Double-stranded ribonucleic acid for inhibiting expression of INHBE gene as well as modifier, conjugate and application of double-stranded ribonucleic acid

Abstract

The present disclosure relates to a double-stranded ribonucleic acid for inhibiting expression of an INHBE gene, and modifiers, conjugates and uses thereof. Specifically, the invention relates to a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modifier, a double-stranded ribonucleic acid conjugate, a prodrug, a pharmaceutical composition and application for inhibiting the expression of the INHBE gene, and a method for inhibiting the expression of the INHBE gene in a cell. The double-stranded ribonucleic acid as well as the modifier, the conjugate and the prodrug thereof provided by the invention can be combined in cells to form an RNA-induced silence complex (RISC), cut mRNA transcribed by the INHBE gene and efficiently and specifically inhibit the expression of the INHBE gene, is used for treating INHBE gene mediated diseases, and has an important application prospect in clinical disease treatment.

Description

Technical Field

[0001] This disclosure pertains to the field of biomedicine. Specifically, this disclosure relates to a double-stranded ribonucleic acid (BRNA) for inhibiting INHBE gene expression, a BRNA modification, a BRNA conjugate, a prodrug, a pharmaceutical composition, and its use, as well as a method for inhibiting intracellular INHBE gene expression. Background Technology

[0002] Inhibin β-E (INHBE) is a member of the transforming growth factor-β (TGF-β) family. The proprotein of INHBE is proteolytically processed to produce the inhibin β-subunit. INHBE is involved in regulating many cellular processes, including cell proliferation, apoptosis, immune responses, and hormone secretion. This gene may be upregulated under endoplasmic reticulum stress, and this protein may inhibit cell proliferation and growth in the pancreas and liver. INHBE mRNA is primarily expressed in the liver and participates in the regulation of hepatocyte growth and differentiation, and has been shown to be positively correlated with insulin resistance and body mass index in humans. Real-time quantitative PCR analysis has also shown increased INHBE gene expression in liver samples from patients with insulin resistance. Furthermore, INHBE gene expression is increased in the liver of db / db mice (a rodent model of type 2 diabetes). Inhibition of INHBE expression in db / db mice has been shown to suppress weight gain, attributed to fat reduction rather than weight loss.

[0003] Current treatments for lipid metabolism disorders include lifestyle modifications, diet, exercise, and medications such as lipid-lowering drugs, statins, and other drugs. However, these therapies and treatments are often limited by adherence, are not always effective, cause side effects, and lead to drug interactions.

[0004] Furthermore, literature reports exome sequencing of 360,000 individuals, highlighting INHBE as a novel therapeutic target for abdominal obesity and cardiometabolic diseases. A causal relationship between healthy body mass index and cardiometabolic disease was confirmed. Carriers of the INHBE pLOF variant had more favorable metabolic profiles and a lower risk of coronary artery disease and type 2 diabetes (T2D) than non-carriers. Importantly, by reducing abdominal fat, drugs targeting INHBE will have a different biological mechanism than existing coronary artery disease and T2D drugs and may complement current therapies.

[0005] This invention aims to provide double-stranded ribonucleic acid (BRNA), BRNA modifiers, BRNA conjugates, prodrugs, and pharmaceutical compositions that can be effectively applied to RNA-induced silencing complex (RISC)-mediated cleavage of the INHBE gene RNA transcript, thereby selectively and effectively inhibiting the expression of the INHBE gene and achieving the goal of disease treatment. Summary of the Invention

[0006] The problem the invention aims to solve

[0007] Given the problems existing in the prior art, such as the need to develop more INHBE inhibitors for the treatment of INHBE-related diseases including obesity (e.g., abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (e.g., coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome, as well as other unidentified related conditions, pathologies, or syndromes, this disclosure aims to provide a series of double-stranded ribonucleic acid (BRNA), BRNA modifications, BRNA conjugates, prodrugs, and pharmaceutical compositions for inhibiting INHBE gene expression, which have significant application prospects in the clinical treatment of diseases.

[0008] Solution for solving the problem

[0009] [1]. A double-stranded ribonucleic acid that inhibits the expression of the INHBE gene, the double-stranded ribonucleic acid comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are anticomplementary and / or substantially anticomplementary to form the double-stranded region of the double-stranded ribonucleic acid;

[0010] The sense strand comprises a sequence A that differs from the target sequence by no more than 3 nucleotides in at least 15 consecutive nucleotides, and the antisense strand comprises a sequence B that differs from the target sequence by no more than 3 nucleotides in its reverse complementary sequence of at least 15 consecutive nucleotides.

[0011] The target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NO:1-6, 507-509, 610, 611 and sequences consisting of at least 15 consecutive nucleotides contained in any one of SEQ ID NO:1-6, 507-509, 610, 611.

[0012] [2]. According to the double-stranded ribonucleic acid of [1], wherein the target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NO:7-24, 504-509, 610, 611, the sense strand comprises sequence A consisting of at least 15 consecutive nucleotides from the nucleotide sequences shown in any one of SEQ ID NO:7-24, 504-509, 610, 611, and the antisense strand comprises sequence B consisting of at least 15 consecutive nucleotides from the nucleotide sequences shown in any one of SEQ ID NO:7-24, 504-509, 610, 611 that is anticomplementary to and / or substantially anticomplementary to the nucleotide sequences shown in the nucleotide sequences shown in the SEQ ID NO:7-24, 504-509, 610, 611.

[0013] [3]. According to the double-stranded ribonucleic acid described in [1] or [2], wherein the positive strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and even more preferably 19, 20, 21 or 23 nucleotides.

[0014] [4]. According to the double-stranded ribonucleic acid described in [3], wherein the nucleotide sequence of the positive strand is a sequence A that differs by no more than 1 nucleotide from the sequence consisting of 15-28 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NO: 7-24, 504-509, 610, 611, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and even more preferably 19, 20, 21 or 23 nucleotides.

[0015] [5]. The double-stranded ribonucleic acid according to any one of [1]-[4], wherein the antisense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and even more preferably 19, 21 or 23 nucleotides.

[0016] [6]. According to the double-stranded ribonucleic acid of [5], wherein the nucleotide sequence of the antisense strand is a sequence B that differs by no more than 1 nucleotide from the reverse complementary sequence of a sequence consisting of 15-28 consecutive nucleotides in any one of the nucleotide sequences shown in SEQ ID NO: 7-24, 504-509, 610, 611, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and even more preferably 19, 21 or 23 nucleotides.

[0017] [7]. The double-stranded ribonucleic acid according to any one of [1]-[6], wherein the length of the double-stranded region is 15-25 nucleotides, preferably 19-23 nucleotides, more preferably 19, 20, 21 or 23 nucleotides.

[0018] [8]. According to any one of [1]-[7], the double-stranded ribonucleic acid, wherein,

[0019] The positive and negative strands are complementary to form the double-stranded region, and the 3' end of the positive strand has 1-3 protruding nucleotides extending out of the double-stranded region, while the 3' end of the negative strand forms a blunt end; or,

[0020] The sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region, while the 3' end of the sense strand forms a blunt end; or,

[0021] The sense strand and the antisense strand are complementary to form the double-stranded region, and both the sense strand and the antisense strand have 1-3 protruding nucleotides extending out of the double-stranded region at their 3' ends; or,

[0022] The positive chain and the negative chain complement each other to form the double-chain region, and the 3' ends of both the positive chain and the negative chain form flat ends.

[0023] [9]. The double-stranded ribonucleic acid according to any one of [1]-[8], wherein the sense strand and the antisense strand are selected from the following combinations:

[0024] The sense strand includes the sense strand of any of the siRNAs shown in Tables 1 and 1-1 of this document, and the antisense strand includes the antisense strand of the corresponding siRNA.

[0025] Preferably, the justice chain and the antisense chain are selected from the following combinations:

[0026] The sense strand includes the sense strand of any one of the siRNAs shown in Tables 1 and 1-1 of this document: siRNA 15, siRNA 419, siRNA 421-siRNA 425, siRNA 434, siRNA 466, siRNA 480-siRNA 487, and siRNA 492. The antisense strand includes the antisense strand of the corresponding siRNA.

[0027]

[10] . The double-stranded ribonucleic acid according to any one of [1]-[9], wherein each nucleotide in the sense strand is independently a modified nucleotide or an unmodified nucleotide, and / or each nucleotide in the antisense strand is independently a modified nucleotide or an unmodified nucleotide.

[0028]

[11] . The double-stranded ribonucleic acid according to any one of [1]-

[10] , wherein any two nucleotides in the sense strand are linked by a phosphodiester bond, a thiophosphate diester bond or a dithiophosphate diester bond, and / or any two nucleotides in the antisense strand are linked by a phosphodiester bond, a thiophosphate diester bond or a dithiophosphate diester bond.

[0029]

[12] . The double-stranded ribonucleic acid according to any one of [1]-

[11] , wherein the 5' terminal nucleotide of the antisense strand is connected to a 5' phosphate group or a 5' phosphate derivative group, or the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group.

[0030]

[13] . The double-stranded ribonucleic acid according to any one of [1]-

[12] , wherein neither the 5' end nor the 3' end of the positive strand is connected to a reverse debased deoxyribose residue, or the 5' end or 3' end nucleotide of the positive strand is connected to a reverse debased deoxyribose residue, or the 5' end and 3' end nucleotide of the positive strand are respectively connected to a reverse debased deoxyribose residue.

[0031]

[14] . The double-stranded ribonucleic acid according to any one of [1]-

[13] , wherein the double-stranded ribonucleic acid is siRNA.

[0032]

[15] . A double-stranded ribonucleic acid (BRNA) modifier, which is a BRNA modifier as described in any one of [1]-

[14] , wherein the BRNA modifier comprises at least one of the following chemical modifications:

[0033] (1) Modification of at least one nucleotide in the positive strand,

[0034] (2) Modification of the phosphodiester bond at at least one position in the positive chain.

[0035] (3) Modification of at least one nucleotide in the antisense strand,

[0036] (4) Modification of the phosphodiester bond at at least one position in the antisense chain;

[0037] Optionally, the nucleotide sequence of the positive strand of the double-stranded ribonucleic acid (SSRNA) modification comprises sequence A and sequence D, wherein the 3' end of sequence A in the positive strand is connected to sequence D, which consists of 1-3 nucleotides, preferably 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the antisense strand of the SSRNA modification comprises sequence B and sequence E, wherein the 3' end of sequence B in the antisense strand is connected to sequence E, which consists of 1-3 nucleotides, preferably 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the positive strand of the SSRNA modification comprises sequence A', which is formed by excluding 1-3 nucleotides from the 3' end of sequence A in the positive strand.

[0038] Optionally, the sense and antisense strands of the double-stranded ribonucleic acid modification are selected from the following sequence combinations:

[0039] The nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;

[0040] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked with sequence E;

[0041] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in the sequence A linked to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;

[0042] Alternatively, the nucleotide sequence of the sense strand is the sequence shown by sequence A followed by sequence D, and the nucleotide sequence of the antisense strand is the sequence shown by sequence B followed by sequence E.

[0043] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;

[0044] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked to sequence E.

[0045]

[16] . According to the double-stranded ribonucleic acid modified product of

[15] , wherein the modification of the nucleotide is selected from 2'-fluoro modification, 2'-alkoxy modification, 2'-substituted alkoxy modification, 2'-alkyl modification, 2'-substituted alkyl modification, 2'-deoxy modification, nucleotide derivative modification or any combination of two or more thereof;

[0046] Preferably, the modification of the nucleotide is selected from 2'-F modification, 2'-O-CH3 modification, 2'-O-CH2-CH2-O-CH3 modification, 2'-O-CH2-CH=CH2 modification, 2'-CH2-CH2-CH=CH2 modification, 2'-deoxy modification, nucleotide derivative modification, or any combination of two or more thereof.

[0047]

[17] . The double-stranded ribonucleic acid modification according to

[15] or

[16] , wherein the nucleotide derivative in the nucleotide derivative modification is selected from isonucleotides, LNA, ENA, cET, UNA or GNA.

[0048]

[18] . The double-stranded ribonucleic acid modified according to any one of

[15] -

[17] , wherein, along the direction from the 5' end to the 3' end, the ribonucleotides at the 7th, 9th, 10th and 11th positions of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides;

[0049] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 5, 7, 8, and 9 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0050] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9, and 11 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0051] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 11, and 13 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0052] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 8, and 9 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0053] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 9, and 11 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0054] Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 11, 12, 13, and 17 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0055] Alternatively, along the direction from the 3' end to the 5' end, the ribonucleotides at positions 10, 11, 12, and 16 of the positive strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0056]

[19] . The double-stranded ribonucleic acid modification according to any one of

[15] -

[18] , wherein neither the 5' end nor the 3' end of the positive strand is connected to a reverse debased deoxyribose residue, or the 5' end or 3' end nucleotide of the positive strand is connected to a reverse debased deoxyribose residue, or the 5' end and 3' end nucleotide of the positive strand are respectively connected to a reverse debased deoxyribose residue.

