTCGTTGAACCGGGCGTCCGCCAAATAAA.

[0080] The downstream sequence (DO1) is shown in SEQ ID NO:8.

[0081] SEQ ID NO:8 nucleotide sequence:

[0082] ATGGCCAGCGCCCAGCCGCATCCTCTCCCGTCGAAGCGGGCCCCGGTTGGGG GACAGGAGGCCGGCAGCCCCAGCGCAGCCACCCAGGGGGAGGCCGCCGGGGCCCCTC TACCCACGGCCACCACGTGTACTGCCAGCGAGTCAAT.

[0083] The upstream sequence (UP1), the mfSUR promoter element (the optimal promoter element in Example 2 (SEQ ID NO. 6)), and the downstream sequence (DO1) were amplified using multiple rounds of PCR to form a fragment (UP1-SUR5-DO1) with EcoRI and HindIII restriction sites at both ends. The psp73 cloning plasmid was digested with restriction endonucleases EcoRI and HindIII, and then UP1-SUR5-DO1 was ligated into the digested psp73 cloning plasmid. After successful sequencing, the psp73-UP1-SUR5-DO1 vector was constructed.

[0084] The specific operating method is as follows:

[0085] (1) Extract OV6S-basic viral genomic DNA.

[0086] (2) 293T cells were seeded into 12-well plates and, when the cell density reached approximately 70%, the psp73-UP1-SUR5-DO1 plasmid and OV6S-basic viral genomic DNA were co-transfected into the 293T cells. The specific amounts of plasmid and transfection reagents used are as follows:

[0087] psp73-UP1-SUR5-DO1 plasmid: 1 μg;

[0088] OV6S-basic viral genome: 1ug;

[0089] Opti-MEM: 300 μl;

[0090] PEI: 3 times the total amount of plasmid.

[0091] (3) Take a sterile 1.5ml EP tube, add 300μl Opti-MEM medium, add the corresponding amount of plasmid, vortex mix well, add PEI, vortex mix again, let stand for about 20min, and then add it to a 293T cell culture dish.

[0092] (4) After culturing in a CO2 incubator at 37℃ for 8 hours, the cell culture medium containing the transfection mixture was replaced with fresh DMEM complete culture medium. After culturing for 48 hours, the supernatant of the culture medium was collected and stored at 4℃.

[0093] (5) Finally, the cell culture medium was added to the prepared 96-well plate, and monoclonal virus plaques were selected by gradient dilution. After sequencing verification, the herpes simplex virus OV6S-mfSUR strain was successfully obtained.

[0094] The procedure for comparing the oncolytic activity of the OV6S-mfSUR and OV6S-basic strains in this embodiment is as follows:

[0095] U87MG tumor cells were seeded into 96-well plates, with 1×10⁻⁶ cells per well. 4 Cells were cultured overnight at 37°C. Herpes simplex virus strains OV6S-mfSUR and OV6S-basic were added to 96-well plates at the same viral titer (MOI = 0.5), with three replicates per group. After culturing at 37°C for 48 hours, the oncolysis of U87MG by OV6S-mfSUR and OV6S-basic strains was observed under a microscope.

[0096] Experimental results are as follows Figure 4 As shown, the results indicate that under the same viral titer infection conditions, the oncolytic ability of herpes simplex virus OV6S-mfSUR to kill U87MG glioma cells is stronger than that of the OV6S-basic strain, proving that the mfSUR promoter specifically activates the ICP6 gene of herpes simplex virus in tumor cells, thereby enhancing the replication and killing ability of herpes simplex virus in tumor cells.

[0097] Example 4: Detection of cell viability of glioma cells after treatment with herpes simplex virus OV6S-mfSUR using the CCK8 assay.

[0098] The specific operating method is as follows:

[0099] Human glioma cells U87MG, U251, and A172, and mouse glioma cells GL261, all in logarithmic growth phase, were collected, digested, and then distributed at 2 × 10⁻⁶ cells per well. 4 Cells were cultured in 96-well plates with three replicates of each cell type. A blank control group (culture medium only), a control group (containing tumor cells but no herpes simplex virus), an OV6S-basic group, and an OV6S-mfSUR group were established. Herpes simplex virus was added at an MOI of 0.5. The plates were incubated at 37°C with 5% CO2 for 72 hours. Afterward, 10 μl of CCK8 solution was added to each well, and the plates were incubated for 1 hour. The absorbance of each well was read at 450 nm using a microplate reader, and the relative cell viability was calculated.

[0100] The results are as follows Figure 5 As shown, under the same infection conditions, the OV6S-mfSUR strain, which specifically initiates ICP6, has a significantly better killing effect on glioma cells than the OV6S-basic strain. This demonstrates that the OV6S-mfSUR strain replicates better in glioma cells than the OV6S-basic strain, significantly improving its oncolytic ability.