[0057]

[20] . The double-stranded ribonucleic acid modification according to any one of

[15] -

[19] , wherein, along the 5' end to the 3' end direction, the positive strand contains a phosphothioester bond located at the following positions:

[0058] Between the first and second nucleotides starting at the 5' end of the positive strand;

[0059] Between the second and third nucleotides starting at the 5' end of the positive strand;

[0060] Between the first and second nucleotides starting at the 3' end of the positive strand;

[0061] Between the second and third nucleotides starting at the 3' end of the positive strand;

[0062] or,

[0063] The positive chain contains phosphothiophosphate diester bonds located at the following positions:

[0064] Between the first and second nucleotides starting at the 5' end of the positive strand;

[0065] Between the second and third nucleotides starting at the 5' end of the positive strand;

[0066] or,

[0067] When the 3' terminal nucleotide of the positive strand is linked to a reverse debased deoxyribose residue, the positive strand contains a phosphothiodiester bond located at the following positions along the 5'-to-3' direction:

[0068] Between the first and second nucleotides starting at the 5' end of the positive strand;

[0069] Between the second and third nucleotides starting at the 5' end of the positive strand; and

[0070] Between the reverse debased deoxyribose residue starting at the 3' end of the positive strand and the first nucleotide;

[0071] When the 5' and 3' nucleotides of the positive strand are respectively linked to reverse debased deoxyribose residues, the positive strand contains phosphothioester bonds located at the positions shown below along the 5' to 3' direction:

[0072] Between the reverse debased deoxyribose residue starting at the 5' end of the positive strand and the first nucleotide;

[0073] Between the first and second nucleotides starting at the 5' end of the positive strand; and

[0074] The reverse debasing deoxyribose residue starting at the 3' end of the positive strand is between the first nucleotide and the first nucleotide.

[0075]

[21] . The double-stranded ribonucleic acid modified according to any one of

[15] -

[20] , wherein, along the direction from the 5' end to the 3' end, the ribonucleotides at the 2nd, 6th, 14th and 16th positions of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0076] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0077] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0078] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0079] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0080] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified by the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0081] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0082] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 5, 7, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0083]

[22] . The double-stranded ribonucleic acid modification according to any one of

[15] -

[21] , wherein, along the 5' end to the 3' end direction, the nucleotide at the 5' end of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group, or the nucleotide at the 5' end of the antisense strand is connected to a 5' phosphate group or a 5' phosphate derivative group.

[0084]

[23] . The double-stranded ribonucleic acid modification according to any one of

[15] -

[22] , wherein the antisense strand comprises a phosphothiophosphate diester bond or a dithiophosphate diester bond located at the following positions:

[0085] The antisense chain contains a phosphothiophosphate diester bond located at the following positions:

[0086] Between the first and second nucleotides starting at the 5' end of the antisense strand;

[0087] Between the second and third nucleotides starting at the 5' end of the antisense strand;

[0088] Between the first and second nucleotides starting at the 3' end of the antisense strand;

[0089] Between the second and third nucleotides starting at the 3' end of the antisense strand;

[0090] or,

[0091] The antisense chain contains a thiophosphate diester bond and a dithiophosphate diester bond located at the positions shown below:

[0092] The first and second nucleotides starting at the 5' end of the antisense strand are connected by a phosphate dithioester bond;

[0093] The second and third nucleotides starting at the 5' end of the antisense strand are connected by a phosphate dithioester bond;

[0094] The first and second nucleotides, starting at the 3' end of the antisense strand, are connected by a dithiophosphate diester bond.

[0095]

[24] . A double-stranded ribonucleic acid (BRNA) modifier according to any one of

[15] -

[23] , wherein the positive strand of the BRNA modifier has a structure as shown in (a1)-(a2). 14 The structure shown in any one of the following examples:

[0096] (a1)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0097] (a2)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0098] (a3)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0099] (a4)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15-mN 16 -mN 17 -mN 18 -mN 19 -3',

[0100] (a5)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3',

[0101] (a6)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3',

[0102] (a7)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3',

[0103] (a8)5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN18 -mN 19 -3',

[0104] (a9)5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3',

[0105] (a 10 )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-3',

[0106] (a 11 )5'-(invAb)-(s)-mN1-(s)-mN2-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-3',

[0107] (a 12 5'-mN 19 -(s)-mN 18 -(s)-N 17 f-mN 16 -mN 15 -mN 14 -N 13 fN 12 fN 11f-mN 10 -mN9-mN8-mN7-m N6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3',

[0108] (a 13 )5'-mN 21 -(s)-mN 20 -(s)-mN 19 -mN 18 -N 17 f-mN 16 -mN 15 -mN 14 -N 13 fN 12 fN 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3',

[0109] (a 14 )5'-mN 20 -(s)-mN 19 -(s)-mN 18 -mN 17 -N 16 f-mN 15 -mN 14 -mN 13 -N 12 fN 11 fN 10 f-mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3',

[0110] Among them, N1-N 23 Ribonucleotides selected independently of each other from bases A, U, C, or G.

[0111] The capital letter T indicates a deoxyribonucleotide with the base thymine.

[0112] The lowercase letter 'm' indicates that the ribonucleotide adjacent to the right of 'm' is a ribonucleotide modified with 2'-O-CH3.

[0113] The lowercase letter 'f' indicates that the ribonucleotide adjacent to the left of 'f' is a 2'-F modified ribonucleotide.

[0114] (invAb): Indicates a reverse debasing deoxyribose residue.

[0115] -(s)- indicates that two adjacent nucleotides are linked by a phosphothioester bond.

[0116] Optionally, the ribosome of the 5' terminal nucleotide of the positive strand has a 5' hydroxyl group.

[0117]

[25] . The double-stranded ribonucleic acid modifier according to any one of

[15] -

[24] , wherein the antisense strand of the double-stranded ribonucleic acid modifier has a structure as shown in (b1)-(b1). 32 The structure shown in any one of the following examples:

[0118] (b1)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0119] (b2)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0120] (b3)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0121] (b4)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0122] (b5)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0123] (b6)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0124] (b7)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0125] (b8)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0126] (b9)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0127] (b 10 )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN23 -3',

[0128] (b 11 )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0129] (b 12 )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0130] (b 13 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3',

[0131] (b 14)5’-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0132] (b 15 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0133] (b 16 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0134] (b 17 )5’-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN19 -(s)-mN 20 -(s)-mN 21 -3',

[0135] (b 18 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0136] (b 19 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0137] (b 20 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0138] (b 21)5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0139] (b 22 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0140] (b 23 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0141] (b 24)5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0142] (b 25 )5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0143] (b 26 )5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0144] (b 27 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11-mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0145] (b 28 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0146] (b 29 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’,

[0147] (b 30 )5’-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0148] (b 31 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0149] (b 32 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -(ss)-mN 21 -3', where N1-N 23 Ribonucleotides selected independently of each other from bases A, U, C, or G.

[0150] The capital letter T indicates a deoxyribonucleotide with the base thymine.

[0151] The lowercase letter 'm' indicates that the ribonucleotide adjacent to the right of 'm' is a ribonucleotide modified with 2'-O-CH3.

[0152] The lowercase letter 'f' indicates that the ribonucleotide adjacent to the left of 'f' is a 2'-F modified ribonucleotide.

[0153] P1 indicates that the nucleotide adjacent to the right of this letter is a 5'-phosphate nucleotide.

[0154] EVP indicates that the nucleotide adjacent to the right of this letter combination is a 5'-trans-vinylphosphonate nucleotide.

[0155] -(s)- indicates that two adjacent nucleotides are linked by a phosphothioester bond.

[0156] -(ss)- indicates that two adjacent nucleotides are linked by a phosphothioester bond.

[0157] [GNA] indicates that the ribonucleotide adjacent to it on the right is a ribonucleotide modified with GNA.

[0158] Optionally, the 5' terminal nucleotide of the antisense strand does not have P1 or EVP, indicating that the ribose group of the nucleotide has a 5' hydroxyl group.

[0159]

[26] . The double-stranded ribonucleic acid modification according to any one of

[15] -

[25] , wherein the sense strand and the antisense strand are selected from the following combinations:

[0160] The sense strand includes the sense strand of any of the double-stranded RNA modifications shown in Table 2 of this document, and the antisense strand includes the antisense strand of the corresponding double-stranded RNA modification.

[0161] Preferably, the justice chain and the antisense chain are selected from the following combinations:

[0162] The sense strand includes the sense strand of any one of the siRNAs shown in Table 2 of this document: siRNA 414, siRNA 436-siRNA 440, siRNA 449, siRNA 472, and siRNA 488-siRNA 489. The antisense strand includes the antisense strand of the corresponding siRNA.

[0163]

[27] . A double-stranded ribonucleic acid (BRNA) modifier comprising a modifier in any one of

[15] -

[26] whose 3' end of the positive strand of the BRNA modifier is modified to be flat-ended, optionally by excluding protruding nucleotides extending from the 3' end of the positive strand of the BRNA modifier in any one of

[15] -

[26] to form a double-stranded region.

[0164]

[28] . A double-stranded ribonucleic acid conjugate, wherein the double-stranded ribonucleic acid conjugate comprises a double-stranded ribonucleic acid as described in any one of [1]-

[14] , or a double-stranded ribonucleic acid modifier as described in any one of

[15] -

[27] ; and a conjugation group attached to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modifier.

[0165]

[29] . The double-stranded ribonucleic acid conjugate according to

[28] , wherein the conjugating group has any of the following structures:

[0166]

[0167]

[0168]

[30] . The double-stranded ribonucleic acid conjugate according to

[28] or

[29] , wherein the conjugation group is attached to the 3' end of the positive strand.

[0169]

[31] . The double-stranded ribonucleic acid conjugate according to any one of

[28] -

[30] , wherein the conjugation group is conjugated to the 3' end of the positive strand via a phosphodiester bond or a thiophosphate diester bond;

[0170] Preferably, the sense strand and antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form the double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3' end of the sense strand is blunt, and the 3' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region;

[0171] or,

[0172] The sense and antisense strands of the double-stranded ribonucleic acid conjugate are complementary to form the double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3' end of the sense strand is flattened, as is the 3' end of the antisense strand.

[0173]

[32] . The double-stranded ribonucleic acid conjugate according to any one of

[28] -

[31] , wherein the double-stranded ribonucleic acid conjugate has the following structure:

[0174]

[0175] The double helix structure is a double-stranded ribonucleic acid or a double-stranded ribonucleic acid modified product.

[0176]

[33] . The double-stranded ribonucleic acid conjugate according to any one of

[28] -

[32] , wherein the double-stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting the expression of the INHBE gene.

[0177]

[34] . The double-stranded ribonucleic acid conjugate according to any one of

[28] -

[33] , wherein the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNAs shown in Table 1 and Table 1-1 of this document with a conjugation group, or the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNA modifiers shown in Table 2 of this document with a conjugation group;

[0178] Preferably, in the double-stranded ribonucleic acid conjugate, the sense strand and the antisense strand are selected from the following combinations:

[0179] The sense strand comprises the sense strand of any of the siRNA conjugates shown in Table 3 of this document, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate.

[0180] More preferably, the justice chain and the antisense chain are selected from the following combinations:

[0181] The sense strand includes the sense strand of any one of the siRNAs shown in Table 3 of this document: siRNA 417, siRNA 451-siRNA 455, siRNA 464, siRNA 476, and siRNA 490-siRNA 491. The antisense strand includes the antisense strand of the corresponding siRNA.

[0182]

[35] . Prodrugs of any of the double-stranded ribonucleic acid (BRNA) described in any of [1]-

[14] ,

[15] -

[27] , or

[28] -

[34] double-stranded ribonucleic acid conjugates.

[0183]

[36] . A pharmaceutical composition comprising at least one of the following: double-stranded ribonucleic acid as described in any one of [1]-

[14] , double-stranded ribonucleic acid modified as described in any one of

[15] -

[27] , double-stranded ribonucleic acid conjugate as described in any one of

[28] -

[34] , or a prodrug as described in

[35] .

[0184]

[37] . The pharmaceutical composition according to

[36] further comprises one or more pharmaceutically acceptable carriers, and optionally one or more additional therapeutic agents.

[0185]

[38] . Use of the double-stranded ribonucleic acid according to any one of [1]-

[14] , the double-stranded ribonucleic acid modified according to any one of

[15] -

[27] , the double-stranded ribonucleic acid conjugate according to any one of

[28] -

[34] , the prodrug according to

[35] , or the pharmaceutical composition according to

[36] or

[37] in at least one of the following:

[0186] (1) Inhibit INHBE gene expression in vivo or in vitro, or prepare a drug for inhibiting INHBE gene expression;

[0187] (2) To prevent or treat diseases associated with abnormal expression of the INHBE gene, or to prepare drugs for the prevention or treatment of diseases associated with abnormal expression of the INHBE gene;

[0188] (3) To treat subjects with diseases that would benefit from reduced INHBE gene expression, or to prepare a medicine for treating subjects with diseases that would benefit from reduced INHBE gene expression.

[0189]

[39] . According to the use described in

[38] , wherein the diseases associated with abnormal expression of the INHBE gene are selected from the group consisting of:

[0190] Obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome.

[0191]

[40] . A method for inhibiting intracellular INHBE gene expression in vivo or in vitro, wherein the method comprises contacting the cells with a double-stranded ribonucleic acid according to any one of [1]-

[14] , a double-stranded ribonucleic acid modifier according to any one of

[15] -

[27] , a double-stranded ribonucleic acid conjugate according to any one of

[28] -

[34] , a prodrug according to

[35] , or a pharmaceutical composition according to

[36] or

[37] .

[0192]

[41] . The method according to

[40] , wherein the cell is an in vivo cell or an in vitro cell.

[0193]

[42] . The method according to

[40] or

[41] , wherein the cells are in the subject;

[0194] Preferably, the subject is a mammal, more preferably a human;

[0195] Preferably, the subject has at least one of the following characteristics:

[0196] Abnormal expression of the INHBE gene in vivo, more specifically, abnormally high expression of the INHBE gene;

[0197] Suffering from a disease associated with abnormal expression of the INHBE gene;

[0198] Suffering from a disease in which reduced expression of the INHBE gene would benefit.

[0199]

[43] . A double-stranded ribonucleic acid as described in any one of [1]-

[14] , a double-stranded ribonucleic acid modified as described in any one of

[15] -

[27] , a double-stranded ribonucleic acid conjugate as described in any one of

[28] -

[34] , a prodrug as described in

[35] , or a pharmaceutical composition as described in

[36] or

[37] , for the purpose of treatment.

[0200] The effects of the invention

[0201] In some implementations, the double-stranded ribonucleic acid provided in this disclosure can bind intracellularly to form an RNA-induced silencing complex (RISC), cleaving the mRNA transcribed from the INHBE gene, and efficiently and specifically inhibiting the expression of the INHBE gene. This can be used to treat INHBE-related diseases, including obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome, as well as other unidentified related conditions, pathologies, or syndromes.

[0202] Furthermore, in this disclosure, the double-stranded ribonucleic acid is siRNA. The siRNA targets and binds to and degrades the mRNA of the INHBE gene transcription product, exerting RNA interference to inhibit the protein expression of the INHBE gene. It is an INHBE inhibitor with high inhibition rate and good specificity.

[0203] In some embodiments, this disclosure modifies double-stranded ribonucleic acid to obtain double-stranded ribonucleic acid modified products. The double-stranded ribonucleic acid modified products have high stability and are suitable for use in in vivo disease treatment.

[0204] Furthermore, the double-stranded ribonucleic acid modification is an siRNA modification, which has high stability and good inhibitory activity.

[0205] In some embodiments, this disclosure involves attaching conjugation groups to double-stranded ribonucleic acid (BRNA) or BRNA modifiers to obtain BRNA or BRNA conjugates, which can be used for highly efficient targeted delivery to tissues and cells, reducing the impact of BRNA or BRNA modifiers on non-targeted normal tissues and cells, and improving their safety in clinical disease treatment.

[0206] Furthermore, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, which, while maintaining the inhibitory activity and stability of siRNA, also has organ or tissue targeting properties. This can reduce the impact on other tissues or organs and reduce the amount of siRNA molecules used, thereby achieving the goals of reducing toxicity and lowering costs.

[0207] Furthermore, the conjugating group in this disclosure is a group with the structure shown in Formula I (GalNAc). GalNAc can be used for targeted delivery into liver cells and tissues to efficiently inhibit the expression of the INHBE gene in the liver. In addition, the siRNA conjugate of this disclosure has low toxicity and an excellent drug safety window. Attached Figure Description

[0208] Figure 1 The inhibition rate of N-ER-FY046149M47L96 at various concentrations in PHH cells in Example 14 is shown.

[0209] Figure 2 The differentially expressed gene N-ER-FY046149M47L96 in Example 14 is a gene that satisfies the condition |log2(FoldChange)|>1&padj<0.05 at a concentration of 20nM.

[0210] Figure 3 The differentially expressed gene N-ER-FY046149M47L96 in Example 14 is a gene that satisfies the condition |log2(FoldChange)|>1&padj<0.05 at a concentration of 100nM. Detailed Implementation

[0211] definition

[0212] Unless otherwise stated, the terms used in this invention have the following meanings.

[0213] In the claims and / or description of this invention, the words “a”, “an”, or “the” may refer to “one”, but may also refer to “one or more”, “at least one”, and “one or more”.

[0214] As used in the claims and specification, the words “comprising,” “having,” “including,” or “containing” mean included or open-ended and do not exclude additional, uncited elements or method steps.

[0215] Throughout this application, the term "about" means that a value includes the standard deviation of the error of the apparatus or method used to determine that value. The numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains a standard deviation due to the aforementioned test methods or apparatus. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with "about". Here, "about" generally means an actual value within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.

[0216] As used in the context of this disclosure, the term "INHBE" refers to a well-known gene and polypeptide. The INHBE gene and INHBE mRNA sequence are readily available, for example, from the following sources: GenBank, UniProt databases, Online Human Mendelian Inheritance (OMIM), etc.

[0217] The term "INHBE gene" can refer to the wild-type INHBE gene or a mutant INHBE gene with sequence variations. Many sequence variations in the INHBE gene have been identified and can be found in, for example, NCBIdbSNP and UniProt (see, for example, ncbi.nlm.nih.gov / snp).

[0218] The terms "peptide" and "protein" are used interchangeably to refer to a string of at least two amino acid residues linked together by covalent bonds (e.g., peptide bonds), and can be recombinant, natural, or synthetic peptides. Peptides can be linear or branched, can contain modified amino acids, and can be separated by non-amino acid segments. The term also includes amino acid polymers that have been modified (e.g., through disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with labeled components).

[0219] As used in the context of this disclosure, the term "target sequence" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a target gene, including mRNA as a product of RNA processing of the primary transcription product.

[0220] In some embodiments, the target sequence is a nucleotide sequence consisting of no fewer than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 80, 100, or 150 consecutive linked nucleosides. In some alternative embodiments, the target sequence may include another shorter target sequence. In some embodiments, the target sequence may include one or more shorter target sequences. It should be assumed that two or more shorter target sequences included in the same target sequence segment have the same characteristics; for example, target sequence I includes target sequences I-1 to I-2.

[0221] In some implementations, the target gene is the INHBE gene. In some implementations, the target portion of the gene sequence (i.e., the portion corresponding to the target sequence in the mRNA sequence) will be at least long enough to act as a substrate for iRNA-guided cleavage at or near the nucleotide sequence portion of the mRNA molecule formed during transcription of the INHBE gene.

[0222] In this technical field, “G”, “C”, “A”, “T” and “U” generally represent bases containing guanine, cytosine, adenine, thymine and uracil, respectively. However, it is also generally known in the art that each of “G”, “C”, “A”, “T” and “U” generally also represents a nucleotide containing guanine, cytosine, adenine, thymine and uracil as bases, respectively. This is a common practice in representing deoxyribonucleic acid sequences and / or ribonucleic acid sequences. Therefore, in the context of this disclosure, the meanings of “G”, “C”, “A”, “T” and “U” include all the above-mentioned possible cases. However, it should be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide (as further detailed below) or a substitute portion. In this application, “nucleotide”, “ribonucleotide” and “ribonucleic acid” are used interchangeably, and “deoxyribonucleotide” and “2'-deoxyribonucleotide” are used interchangeably. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil can be substituted with other moieties without substantially altering the base-pairing properties of an oligonucleotide (including a nucleotide having such a substitution moiety). For example, without limitation, a nucleotide including inosine as its base can base-pair with a nucleotide including adenine, cytosine, or uracil. Therefore, a nucleotide containing uracil, guanine, or adenine can be replaced in the nucleotide sequence of the dsRNA characterized in this invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in an oligonucleotide can be replaced with guanine and uracil, respectively, to form a GU swing base pairing with the target mRNA. Sequences containing such substitution moieties are suitable for the compositions and methods characterized in this invention.

[0223] In this application, "5'-nucleotide" refers to a nucleotide in which the phosphate group is attached to the 5' carbon of a pentose sugar, and it is the main type of nucleotide that exists freely in organisms. "3'-nucleotide" refers to a nucleotide in which the phosphate group is attached to the 3' carbon of a pentose sugar, and may include, for example, adenosine-3'-phosphate, guanosine-3'-phosphate, cytidine-3'-phosphate, uridine-3'-phosphate, 2'-deoxythymidine-3'-phosphate, 2'-O-methyladenosine-3'-phosphate, 2'-O-methyladenosine-3'-thiophosphate, 2'-fluoroadenosine-3'-phosphate, 2'-fluoroadenosine-3'-thiophosphate, 2'-O-methylguanosine-3'-phosphate, and 2'-O-methylguanosine-3'-phosphate. The terms glycoside-3'-thiophosphate, 2'-fluoroguanosine-3'-phosphate, 2'-fluoroguanosine-3'-thiophosphate, 2'-O-methylcytidine-3'-phosphate, 2'-O-methylcytidine-3'-thiophosphate, 2'-fluorocytidine-3'-phosphate, 2'-fluorocytidine-3'-thiophosphate, 2'-O-methyluridine-3'-phosphate, 2'-O-methyluridine-3'-thiophosphate, 2'-fluorouridine-3'-phosphate, 2'-fluorouridine-3'-thiophosphate, and 2'-deoxythymidine-3'-thiophosphate are used. This definition can be applied to modified or unmodified nucleoside phosphoramidamide monomers.

[0224] The terms “iRNA,” “RNAi reagent,” “iRNA agent,” and “RNA interference agent” as used in the context of this disclosure are used interchangeably and refer to terms defined herein that contain siRNA and mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNA regulates, for example, the expression of target genes in cells (such as the cells of a subject, such as a mammalian subject).

[0225] As used in the context of this disclosure, the terms "double-stranded ribonucleic acid," "double-stranded RNA (dsRNA) molecule," and "dsRNA" are used interchangeably. The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure containing two antiparallel and substantially complementary nucleic acid strands, described as having "sense" and "antisense" orientation relative to a target gene, such as the INHBE gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers the degradation of target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).

[0226] Typically, the majority of nucleotides on each strand of a dsRNA molecule are double-stranded ribonucleotides; however, as detailed herein, each or both strands may also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. Additionally, as used herein, “double-stranded ribonucleic acid” can include chemically modified ribonucleotides, phosphate backbones, etc. These modifications can include all types of modifications disclosed herein or known in the art.

[0227] As used in the context of this disclosure, the term "isonucleotide" refers to a compound formed by altering the position of a base on the ribose ring, for example, a compound formed by attaching a base to the 2' or 3' position of the ribose ring instead of the 1' position.

[0228] In some embodiments, the double-stranded ribonucleic acid disclosed herein is siRNA, which interacts with the mRNA sequence transcribed from the target gene (e.g., the mRNA sequence transcribed from the INHBE gene) to guide the cleavage of the target RNA. Not wishing to be bound by theory, long double-stranded RNA introduced into cells is broken down into siRNA by a type III endonuclease called Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer (a ribonuclease III-like enzyme) processes dsRNA into short 19–23 base pairs of interfering RNA with a characteristic dibase 3' overhang (Bernstein et al., (2001) Nature 409:363). These siRNAs are then incorporated into the RNA-inducible silencing complex (RISC), where one or more helicases unwind the siRNA duplex, enabling complementary antisense strands to guide target recognition (Nykanen et al., (2001) Cell 107:309). Once bound to a suitable target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir et al., (2001) Genes Dev. 15:188).

[0229] In the context of this disclosure, a "nucleotide difference" between two nucleotide sequences refers to a change in the type of bases at the same position of the nucleotides compared to the latter. For example, if a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, then a nucleotide difference at that position is considered to exist between the two nucleotide sequences. In some embodiments, replacing the nucleotide at the original position with a nucleotide analog can also be considered as a nucleotide difference at that position.

[0230] As used in the context of this disclosure, the terms "protruding nucleotide" and "protruding end" refer to one or more unpaired nucleotides that protrude from the double-stranded structure of a dsRNA when one 3' end of one strand of a double-stranded RNA extends beyond the 5' end of the other strand, or vice versa. "Flat-ended" or "blunt-terminated" means that there are no unpaired nucleotides at that end of the double-stranded RNA, i.e., no nucleotide protrusions. A "flat-terminated" double-stranded RNA is a dsRNA that is double-stranded throughout its entire length, i.e., without nucleotide protrusions at either end of the molecule. "Double-stranded region" refers to the complementary formation of the sense and antisense strands of the siRNA to form the double-stranded region of the siRNA.