[0101] Example 5: Pharmacodynamic evaluation of the specifically modified OV6S-mfSUR strain in a U87MG glioma subcutaneous xenograft model in nude mice.

[0102] The specific operating method is as follows:

[0103] 3×10 6 U87MG glioma cells were inoculated subcutaneously into the right back near the right hind limb of nude mice aged 5 to 8 weeks. The tumors were allowed to grow to 100 mm². 3 When the tumor is small, inject the herpes simplex virus into the tumor, measure the tumor volume after 2-3 days, and plot the tumor growth curve.

[0104] The groups are as follows:

[0105] (1) Control group: 100 μL sterile PBS;

[0106] (2) OV6S-basic group: 1×10 per bird 6 PFU, volume 100μL;

[0107] (3) OV6S-mfSUR group: 1×10 per animal 6 PFU, volume 100μL.

[0108] Dosage frequency: once a week, for a total of 2 times.

[0109] Experimental results are as follows Figure 6 As shown in the figure, in the U87MG subcutaneous glioma model, the OV6S-mfSUR group showed statistically significant differences in antitumor activity compared to the OV6S-basic group and the Control group (* for p<0.05; ** for p<0.01). This indicates that the genetically modified OV6S-mfSUR strain can better inhibit tumor growth compared to existing recombinant strains.

[0110] Example 6: Pharmacodynamic evaluation of the specifically modified OV6S-mfSUR strain in an immunocompetent mouse GL261 glioma orthotopic model.

[0111] The specific operating method is as follows:

[0112] 1×10 5 GL261 glioma cells were injected into the deep right frontal lobe of homologous C57BL / 6 mice. After tumor formation, herpes simplex virus was injected in situ. The mice's performance and survival time were observed daily.

[0113] The groups are as follows:

[0114] ①Control group: 5μL sterile PBS;

[0115] ②OV6S-basic group: 1x106 PFU per device, 5μL volume;

[0116] ③OV6S-mfSUR group: 1x106 PFU per device, 5μL volume.

[0117] Dosage frequency: 1 time.

[0118] Experimental results are as follows Figure 7 As shown in the figure, in the GL261 orthotopic glioma transplantation model, the OV6S-mfSUR group showed statistically significant differences in the inhibition of orthotopic tumors in mice compared with the OV6S-basic group and the Control group (* for p<0.05; ** for p<0.01), and the survival time of mice in the OV6S-mfSUR group was significantly prolonged.

[0119] As can be seen from the above embodiments, the present invention provides a promoter that specifically initiates the ICP6 gene, and constructs a recombinant oncolytic herpesvirus based on the promoter. After the oncolytic virus enters tumor cells, it can specifically express the ICP6 gene in the tumor cells, thereby improving the replication ability and oncolytic activity of the recombinant oncolytic virus. This provides a more effective method to improve the effect of oncolytic viruses and represents a significant advancement.

Claims

1. A core start element, characterized by: The nucleotide sequence is as shown in SEQ ID NO. 5; or a nucleic acid molecule having 1 or several base insertions, deletions and / or substitution mutations in the nucleotide sequence shown in SEQ ID NO. 5, and still having a promoter function.

2. The core start element of claim 1, wherein: The nucleotide sequence is as shown in SEQ ID NO.

6.

3. A promoter comprising the core promoter element of claim 1 or 2.

4. Use of the core promoter element of claim 1 or 2, or the promoter of claim 3 in the preparation of a recombinant oncolytic virus.

5. A recombinant vector comprising the core promoter element of claim 1 or 2, or the promoter of claim 3.

6. The recombinant vector of claim 5, wherein: The recombinant vector is a plasmid vector or a viral vector.

7. The recombinant vector of claim 6, wherein: The viral vector is at least one of herpes virus, adenovirus, vaccinia virus, myxoma virus, measles virus, Newcastle disease virus, vaccinia virus, reovirus, coxsackie virus; the plasmid vector is pGL3-basic plasmid.

8. An antitumor agent, characterized by comprising: the compound or a pharmaceutically acceptable salt of the compound according to claim 1. The recombinant vector of any one of claims 5-7 is prepared by adding a pharmaceutically acceptable auxiliary ingredient.

9. The antitumor drug according to claim 8, characterized by: The tumor is a tumor with high expression of Survivin; preferably at least one of glioma, osteosarcoma, melanoma, breast cancer, head and neck cancer, pancreatic cancer, liver cancer or bladder cancer.

10. A method of producing the recombinant vector according to any one of claims 5 to 7, characterized in that, The method comprises the following steps: a) obtaining a promoter with a nucleotide sequence as shown in SEQ ID NO. 6; b) inserting the promoter into an oncolytic virus vector to regulate the expression of ICP6 gene; c) constructing and packaging an oncolytic virus vector containing a promoter with a nucleotide sequence as shown in SEQ ID NO. 6 by genetic engineering technology.

Images