[0231] The term "antisense strand" refers to a region of double-stranded RNA that is substantially complementary to a target sequence (e.g., from human INHBE mRNA). Mismatches at the terminal regions are most tolerable when the complementary region is not perfectly complementary to the target sequence, and if mismatches do occur, they are typically within one or more terminal regions, such as 5, 4, 3, 2, or 1 nucleotides at the 5' and / or 3' ends.

[0232] The term "sense chain" refers to a double-stranded RNA containing a nucleic acid chain that is substantially complementary to the antisense chain region.

[0233] The terms “complementary” or “reverse complementary” are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired in a complementary manner with the bases of the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) always pairs with the pyrimidine base cytosine (C). Each base pair consists of one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, “mismatch” in the art means, in a double-stranded nucleic acid, that the bases at corresponding positions are not paired in a complementary manner.

[0234] The terms "substantially complementary" and "substantially complementary" refer to the presence of no more than three base mismatches between the two nucleotide sequences involved, i.e., one, two, or three base mismatches between the two nucleotide sequences involved; "completely complementary" refers to the presence of no base mismatches between the two nucleotide sequences.

[0235] The terms “complementary,” “fully complementary,” and “substantially complementary” can be used relative to base pairing between the sense and antisense strands of dsRNA, or between the antisense strand of dsRNA and the target sequence, as will be understood from the context in which they are used.

[0236] In the foregoing and hereinafter, particularly in the description of methods for preparing double-stranded ribonucleic acid, modified double-stranded ribonucleic acid, or conjugates thereof or pharmaceutical compositions of the present disclosure, unless otherwise specified, a nucleoside monomer refers to a modified or unmodified nucleoside phosphorus amide monomer used in phosphorus amide solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphorus amide solid-phase synthesis is a method known to those skilled in the art for RNA synthesis. All nucleoside monomers used in this disclosure are commercially available.

[0237] The term “inhibition” can be used interchangeably with “reduction,” “silence,” “downregulation,” “suppression,” and other similar terms, and includes any level of inhibition.

[0238] The term "suppressing INHBE gene expression" includes suppressing the expression of any INHBE gene (such as, for example, the mouse INHBE gene, the rat INHBE gene, the monkey INHBE gene, or the human INHBE gene) and variants (e.g., naturally occurring variants) or mutants of the INHBE gene. Therefore, the INHBE gene can be a wild-type INHBE gene, a mutant INHBE gene, or a transgenic INHBE gene in the case of genetically manipulated cells, cell groups, or organisms.

[0239] "Inhibition of INHBE gene expression" includes inhibition of the INHBE gene at any level, such as at least partial inhibition of INHBE gene expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0240] The term "independently" means that at least two groups (or ring systems) in a structure with the same or similar value ranges can have the same or different meanings under specific circumstances. For example, if substituent X and substituent Y are independently hydrogen, hydroxyl, alkyl, or aryl, then when substituent X is hydrogen, substituent Y can be hydrogen, hydroxyl, alkyl, or aryl; similarly, when substituent Y is hydrogen, substituent X can be hydrogen, hydroxyl, alkyl, or aryl.

[0241] The term "alkyl" includes straight-chain, branched, or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl, and similar groups. For example, "C 1-6 The "C" in "alkyl" 1-6 "" refers to a group consisting of 1, 2, 3, 4, 5 or 6 carbon atoms arranged in a straight chain, branched chain or cyclic form.

[0242] The term "alkoxy" herein refers to an alkyl group that is attached to the remainder of a molecule by an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, etc.

[0243] The term "treatment" refers to the process of exposing a subject to (e.g., administering medication) double-stranded RNA, double-stranded RNA modifications, double-stranded RNA conjugates, prodrugs, or pharmaceutical compositions after the onset of a disease, thereby reducing the symptoms of the disease compared to when the subject is not exposed. It does not imply the complete suppression of disease symptoms. Having a disease means that the body has developed symptoms of a disease.

[0244] The term "prevention" means that, prior to the onset of a disease, by exposing (e.g., administering medication) a subject to the double-stranded RNA, double-stranded RNA modification, double-stranded RNA conjugate, prodrug, or pharmaceutical composition disclosed herein, the symptoms of the disease are reduced compared to when the subject is not exposed, and does not imply the necessity of completely suppressing the disease.

[0245] The term "effective amount" refers to the quantity or dose of the double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, double-stranded ribonucleic acid conjugate, prodrug, or pharmaceutical composition of the present invention, which, when administered to a patient in a single or multiple dose, produces the intended effect in a patient requiring treatment or prevention. The effective amount can be readily determined by a physician skilled in the art by considering a variety of factors, such as: the species of the mammal; its size, age, and general health; the specific disease involved; the degree or severity of the disease; the individual patient's response; the specific antibody administered; the administration method; the bioavailability characteristics of the administered formulation; the chosen dosing regimen; and the use of any concomitant therapies. The term "therapeutic effective amount" refers to the quantity or dose of the double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, conjugate, prodrug, or pharmaceutical composition of the present invention, which, when administered to a patient in a single or multiple dose, produces the intended therapeutic effect in a patient requiring treatment or prevention.

[0246] The term "disease associated with INHBE gene aberration" refers to a disease or disorder associated with the involvement of INHBE. The term "disease associated with INHBE gene aberration" includes diseases, disorders, or conditions that would benefit from reduced INHBE expression (i.e., "INHBE-related diseases"). In some embodiments, diseases associated with INHBE gene aberration are selected from the group consisting of: obesity (e.g., abdominal obesity), non-alcoholic fatty liver disease, alcoholic fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (e.g., coronary artery disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome. For example, refer to the following scientific literature, but not limited thereto: Jiali Cao, et al. Identification and validation of INHBE and P4HA1 as hub genes in non-alcoholic fatty liverdisease. Biochemical and Biophysical Research Communications, 686 (2023) 149180; Masakazu Sugiyama, et al. Inhibin βE (INHBE) is a possible insulin resistance-associated hepatokine identified by comprehensive gene expression analysis in human Liver biopsy samples.PLOS ONE, March 29, 2018; Aimee M.Deaton, et al. Rareloss of function variants in the hepatokine gene INHBE protect from abdominalobesity. Nat Commun.2022,13(1):4319; Parsa Akbari et al.Multiancestry exomesequencing reveals INHBE mutations associated with favorable fat distribution and protection from diabetes.Nat Commun. 2022, 13: 4844.

[0247] The terms "pharmaceuticalally acceptable excipient" or "pharmaceuticalally acceptable carrier" refer to excipient materials widely used in the pharmaceutical manufacturing industry. The primary purpose of using excipients is to provide a pharmaceutical composition that is safe to use, stable in nature, and / or has specific functionalities, and also to provide a method for the active ingredient to dissolve at a desired rate or to promote the effective absorption of the active ingredient in the body of the administered subject after administration of the drug. Pharmaceutically acceptable excipients can be inert fillers or functional ingredients that provide a function to the pharmaceutical composition (e.g., stabilizing the overall pH of the composition or preventing the degradation of the active ingredient in the composition). Non-limiting examples of pharmaceutically acceptable excipients include, but are not limited to, binders, suspending agents, emulsifiers, diluents (or fillers), granulating agents, adhesives, disintegrants, lubricants, anti-adhesion agents, flow aids, wetting agents, gelling agents, absorption delay agents, dissolution inhibitors, enhancers, adsorbents, buffers, chelating agents, preservatives, colorants, flavoring agents, sweeteners, etc.

[0248] The term "pharmaceutical composition" refers to a mixture of one or more of the double-stranded RNA, double-stranded RNA modifications, prodrugs, or conjugates thereof disclosed herein with a pharmaceutically acceptable excipient / carrier. The purpose of a pharmaceutical composition is to facilitate the administration of the double-stranded RNA, double-stranded RNA modifications, or conjugates thereof disclosed herein to an organism.

[0249] The pharmaceutical compositions disclosed herein can be prepared using any method known to those skilled in the art. For example, conventional mixing, dissolving, granulation, emulsification, grinding, encapsulation, embedding, and / or lyophilization processes.

[0250] In this disclosure, the application method can be varied or modified in any applicable manner to meet the needs of the properties of the drug, the convenience of patients and medical personnel, and other relevant factors.

[0251] As used in the context of this disclosure, the terms “individual,” “patient,” or “subject” include mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., human and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0252] As used in the context of this disclosure, the term "corresponding siRNA" refers to the same siRNA mentioned above. For example, when referring to "the positive strand comprising the positive strand of any of the siRNAs shown in Tables 1 and 1-1 herein, and the antisense strand comprising the antisense strand of the corresponding siRNA," it means that the included positive and antisense strands are from the same siRNA shown in Tables 1 and 1-1 herein. For example, when the positive strand comprises 5'-AGCACAGCUAUCCAUCAGA-3' (SEQ ID NO: 25), the antisense strand comprises 5'-UCUGAUGGAUAGCUGUGCU-3' (SEQ ID NO: 121). Similarly, the term "corresponding siRNA modifier" refers to the same siRNA modifier mentioned above. For example, when referring to "the positive strand comprising the positive strand of any of the siRNA modifiers shown in Table 2 herein, and the antisense strand comprising the antisense strand of the corresponding siRNA modifier," it means that the included positive and antisense strands are from the same siRNA modifier shown in Table 2 herein. Similarly, the term "corresponding siRNA conjugate" refers to the same siRNA conjugate mentioned above. For example, when it is stated that "the sense strand comprises the sense strand of any of the siRNA conjugates shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate," it means that the included sense and antisense strands are from the same siRNA conjugate shown in Table 3 herein. Furthermore, in these contexts, "comprising" includes cases where the sequences consist of these sequences.

[0253] Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0254] Double-stranded RNA

[0255] The first aspect of this disclosure provides a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the INHBE gene. One strand of the dsRNA is an antisense strand, which is complementary to the mRNA sequence formed during the expression of the target gene (i.e., the INHBE gene) to guide the cleavage of the target mRNA (i.e., the transcript of the INHBE gene). The other strand of the dsRNA includes a double-stranded region that is partially or fully complementary to the antisense strand to form the double-stranded ribonucleic acid.

[0256] In some implementations, double-stranded RNA is used as a substrate for the endonuclease Dicer, and is cleaved into small fragments of dsRNA, i.e., siRNA. In some implementations, the double-stranded RNA is siRNA. The siRNA assembles to form an RNA-induced silencing complex (RISC), which cleaves the target mRNA, thereby inhibiting the expression of the INHBE gene.

[0257] Based on the target sequence derived from human INHBE mRNA (NM_031479.5), siRNAs that bind to the target mRNA are designed. In some embodiments, the target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NO: 1-6, 507-509, 610, and 611. In some more specific embodiments, the target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NO: 7-24, 504-509, 610, and 611.

[0258] In some specific implementations, the nucleotide sequence shown in SEQ ID NO:1 includes the nucleotide sequences shown in SEQ ID NO:7 and 8.

[0259] In some specific implementations, the nucleotide sequence shown in SEQ ID NO:2 includes the nucleotide sequences shown in SEQ ID NO:9-11.

[0260] In some specific implementations, the nucleotide sequence shown in SEQ ID NO:3 includes the nucleotide sequences shown in SEQ ID NO:12 and 13.

[0261] In some specific implementations, the nucleotide sequence shown in SEQ ID NO:4 includes the nucleotide sequences shown in SEQ ID NO:14-16 and 504-506.

[0262] In some specific implementations, the nucleotide sequence shown in SEQ ID NO:5 includes the nucleotide sequences shown in SEQ ID NO:17-19.

[0263] In some specific implementations, the nucleotide sequence shown in SEQ ID NO:6 includes the nucleotide sequences shown in SEQ ID NO:20-24.

[0264] In some implementations, the antisense strand comprises a sequence B whose inverse complementary sequence to at least 15 consecutive nucleotides in the target sequence differs by no more than 3 nucleotides. Specifically, a start nucleotide is selected in the target sequence along the 5' end to the 3' end, and at least 15 nucleotides extending in the 3' direction, including the start nucleotide, serve as the binding region of the siRNA. The antisense strand comprises the inverse complementary sequence of the nucleotide sequence corresponding to the binding region. It should be noted that the start nucleotide can be a nucleotide at any position in the target sequence, as long as extending in the 3' direction from the start nucleotide yields at least 15 consecutive nucleotides (including the nucleotide at the start position).

[0265] In this disclosure, the nucleotide sequence of the antisense strand can be completely complementary or substantially complementary to the target sequence. When the nucleotide sequence of the antisense strand is substantially complementary to the target sequence, there are no more than three mismatched bases in the nucleotide sequence of the antisense strand that are in the target sequence. For example, there may be one, two, or three mismatched bases. When the nucleotide sequence of the antisense strand is completely complementary to the target sequence, there are no mismatched bases in the nucleotide sequence of the antisense strand and the target sequence.

[0266] Furthermore, the antisense strand consists of at least 15 nucleotides. In some embodiments, the antisense strand consists of 15-28 nucleotides. For example, the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides.

[0267] Preferably, the antisense strand consists of 19-25 nucleotides, more preferably 19-23 nucleotides, and most preferably 19, 21 or 23 nucleotides.

[0268] In some alternative implementations, the antisense strand contains sequence B, which is the reverse complementary sequence of a sequence consisting of at least 15 consecutive nucleotides on the target sequence.

[0269] In some specific implementations, the antisense strand contains sequence B, which is the reverse complementary sequence of a sequence consisting of 15-28 consecutive nucleotides on the target sequence. Preferably, the target sequence consists of 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 21, or 23 consecutive nucleotides.

[0270] In some alternative implementations, the sequence B contained in the antisense strand differs by one nucleotide from the reverse complementary sequence of the target sequence, which consists of at least 15 consecutive nucleotides.

[0271] In some specific implementations, the sequence B contained in the antisense strand differs from the reverse complementary sequence of the 15-28 nucleotides of the target sequence by one nucleotide. Preferably, the target sequence consists of 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 21, or 23 consecutive nucleotides.

[0272] In some specific embodiments, the differing nucleotide is located at the 3' end of sequence B. In other specific embodiments, the differing nucleotide is located at the 5' end of sequence B.

[0273] In some embodiments, the sense strand comprises sequence A, which differs from at least 15 consecutive nucleotides in the target sequence by no more than 3 nucleotides. The sense strand includes regions complementary to the antisense strand, and the nucleotide sequence of the sense strand is identical or substantially identical to the sequence of the antisense strand binding region on the target sequence. Therefore, the nucleotide sequence of the sense strand is at least 15 consecutive nucleotides in the target sequence that bind the antisense strand; or, the nucleotide sequence of the sense strand differs from at least 15 consecutive nucleotides in the target sequence that bind the antisense strand by 1, 2, or 3 bases.

[0274] Furthermore, the sense strand consists of at least 15 nucleotides. In some embodiments, the sense strand consists of 15-28 nucleotides. For example, the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides.

[0275] Preferably, the positive chain consists of 19-25 nucleotides, more preferably 19-23 nucleotides, and most preferably 19, 20, 21 or 23 nucleotides.

[0276] In some alternative implementations, the positive strand contains sequence A which is identical to the sequence consisting of at least 15 consecutive nucleotides on the target sequence.

[0277] In some specific implementations, the positive strand contains sequence A, which is identical to the sequence consisting of 15-28 consecutive nucleotides on the target sequence. Preferably, the target sequence consists of 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 20, 21, or 23 consecutive nucleotides.

[0278] In some alternative implementations, the sequence A contained in the positive strand differs from the target sequence by one nucleotide by at least 15 consecutive nucleotides.

[0279] In some specific implementations, the sequence A contained in the positive strand differs from the target sequence consisting of 15-28 consecutive nucleotides by one nucleotide. Preferably, the target sequence consists of 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 20, 21, or 23 consecutive nucleotides.

[0280] In some specific embodiments, the differing nucleotide is located at the 3' end of sequence A. In other specific embodiments, the differing nucleotide is located at the 5' end of sequence A.

[0281] In this disclosure, the length of the justice chain and the length of the antisense chain may be the same or different.

[0282] In some implementations, the lengths of the justice chain and the antisense chain are the same. Specifically, the length ratio of the justice chain to the antisense chain is 15 / 15, 16 / 16, 17 / 17, 18 / 18, 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, 25 / 25, 26 / 26, 27 / 27, or 28 / 28. Preferably, the length ratio of the justice chain to the antisense chain is 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, or 25 / 25; more preferably, it is 19 / 19, 20 / 20, 21 / 21, 22 / 22, or 23 / 23; and most preferably, it is 19 / 19, 21 / 21, or 23 / 23.

[0283] In some implementations, the lengths of the justice chain and the antisense chain differ. For example, the justice chain / antisense chain length ratio is 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 19, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 19, 21 / 20, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 19, 22 / 20, 22 / 21, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 19, 23 / 20, 23 / 21, 23 / 22, 23 / 24, 23 / 25, or 23 / 26, etc.; in some preferred embodiments, the length ratio of the justice chain to the antisense chain is 19 / 21, 20 / 22, 20 / 23, or 21 / 23.

[0284] In this disclosure, the sense strand and the antisense strand can be fully complementary or substantially complementary. When they are substantially complementary, there are no more than 3 mismatched bases in the double-stranded region formed by the sense strand and the antisense strand.

[0285] In some implementations, after the sense and antisense strands complement each other to form a double-stranded region, the sense, antisense, or combination thereof has protruding nucleotides extending out of the double-stranded region. The number of protruding nucleotides can be one or more, for example, one, two, or three. Furthermore, the one to three protruding nucleotides can be located at the 5' end, 3' end, or both ends of any antisense or sense strand, and each protruding nucleotide can be of any type. For example, in the case where the sense strand consists of a 21-bit sequence A+D and the antisense strand consists of a 21-bit sequence B+E, the nucleotides at positions 1-19 of sequence A are completely anticomplementary to those at positions 1-19 of sequence B in the direction from the 5' end to the 3' end, thereby forming protruding nucleotides at the 3' end of sequences D and E, respectively. For example, when the sense strand consists of a 19-position sequence A and the antisense strand consists of a 21-position sequence B+E, the nucleotides 1-19 of sequence A are completely anticomplementary to those 1-19 of sequence B in the direction from the 5' end to the 3' end, thus forming a protruding nucleotide at the 3' end of sequence E on the antisense strand.

[0286] In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of the sense strand has 1-3 protruding nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end.

[0287] In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region, while the 3' end of the sense strand forms a blunt end.

[0288] In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' ends of both the sense strand and the antisense strand have 1-3 protruding nucleotides extending out of the double-stranded region.

[0289] In some implementations, the sense chain and the antisense chain complement each other to form the double-stranded region, and the 3' ends of both the sense chain and the antisense chain form flat ends.

[0290] In some implementations, the sense strand comprises the sense strand of any of the siRNAs shown in Tables 1 and 1-1 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.

[0291] In some specific embodiments, the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO: 25-120, 493, 510-522 and 582-586, 612, and the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO: 121-216, 449-453, 494, 523-536, 587-592, 607-609, 613, 618-620, 623.

[0292] In some specific embodiments, the double-stranded ribonucleic acid is selected from any siRNA shown in Tables 1 and 1-1. In some specific embodiments, the siRNA of this disclosure has an inhibition rate of at least about 10% against the INHBE gene, and may be at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between these values.

[0293] The siRNA disclosed herein has high specificity in binding to the target mRNA (INHBE mRNA) and good silencing activity of the target mRNA. It can significantly inhibit INHBE gene expression and can be used to treat INHBE-related diseases, including obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes and metabolic syndrome, as well as other unidentified related conditions, pathologies or syndromes.

[0294] In some embodiments, this disclosure provides an siRNA composition comprising any one or more of the siRNAs shown in Tables 1 and 1-1.

[0295] In some embodiments, each nucleotide of the sense strand is independently a modified or unmodified nucleotide. In some embodiments, each nucleotide of the antisense strand is independently a modified or unmodified nucleotide.

[0296] In some embodiments, any two nucleotides linked in the sense strand are connected by a phosphodiester bond, a thiophosphate diester bond, or a dithiophosphate diester bond. In some embodiments, any two nucleotides linked in the antisense strand are connected by a phosphodiester bond, a thiophosphate diester bond, or a dithiophosphate diester bond.

[0297] In some embodiments, the 5' terminal nucleotide of the antisense strand is either not linked to a 5' phosphate group or a 5' phosphate derivative group, or is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0298] In this paper, when the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group, a 5' phosphate-derived group, or (invAb) (i.e., the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group), the structure of the 5' terminal nucleotide is as shown in Formula X:

[0299]

[0300] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro(2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide.

[0301] When the 5' terminal nucleotide of the antisense strand is attached to a 5' phosphate group or a 5' phosphate derivative, the following structure is formed:

[0302]

[0303] Formula (1) shows the structure formed by linking a 5' nucleotide to a 5' phosphate group, Formula (2) shows the structure formed by linking a 5' nucleotide to an EVP, and Formula (3) shows the structure formed by linking a 5' nucleotide to a 5' methylene phosphate group. Base represents a base, such as A, U, G, C, or T; R' is a hydroxyl group or is substituted by various groups known to those skilled in the art. For example, R' can be 2'-fluoro(2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, or 2'-substituted amino.

[0304] In some embodiments, the positive strand may contain one or more capping residues or portions, sometimes referred to in the art as a “cap,” “terminal cap,” or “capping residue.” As used herein, a “capping residue” is a nonnucleotide compound or other portion that may be incorporated at one or more ends of the nucleotide sequence of the siRNA disclosed herein. In some cases, capping residues may provide certain beneficial properties to the siRNA, such as protection against exonuclease degradation. In some embodiments, an inverse debased deoxyribose residue (invAb) is added as a capping residue. In some embodiments, the capping residue appears at the 3' end of the positive strand or both the 5' and 3' ends.

[0305] In some embodiments, one or more inverted debased deoxyribose residues (invAb) are added to the 3' end of the positive strand. In some embodiments, one or more inverted debased deoxyribose residues (invAb) are added to both the 5' end and the 3' end of the positive strand. The inverted debased deoxyribose residues may be linked via phosphate ester bonds, thiophosphate ester bonds, or other nucleoside internucleotide bonds. When describing modification sites in the modification method, (invAb) is not counted as the first site of the sequence. In some embodiments, inverted debased deoxyribose residues (invAb) (also referred to in the art as "inverted debasing sites") may be added. The chemical structure of the inverted debased deoxyribose residue is shown below:

[0306] Formula B is used when (invAb) is located at the 3' end of the siRNA; Formula C is used when (invAb) is located at the 5' end of the siRNA.

[0307]

[0308] Double-stranded RNA modified products

[0309] A second aspect of this disclosure provides a double-stranded ribonucleic acid (RNA) modifier. Further, the double-stranded RNA modifier is a siRNA modifier. The siRNA modifier maintains high INHBE mRNA inhibitory activity while improving the stability of the siRNA.

[0310] In some embodiments, the double-stranded ribonucleic acid (SSRNA) modifier comprises at least one nucleotide modification. The nucleotide modification is selected from at least one of ribose group modification and base modification. In some embodiments, "nucleotide modification" refers to a nucleotide or nucleotide derivative formed by replacing the 2' hydroxyl group of the ribose group with another group, or a nucleotide in which the base is a modified base. The nucleotide modification does not result in a significant weakening or loss of the siRNA's ability to suppress gene expression. For example, modified nucleotides disclosed in JK Watts, G.F. Deleavey, and MJ Damha, Chemically Modified siRNA: Tools and Applications. Drug Discov Today, 2008, 13(19-20):842-55 can be selected. Nucleotide modification can improve the stability of siRNA and maintain its high repressive efficiency against the INHBE gene.

[0311] For example, the modified nucleotide has the following structure:

[0312] Wherein, Base represents a base, such as A, U, G, C, or T. The hydroxyl group at the 2' position of the ribosyl group is replaced by R. These hydroxyl groups at the 2' position of the ribosyl group can be replaced by various groups known to those skilled in the art, such as 2'-fluoro(2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, and 2'-deoxyribonucleotides.

[0313] In some implementations, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe, 2'-O-CH3) modified nucleotide, etc.

[0314] In some embodiments, the 2'-substituted alkoxy modified nucleotide is a nucleotide modified with 2'-methoxyethoxy (2'-O-CH2-CH2-O-CH3), a nucleotide modified with 2'-O-CH2-CH=CH2, etc.

[0315] In some embodiments, the 2'-substituted alkyl-modified nucleotide is a 2'-CH2-CH2-CH=CH2 modified nucleotide, etc.

[0316] In some embodiments, the modification of the nucleotide is a modification of the bases. Base modifications can be of various types known to those skilled in the art. For example, base modifications include, but are not limited to, m... 6 A、Ψ、m 1 A、m 5 A, ms 2 i 6 A、i 6 A、m 3 C, m 5 C、ac 4 C, m 7 G, m 2,2 G, m 2 G, m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um, D, mcm 5 s 2 U, Inosine(I), hm 5 C, s 4 U、s 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or its derivatives.

[0317] In some embodiments, a nucleotide derivative refers to a compound that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, the nucleotide derivative can be an isonucleotide, a bridged nucleic acid (BNA), or an acyclic nucleotide. A BNA refers to a restricted or inaccessible nucleotide. A BNA can contain a bridging structure with a "fixed" C3'-endoglucan condensation, such as a five-membered, six-membered, or seven-membered ring. This bridge is typically incorporated into the 2',4' position of the ribose to provide a 2',4'-BNA nucleotide, such as LNA, ENA, cET, etc.

[0318] LNA is shown in Equation (4), ENA is shown in Equation (5), and cET is shown in Equation (6):

[0319]

[0320] In this context, "Base" refers to a base.

[0321] Acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of a nucleotide, such as unopened nucleic acids (UNA) or glycerol nucleic acids (GNA). UNA is shown in formula (7), and GNA is shown in formula (8).

[0322]

[0323] In formulas (7) and (8) above, Base refers to a base, and R is selected from H, OH or alkoxy (O-alkyl).

[0324] In some implementations, nucleotide derivative modification refers to the replacement of nucleotides in nucleic acids with nucleotide derivatives. Exemplary examples include isonucleotides, LNA, ENA, cET, UNA, or GNA.

[0325] In some embodiments, the nucleotides in the nucleic acid are replaced with isonucleotides, also referred to as isonucleotide modification in the context of this disclosure. In some embodiments, isonucleotide modification includes incorporating an isonucleotide at one or more sites on the sense and / or antisense strands of the siRNA to be modified, in place of the native nucleoside for coupling at the corresponding position.

[0326] In some embodiments, the isonucleoside modification is D-isonucleoside modification. In other embodiments, the isonucleoside modification is L-isonucleoside modification. In still other embodiments, the isonucleoside modification is a combination of D-isonucleoside and L-isonucleoside modification.

[0327] In some embodiments, the double-stranded ribonucleic acid (siRNA) modifier includes modification of a phosphodiester bond at at least one position. In some embodiments, the modification of the phosphodiester bond refers to the substitution of an oxygen atom in the phosphodiester bond by a sulfur atom to form a phosphothiodiester bond. The phosphothiodiester bond can stabilize the double-stranded structure of siRNA and maintain the specificity of base pairing. An exemplary phosphothiodiester bond structure is shown below:

[0328]

[0329] The structure of the dithiophosphate diester bond is shown below:

[0330]

[0331] In some embodiments, the double-stranded ribonucleic acid modifier comprises at least one of the following chemical modifications:

[0332] (1) Modification of at least one nucleotide in the positive strand,

[0333] (2) Modification of the phosphodiester bond at at least one position in the positive chain.

[0334] (3) Modification of at least one nucleotide in the antisense strand,

[0335] (4) Modification of phosphodiester bonds at at least one position in the antisense chain.

[0336] Furthermore, the double-stranded RNA modifier is an siRNA modifier containing at least one of the chemical modifications in (1)-(4).

[0337] In this disclosure, after sequence A in the sense chain and sequence B in the antisense chain are complementary to form a double-stranded region, the 3' ends of sequences A and B can be any of the following:

[0338] (1) Both sequences A and B have blunt ends at their 3' ends;

[0339] (2) The 3' end of sequence A has 1-3 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence B forms a blunt end;

[0340] (3) The 3' end of sequence B has 1-3 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence A forms a blunt end;

[0341] (4) The 3' end of sequence A has 1-3 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence B has 1-3 protruding nucleotides extending out of the double-stranded region.

[0342] In some implementations, the nucleotide sequence of the sense strand is the sequence shown in Sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in Sequence B.

[0343] In some implementations, when the nucleotide sequences of the sense and antisense strands are complementary to form a double-stranded region, and there are no protruding nucleotides at the 3' ends of either the sense or antisense strands, 1-3 nucleotides are added to the 3' end of at least one of the sense and antisense strands as protruding nucleotides. Specifically, the 1-3 nucleotides attached to the 3' end of the sense strand constitute sequence D, and the 1-3 nucleotides attached to the 3' end of the antisense strand constitute sequence E. Accordingly, the nucleotide sequence of the sense strand is the sequence shown by sequence A linked to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown by sequence B linked to sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked to sequence E. Or, the nucleotide sequence of the sense strand is the sequence shown in sequence A linked to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.

[0344] For example, two deoxyribonucleotides (TT) are added to the 3' end of the sense strand sequence A as sequence D, and two deoxyribonucleotides (TT) are added to the 3' end of the antisense strand sequence B as sequence E. Alternatively, two deoxyribonucleotides (TT) are added only to the 3' end of the antisense strand as sequence E. Alternatively, two deoxyribonucleotides (TT) are added only to the 3' end of the sense strand sequence A as sequence D.

[0345] In some embodiments, when the nucleotide sequences of the sense and antisense strands are complementary to form a double-stranded region, and there is no protruding nucleotide at the 3' end of the sense strand, sequence D, consisting of 1-3 nucleotides, is added to the 3' end of the sense strand as the protruding nucleotide. Then, after the nucleotide sequence formed by linking sequence A to sequence D is chemically modified, sequence D, consisting of 1-3 nucleotides, is excluded. Accordingly, in the double-stranded ribonucleic acid modification, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B. Alternatively, in the double-stranded ribonucleic acid modification, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked to sequence E. In some embodiments, when sequence A forms a double-stranded region complementary to sequence B, and the 3' end of sequence A has a protruding 1-3 nucleotides extending out of the double-stranded region, the protruding nucleotide at the 3' end of sequence A is excluded, and the resulting nucleotide sequence is the sense strand. The sequence with the protruding nucleotide at the 3' end excluded is called sequence A'. Accordingly, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid (SSRNA) modification is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the SSRNA modification is the sequence shown in sequence B. Alternatively, the nucleotide sequence of the sense strand of the SSRNA modification is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the SSRNA modification is the sequence shown in sequence B linked to sequence E.

[0346] In some embodiments, along the 5' end to the 3' end, the sense strand of the double-stranded ribonucleic acid modification includes the following modifications: the ribonucleotides at positions 7, 9, 10, and 11 of the sense strand are 2'-fluoro-modified ribonucleotides; and the ribonucleotides at other positions of the sense strand are 2'-methoxy-modified ribonucleotides.

[0347] In some embodiments, the ribonucleotides at positions 5, 7, 8, and 9 of the positive strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0348] In some embodiments, the ribonucleotides at positions 7, 9, and 11 of the positive strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0349] In some embodiments, the ribonucleotides at positions 7, 9, 11, and 13 of the positive strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0350] In some embodiments, the ribonucleotides at positions 3, 7, 8, and 9 of the positive strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0351] In some embodiments, the ribonucleotides at positions 3, 7, 9, and 11 of the positive strand along the 5' end toward the 3' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0352] In some embodiments, the ribonucleotides at positions 11, 12, 13, and 17 of the positive strand along the 3' end to the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0353] In some embodiments, the ribonucleotides at positions 10, 11, 12, and 16 of the positive strand along the 3' end to the 5' end are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the positive strand are 2'-O-CH3 modified ribonucleotides.

[0354] In this paper, the 5' terminal nucleotide of the positive strand is not connected to a 5' phosphate group, a 5' phosphate-derived group, or a reverse debased deoxyribose residue (i.e., the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group), and the structure is shown in Formula X:

[0355]

[0356] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro(2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide.

[0357] In some embodiments, neither the 5' end nor the 3' end of the positive strand is connected to a reverse debased deoxyribose residue, or the 5' end or the 3' end nucleotide of the positive strand is connected to a reverse debased deoxyribose residue, or the 5' end and the 3' end nucleotide of the positive strand are each connected to a reverse debased deoxyribose residue.

[0358] In some embodiments, the positive strand of the siRNA modifier includes phosphothioester bonds at the following positions along the 5' end to the 3' end: between the first and second nucleotides starting at the 5' end, between the second and third nucleotides starting at the 5' end, between the first and second nucleotides starting at the 3' end, and between the second and third nucleotides starting at the 3' end.

[0359] In some implementations, the positive strand of the siRNA modifier includes phosphothioester bonds at the following positions along the 5'-to-3' direction: between the first and second nucleotides starting at the 5' end, and between the second and third nucleotides starting at the 5' end.

[0360] In some embodiments, along the 5' end to the 3' end direction, when the 3' terminal nucleotide of the positive strand is linked to a reverse debased deoxyribose residue, the positive strand of the siRNA modifier includes a phosphothioester bond at the following positions: between the first and second nucleotides starting at the 5' end; between the second and third nucleotides starting at the 5' end; and between the reverse debased deoxyribose residue starting at the 3' end and the first nucleotide.

[0361] In some embodiments, along the 5' end to the 3' end direction, when the 5' end and 3' end nucleotides of the positive strand are respectively linked to reverse debased deoxyribose residues, the positive strand of the siRNA modifier includes phosphothioester bonds at the following positions: between the reverse debased deoxyribose residue starting at the 5' end and the first nucleotide; between the first nucleotide starting at the 5' end and the second nucleotide; and between the reverse debased deoxyribose residue starting at the 3' end and the first nucleotide.

[0362] In some specific implementations, the siRNA modifier's sense strand has the characteristics described above (a1)-(a 14 (The structure shown in any of the items.)

[0363] In some embodiments, the antisense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0364] In some embodiments, the antisense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0365] In some embodiments, the antisense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0366] In some embodiments, the antisense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0367] In some embodiments, the antisense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0368] In some embodiments, the antisense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides; the ribonucleotide at position 6 of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA; and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0369] In some embodiments, the antisense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 7, 10, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0370] In some embodiments, the antisense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 5, 7, and 14 of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0371] In some embodiments, the antisense strand of the siRNA modifier includes phosphothioester bonds at the following positions along the 5' end to the 3' end: between the first and second nucleotides starting at the 5' end, between the second and third nucleotides starting at the 5' end, between the first and second nucleotides starting at the 3' end, and between the second and third nucleotides starting at the 3' end.

[0372] In some implementations, the antisense strand of the siRNA modifier includes phosphothioester bonds and dithioester bonds at the following positions along the 5' end to the 3' end: a phosphothioester bond between the first and second nucleotides starting at the 5' end, a phosphothioester bond between the second and third nucleotides starting at the 5' end, and a dithioester bond between the first and second nucleotides starting at the 3' end.

[0373] In some embodiments, along the 5' end toward the 3' end, the nucleotide at the 5' end of the antisense strand is either not linked to a 5' phosphate group or a 5' phosphate derivative group, or is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0374] In this paper, when describing the modification methods of the sense or antisense strand of siRNA, when the base is "T", those skilled in the art generally understand that the base "T" represents deoxyribonucleotide, and there is no modification of the base "T" by 2'-F, 2'-O-CH3, nucleotide derivatives, etc.

[0375] In this paper, when the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate-derived group (i.e., the ribosome of the 5' terminal nucleotide has a 5' hydroxyl group), the structure of the 5' terminal nucleotide is as shown in Formula X.

[0376] In some specific implementations, the antisense strand of the siRNA modifier has the above-described (b1)-(b 32 (The structure shown in any of the items.)

[0377] In some alternative implementations, the justice chain and the antisense chain are selected from combinations of the following:

[0378] The sense strand includes the sense strand of any of the siRNA modifiers shown in Table 2 of this document, and the antisense strand includes the antisense strand of the corresponding siRNA modifier.

[0379] Preferably, the justice chain and the antisense chain are selected from the following combinations:

[0380] The sense strand comprises the sense strand of any one of the siRNA modifiers shown in Table 2 of this document: siRNA414, siRNA 436-siRNA 440, siRNA 449, siRNA 472, and siRNA 488-siRNA 489. The antisense strand comprises the antisense strand of the corresponding siRNA modifier.

[0381] In some implementations, double-stranded RNA modifiers include, but are not limited to, siRNA modifiers as shown in Table 2.

[0382] In some specific embodiments, the siRNA modifier of this disclosure has an inhibition rate of at least about 20% against the INHBE gene, and may be at least about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between these values. In some embodiments, the siRNA modifier of this disclosure has an IC50 of about 20% against the INHBE gene. 50 Less than about 1.5 nM, and can be less than about 1.4 nM, about 1.3 nM, about 1.2 nM, about 1.1 nM, about 1 nM, about 0.9 nM, about 0.8 nM, about 0.7 nM, about 0.6 nM, about 0.5 nM, about 0.4 nM, about 0.3 nM, about 0.2 nM, about 0.1 nM, or about 0.05 nM.

[0383] Double-stranded ribonucleic acid conjugates

[0384] The third aspect of this disclosure provides a double-stranded ribonucleic acid conjugate, which is obtained by conjugating and linking the double-stranded ribonucleic acid provided in the first aspect or the double-stranded ribonucleic acid modified by the second aspect of this disclosure with a conjugating group.

[0385] In this disclosure, the sense strand and antisense strand of the double-stranded ribonucleic acid conjugate form a double-stranded region of the double-stranded ribonucleic acid conjugate, and a blunt end is formed at the 3' end of the sense strand of the double-stranded ribonucleic acid conjugate. In some embodiments, the 3' end of the sense strand of the double-stranded ribonucleic acid conjugate is blunt, and the 3' end of the antisense strand of the double-stranded ribonucleic acid conjugate has 1-3 protruding nucleotides extending out of the double-stranded region. In other embodiments, the 3' end of both the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate is blunt. In this disclosure, "the 3' end of the sense strand is blunt" includes the case where the 3' end of the motif sense strand is inherently blunt, and the case where the 3' end of the motif sense strand has a protruding end, but the protruding end is excluded to form a blunt end.

[0386] In some preferred embodiments, the double-stranded ribonucleic acid conjugate is obtained by conjugating a double-stranded ribonucleic acid modifier with a conjugating group. Specifically, the sense and antisense strands of the double-stranded ribonucleic acid modifier are complementary to form the double-stranded region of the modifier, and the 3' end of the sense strand of the modifier is blunt-ended. The conjugating group is then conjugated to the 3' end of the blunt-ended sense strand to form the double-stranded ribonucleic acid conjugate.

[0387] For example, the sense strand of the double-stranded ribonucleic acid (BRNA) modifier is the sequence shown in Sequence A, and the antisense strand is the sequence shown in Sequence E linked from Sequence B. Furthermore, the 3' end of the sense strand of the BRNA modifier is blunt-ended, and a conjugation group is attached to the 3' end of the sense strand to form a BRNA conjugate.

[0388] For example, the siRNA conjugate shown in N-ER-FY046176M47L96 has a blunt-end sequence at the 3' end of its sense strand. The blunt end serves as the nucleotide sequence for linking the L96 conjugate group (i.e., L96 is linked by a phosphodiester bond after the sequence is synthesized to (invAb). Therefore, the sequence forming the siRNA conjugate is: the sense strand is mUsmUsCfmCmAmUUfCfUfmGmCmCmGmUmCmUmUmCmAs(invAb)L96 (SEQ ID NO:576), and the antisense strand is EVPmUsGfsmAmAmGmACfmGmGCfmAmGmAAfmUmGmGmAmAsmAsmG (SEQ ID NO:561).

[0389] For example, the sense strand of the double-stranded ribonucleic acid (BRNA) modifier is the sequence shown in Sequence A, and the antisense strand is the sequence shown in Sequence B. Furthermore, the 3' end of the sense strand of the BRNA modifier is blunt-ended, and a conjugation group is attached to the 3' end of the sense strand to form a BRNA conjugate.

[0390] For example, the sense strand of the double-stranded ribonucleic acid (BRNA) modifier is the sequence shown by sequence A linked to sequence D, and the antisense strand is the sequence shown by sequence B linked to sequence E. Furthermore, the sense strand of the BRNA modifier has a prominent 1-3 nucleotide sequence D at its 3' end. After excluding sequence D from the 3' end of the sense strand of the BRNA modifier, a conjugate group is attached to the 3' end of sequence A to form a BRNA conjugate.

[0391] For example, the sense strand of the double-stranded ribonucleic acid (BRNA) modifier is the sequence shown in sequence A linked to sequence D, and the antisense strand is the sequence shown in sequence B. Furthermore, the 3' end of the sense strand of the BRNA modifier has a prominent 1-3 nucleotide sequence D. After excluding sequence D from the 3' end of the sense strand of the BRNA modifier, a conjugate group is attached to the 3' end of sequence A to form a BRNA conjugate.

[0392] For example, the sense strand of the double-stranded ribonucleic acid (BRNA) conjugate is the sequence shown in Sequence A, and the antisense strand is the sequence shown in Sequence B linked to Sequence E. Sequence A has a protruding nucleotide extending from its 3' end into the double-stranded region. The sequence after excluding the protruding nucleotide at the 3' end of Sequence A (also known as Sequence A') is used as the nucleotide sequence for connecting the conjugate group. Therefore, the nucleotide sequence of the sense strand of the BRNA conjugate is the sequence shown in Sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in Sequence B linked to Sequence E.

[0393] For example, the sense strand of the double-stranded ribonucleic acid (BRNA) conjugate is the sequence shown in Sequence A, and the antisense strand is the sequence shown in Sequence B. Sequence A has a protruding nucleotide extending from its 3' end into the double-stranded region. The sequence after excluding the protruding nucleotide at the 3' end of Sequence A (also known as Sequence A') serves as the nucleotide sequence for attaching the conjugate group. Therefore, the nucleotide sequence of the sense strand of the BRNA conjugate is the sequence shown in Sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in Sequence B.

[0394] For example, the siRNA conjugate shown in N-ER-FY046108M2L96 originally had a protruding nucleotide -smAsmU extending into a double-stranded region at the 3' end of its positive strand. After removing the protruding -smAsmU nucleotide from the 3' end of the positive strand, the resulting blunt-ended sequence mUsmUsmGmGmAmGUfmGAfAfGfmAmGmAmCmCmAmAmA is used as the nucleotide sequence for linking the L96 conjugate group (i.e., L96 is linked via a phosphodiester bond after the sequence is synthesized to the blunt end). Therefore, the sequence forming the siRNA conjugate is: positive strand mUsmUsmGmGmAmGUfmGAfAfGfmAmGmAmCmCmAmAmAL96 (SEQ ID). NO:445), the antisense chain is P1mUsUfsmUmGmGUfmCmUmCmUmUmCmACfmUCfmCmAmAsmAsmG (SEQ ID NO:330).

[0395] In some alternative embodiments, the positive strand of the double-stranded ribonucleic acid conjugate has a structure such as (d1)-(d2). 11 The structure shown in any one of the following examples:

[0396] (d1)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3',

[0397] (d2)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L96-3',

[0398] (d3)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3',

[0399] (d4)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3',

[0400] (d5)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3',

[0401] (d6)5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3',

[0402] (d7)5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3’,

[0403] (d8)5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-L96-3’,

[0404] (d9)5’-(invAb)-(s)-mN1-(s)-mN2-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-L96-3’,

[0405] (d 10 )5’-mN 19 -(s)-mN 18 -(s)-N 17 f-mN 16 -mN 15 -mN 14 -N 13 f-N 12 f-N 11 f-mN 10-mN9-mN8-mN7-m N6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-L96-3',

[0406] (d 11 )5'-mN 21 -mN 20 -mN 19 -(s)-mN 18 -(s)-N 17 f-mN 16 -mN 15 -mN 14 -N 13 fN 12 fN 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-L96-3',

[0407] (d 12 )5'-mN 20 -(s)-mN 19 -(s)-mN 18 -mN 17 -N 16 f-mN 15 -mN 14 -mN 13 -N 12 fN 11 fN 10 f-mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-L96-3',

[0408] Among them, N1-N 21 The ribonucleotides are independently selected from those with bases A, U, C, or G. The lowercase letter m indicates that the ribonucleotide adjacent to the right of m is modified with 2'-O-CH3, and the lowercase letter f indicates that the ribonucleotide adjacent to the left of f is modified with 2'-F. (invAb) indicates a reverse debasing deoxyribose residue, and -(s)- indicates that two adjacent nucleotides are linked by a phosphothioester bond. L96 is also the conjugate group GalNAc shown in Formula I.

[0409] In some alternative embodiments, the antisense strand of the double-stranded ribonucleic acid conjugate has the above-described (b1)-(b 32 (The structure shown in any of the items.)

[0410] Furthermore, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, wherein the siRNA molecule linked to the conjugation group in the siRNA conjugate can be unmodified siRNA or a modified siRNA. The siRNA molecule modified with the conjugation group maintains high inhibitory activity and stability while also exhibiting good tissue and organ targeting and the ability to promote endocytosis, thus reducing the impact on other tissues or organs and decreasing the amount of siRNA molecule used, thereby achieving the goals of reducing toxicity and lowering costs. Optionally, any siRNA molecule shown in Table 1, Table 1-1, or Table 2 can be linked to the conjugation group to obtain a double-stranded ribonucleic acid conjugate.

[0411] The conjugation site of siRNA and the conjugating group can be at the 3' or 5' end of the siRNA's sense strand, at the 5' end of the antisense strand, or within the siRNA's internal sequence. In some embodiments, the conjugation site of siRNA and the conjugating group is at the 3' end of the siRNA's sense strand.

[0412] In some embodiments, the conjugate group may be attached to a phosphate group, a 2'-hydroxyl group, or a base of a nucleotide. In some embodiments, the conjugate group may also be attached to a 3'-hydroxyl group, in which case the nucleotides are linked by a 2',5'-phosphodiester bond. When the conjugate group is attached to the end of the siRNA chain, it is usually attached to a phosphate group of the nucleotide; when the conjugate group is attached to the inner sequence of the siRNA, it is usually attached to a ribose ring or a base. Various connection methods can be found in the reference: Muthiah Manoharan et al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo inhepatocytes. ACS Chemical biology, 2015, 10(5): 1181-7.

[0413] In this disclosure, the conjugation group can be a ligand conventionally used in the field of siRNA drug delivery. In some embodiments, the conjugation group can be selected from one or more ligands formed from the following target molecules or their derivatives: lipophilic molecules, such as cholesterol, bile acids, vitamins (e.g., vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as transmembrane peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid; receptor ligands expressed by hepatocytes, such as desialyl glycoprotein, desialyl sugar residues, lipoproteins (e.g., high-density lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitters (e.g., adrenaline), growth factors, transferrin, etc.

[0414] In some specific embodiments, the conjugation group has a structure selected from formula I, III, IV, V, VI, VII, VIII and IX.

[0415] The conjugation group shown in Formula I is GalNAc. GalNAc has liver targeting properties and can deliver siRNA molecules to liver tissue with high specificity, specifically inhibiting the high expression of the INHBE gene in the liver.

[0416] In some specific implementations, GalNAc is conjugated to the 3' end of the sense strand via a phosphodiester bond, resulting in siRNA conjugates with the structure shown below:

[0417]

[0418] The double helix structure is either unmodified siRNA or siRNA modified.

[0419] In some implementations, the double-stranded ribonucleic acid conjugates include, but are not limited to, siRNA conjugates as shown in Table 3.

[0420] In some specific embodiments, the siRNA conjugate of this disclosure has an inhibition rate of at least about 20% against the INHBE gene, and may be at least about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any value or range between these values.

[0421] prodrug

[0422] A fourth aspect of this disclosure provides a prodrug. The double-stranded ribonucleic acid (BRNA) described in the first aspect, the BRNA modified by the second aspect, and the BRNA conjugate described in the third aspect of this disclosure can also exist in the form of a prodrug. The prodrug can be converted into the BRNA, BRNA modified by the second aspect, or BRNA conjugate of this disclosure in vivo or in vitro.

[0423] As used in this specification, "prodrug" refers to a compound that exerts its pharmacological effect only after being transformed in vivo. For example, the siRNA modifier or conjugate with M6 pattern modification in this application is a prodrug of the siRNA modifier or conjugate with M2 pattern modification, because the difference between M2 and M6 pattern modification is whether there is a P1 at the 5' end of the antisense strand. Similarly, the relationship between M7 and M3 pattern modification is the same. Therefore, double-stranded ribonucleic acid in this document includes its corresponding prodrug.

[0424] Pharmaceutical Composition

[0425] The fifth aspect of this disclosure provides a pharmaceutical composition comprising one or more of the double-stranded ribonucleic acid (BRNA) described in the first aspect, the BRNA modification described in the second aspect, the BRNA conjugate described in the third aspect, and the prodrug described in the fourth aspect.

[0426] In some embodiments, the pharmaceutical composition contains siRNA or prodrugs as described above as the active ingredient and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition also contains one or more additional therapeutic agents, such as those beneficial for the prevention or treatment of diseases, conditions, or symptoms at least partially mediated by INHBE gene expression. In this disclosure, the purpose of using the pharmaceutical composition is to facilitate administration to the organism, to facilitate the absorption of the active ingredient, and thereby to exert its biological activity. The pharmaceutical compositions of this disclosure can be administered in any form, including by injection (intra-arterial, intravenous, intramuscular, intraperitoneal, subcutaneous), mucosal, oral (oral solid dosage form, oral liquid dosage form), rectal, inhalation, implantation, topical (e.g., ocular) administration, etc. Non-limiting examples of oral solid dosage forms include, but are not limited to, powders, capsules, lozenges, granules, tablets, etc. Non-limiting examples of oral or mucosal liquid dosage forms include, but are not limited to, suspensions, tinctures, elixirs, solutions, etc. Non-limiting examples of topical dosage forms include, but are not limited to, emulsions, gels, ointments, creams, patches, pastes, foams, lotions, drops, or serum preparations. Non-limiting examples of parenteral administration formulations include, but are not limited to, solutions for injection, dry powders for injection, suspensions for injection, and emulsions for injection. The pharmaceutical compositions disclosed herein can also be formulated into controlled-release or delayed-release dosage forms (e.g., liposomes or microspheres).

[0427] In this disclosure, the application method can be varied or modified in any applicable manner to meet the needs of the properties of the drug, the convenience of patients and medical personnel, and other relevant factors.

[0428] Medical Use

[0429] The sixth aspect of this disclosure provides at least one use of double-stranded ribonucleic acid, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, prodrugs, and pharmaceutical compositions as follows:

[0430] (1) Inhibit INHBE gene expression, or prepare drugs for inhibiting INHBE gene expression;

[0431] (2) To prevent or treat diseases associated with abnormal expression of the INHBE gene, or to prepare drugs for the prevention or treatment of diseases associated with abnormal expression of the INHBE gene;

[0432] (3) To treat subjects with diseases that would benefit from reduced INHBE gene expression, or to prepare a medicine for treating subjects with diseases that would benefit from reduced INHBE gene expression.

[0433] This disclosure further provides the use of siRNA molecules (including unmodified siRNA, siRNA modifiers, siRNA conjugates) or their prodrugs or pharmaceutical compositions in at least one of (1)-(3) above.

[0434] In this disclosure, abnormal expression of the INHBE gene can lead to one or more diseases associated with abnormal INHBE gene expression, such as obesity (e.g., abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (e.g., coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome.

[0435] The siRNA molecule causes the expression of the INHBE gene to be suppressed by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, thereby achieving the treatment of diseases related to abnormal expression of the INHBE gene.

[0436] In some embodiments, this disclosure provides a method for inhibiting intracellular INHBE gene expression, comprising contacting a cell with double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, a prodrug, or a pharmaceutical composition.

[0437] Furthermore, a method to inhibit intracellular INHBE gene expression is to introduce siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, or pharmaceutical compositions into the cells.

[0438] In some embodiments, the cells are in vivo or in vitro cells. In some specific embodiments, the cells are in the body of the subject.

[0439] In some embodiments, this disclosure provides methods for preventing or treating diseases, including administering double-stranded ribonucleic acid, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, prodrugs, or pharmaceutical compositions to a subject or patient.

[0440] Furthermore, methods for preventing or treating diseases include administering siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, or pharmaceutical compositions to subjects or patients.

[0441] In this disclosure, "subject" includes either a human or a non-human animal, preferably a vertebrate, and more preferably a mammal. The subject may include a transgenic organism. Most preferably, the subject is a human. Further, the subject has at least one of the following characteristics:

[0442] (1) Abnormal expression of the INHBE gene in vivo, more specifically, abnormally high expression of the INHBE gene;

[0443] (2) Suffering from a disease associated with abnormal expression of the INHBE gene;

[0444] (3) People with diseases that would benefit from reduced INHBE gene expression. Such as people who have or are predisposed to diseases associated with abnormal INHBE gene expression.

[0445] The dosage of the siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, or pharmaceutical compositions disclosed herein can be determined based on the patient's weight, age, sex, and disease severity. Based on the amount of double-stranded ribonucleic acid contained therein, the dosage of the siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, or pharmaceutical compositions disclosed herein is approximately 1-300 mg / kg body weight.

[0446] The dosing frequency can be daily, weekly, every two weeks, every three weeks, every one month, every two months, every three months, every four months, every five months, every six months, every seven months, every eight months, every nine months, every ten months, every eleven months, or annually, once or more.

[0447] The total number of times the siRNA molecule (including unmodified siRNA, siRNA modified compounds, and siRNA conjugates), prodrug, or pharmaceutical composition of this disclosure is applied can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 times. For example, the siRNA molecule (including unmodified siRNA, siRNA modified compounds, and siRNA conjugates), prodrug, or pharmaceutical composition of this disclosure can be applied about 1, 2, 3, or 4 times.

[0448] In some embodiments, the siRNA molecules of this disclosure (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, pharmaceutical compositions, and optionally other therapeutic agents may be packaged in a kit, wherein the siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, pharmaceutically acceptable carriers, and optionally other therapeutic agents may be provided in liquid or dry form. In some embodiments, the kit includes instructions on how to mix the siRNA molecules or prodrugs with pharmaceutically acceptable carriers or other components.

[0449] In some embodiments, the siRNA molecules (including unmodified siRNA, siRNA modifiers, and siRNA conjugates), prodrugs, and pharmaceutical compositions disclosed herein are used to prepare agents for inhibiting INHBE gene expression.

[0450] In some embodiments, the siRNA molecules (including unmodified siRNA, siRNA modifiers, siRNA conjugates), prodrugs, and pharmaceutical compositions disclosed herein are used to prepare medicaments for the prevention and / or treatment of diseases associated with INHBE gene overexpression.

[0451] In some implementations, the diseases are obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome, etc.

[0452] Table 1 siRNA sequence information

[0453]

[0454]

[0455]

[0456]

[0457]

[0458]

[0459]

[0460] Table 1-1 siRNA Sequences

[0461]

[0462] Table 2 siRNA Modifiers

[0463]

[0464]

[0465]

[0466]

[0467]

[0468]

[0469]

[0470]

[0471]

[0472]

[0473]

[0474]

[0475]

[0476]

[0477]

[0478]

[0479] In the table above, the capital letters “G”, “C”, “A”, “T”, and “U” typically represent nucleotides containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively; mA, mU, mC, and mG indicate nucleotides modified with 2-methoxy groups; Af, Gf, Cf, and Uf indicate nucleotides modified with 2-fluoro groups; (invAb) indicates a reverse debasing deoxyribose residue; the lowercase letter s indicates that the two nucleotides adjacent to it are linked by a phosphothioester bond; the letter combination ss indicates that the two nucleotides adjacent to it are linked by a dithiophosphoester bond; P1 indicates that the nucleotide adjacent to it on the right is a 5'-phosphate nucleotide; EVP indicates that the nucleotide adjacent to it on the right is a 5'-trans-vinylphosphonate nucleotide (i.e., a 5'-trans-vinylphosphonate group); [GNA] indicates that the ribonucleotide adjacent to it on the right is a ribonucleotide modified with GNA.

[0480] Table 3 siRNA conjugates

[0481]

[0482]

[0483]

[0484]

[0485]

[0486]

[0487]

[0488] In Table 3, L96 is also the conjugate group GalNAc shown in Formula I.

[0489] In Tables 1, 1-1, 2, and 3, if the 5' terminal nucleotide of the positive strand, the modified positive strand, and the modified positive strand with the connecting conjugate is not labeled with P1, EVP, or (invAb), it means that the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group, and its structure is shown in Formula X:

[0490]

[0491] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro(2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide.

[0492] In Tables 1, 1-1, 2 and 3, if the left side of the 5' terminal nucleotide of the antisense strand and the modified antisense strand is not marked with P1 or EVP, it means that the ribose group of the 5' terminal nucleotide has a 5' hydroxyl group, and its structure is as shown in Formula X.

[0493] In Tables 1, 1-1, and 2, the 3' end nucleotide of the sense strand and the modified sense strand has a hydroxyl group at the 3' position (for cases where the end is not (invAb)). In Tables 1, 1-1, 2, and 3, the 3' end nucleotide of the antisense strand and the modified antisense strand has a hydroxyl group at the 3' position.

[0494] Example

[0495] Other objects, features, and advantages of this disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific embodiments (although illustrating specific implementations of this disclosure) are given for illustrative purposes only, as various changes and modifications that can be made within the spirit and scope of this disclosure will become apparent to those skilled in the art upon reading this detailed description.

[0496] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.

[0497] The siRNA, siRNA modifiers, and siRNA conjugates involved in the following examples were synthesized by Tianlin Biotechnology (Shanghai) Co., Ltd.

[0498] Example 1: Synthesis of siRNA

[0499] 1.1 siRNA sequence design

[0500] Based on the human INHBE gene mRNA sequence, multiple pairs of INHBE siRNAs were designed at different sites. All designed individual siRNAs can target all transcripts of the target gene (as shown in Table 4). These multiple pairs of siRNAs showed the lowest homology with all other non-target gene sequences after sequence similarity comparison with sequence similarity software.

[0501] Table 4

[0502] target genes Species Gene ID NM_ID INHBE Homo sapiens 83729 NM_031479.5

[0503] The target sequences used to design siRNA are shown below. These target sequences are derived from the INHBE gene mRNA sequence (see NM_031479.5). For ease of comparison, the target sequences below are represented using the corresponding DNA sequences of the mRNA. In the synthesis process of this embodiment, when ribonucleotides are added, the T position corresponds to uracil ribonucleotide U or a modified U.

[0504] Target sequence I: AGCACAGCTATCCATCAGATGATCTACTTTCAGC (SEQ ID NO:1)

[0505] Target sequence I-1:

[0506] AGCACAGCTATCCATCAGA(SEQ ID NO:7)

[0507] Target sequence I-2:

[0508] ATCCATCAGATGATCTACTTTCAGC(SEQ ID NO:8)

[0509] Target sequence II:

[0510] CTGACCAGTCGTCCCAGAATAACTCATCCTCCACCCCAGGCAGCGCTGACCAGAGC

[0511] CCTCCGGAGACTACAGCCAGGGAGTGTGGCTCCAGGGAATGGGGAGGAGGTCATCAGCTTTGCTACTGTCACAGACTCC(SEQ ID NO:2)

[0512] Target sequence II-1:

[0513] CTGACCAGTCGTCCCAGAATAACTCATCCTCCACCCCAGGCAGCGCTGACCAGAGCCCTCCGGAGACTACA(SEQ ID NO:9)

[0514] Target sequence II-2: ATGGGGAGGAGGTCATCAGCTTTGCTACTGTCACAGACTCC (SEQ ID NO:10)

[0515] Target sequence II-3: ATCAGCTTTGCTACTGTCACA (SEQ ID NO:11)

[0516] Target sequence III:

[0517] CAGCACAGTTACTGGACAACCGAGGCGGCTCTTGGACACAGCAGGACACCAGCAGCCCTTCCTAGAGCTTAAGATCCGAGCCAATGA (SEQ ID NO: 3)

[0518] Target sequence III-1: CAGCACAGTTACTGGACAACCG (SEQ ID NO:12)

[0519] Target sequence III-2: CAGCAGCCCTTCCTAGAGCTTAAGATCCGAGCCAATGA (SEQ ID NO:13)

[0520] Target sequence IV:

[0521] GTACCAGCTGAATTACTGCAGTGGGCAGTGCCCTCCCCACCTGGCTGGCAGCCCAG

[0522] GCATTGCTGCCTCTTCCATCTGCCGTCTTCAGCCTCCTCAAAGCCAACAATCCTT

[0523] GGCCTGCCAGTACCTCCTGTTGTGTCCCTACTGCCCGAAGGCCCCTCTCTCCTCTACCTGGATCATAATGGCAATGTGGTCAAGACGG (SEQ ID NO: 4)

[0524] Target sequence IV-1:

[0525] GTACCAGCTGAATTACTGCAGGTGGGCAGTGCCCTCCCCACCTGGCTGGCAGCCCAGGCATTGCTGCCTCTT(SEQ ID NO:14)

[0526] Target sequence IV-2: CTCTCCTCTACCTGGATCA (SEQ ID NO:15)

[0527] Target sequence IV-3: GGCAATGTGGTCAAGACGG (SEQ ID NO:16)

[0528] Target sequence IV-4: CTTTCCATTCTGCCGTCTTCAG (SEQ ID NO:504)

[0529] Target sequence IV-5: TAATGGCAATGTGGTCAAGAC (SEQ ID NO:505)

[0530] Target sequence IV-6: CCTCTTTCCATTCTGCCGTCTTC (SEQ ID NO:506)

[0531] Target sequence V:

[0532] GCTGCAGCTAGCAAGAGGACCTGGGGCTTTGGAGTGAAGAGACCAAGATGAAGTT

[0533] TCCCAGGCACAGGGCATCTGTGACTGGAGGCATCAGATTCCTGATCCACACCCCAA

[0534] CCCAACAACCACCTGGCAATATGACTCACTTGACCCCTATGGGACCCAAATGGGCACTTTCTTGTCTGAGACTCTGGC(SEQ ID NO:5)

[0535] Target sequence V-1:

[0536] GCTGCAGCTAGCAAGAGGACCTGGGGCTTTGGAGTGAAGAGACCAAGATGAAGTTT(SEQ ID NO:17)

[0537] Target sequence V-2: GACTGGAGGCATCAGATTCCTGA (SEQ ID NO:18)

[0538] Target sequence V-3:

[0539] CCTGGCAATATGACTCACTTGACCCCTATGGGACCCAAATGGGCACTTTCTTGTCTG AGACTCTGGC(SEQ ID NO:19)

[0540] Target sequence VI:

[0541] GCAGGCTTGAAGCAGGGTAAGCAGGCTGGCCCAGGGTAAGGGCTGTTGAGGTACC

[0542] TTAAGGGAAGGTCAAGAGGGAGATGGGCAAGGCGCTGAGGGAGGATCTTAGGGG

[0543] ACCCCCAGAAACAGGAGTCAGGAAAATGAGGCACTAAGCCTAAGAAGTTCCCTGGTTTTTCCCAGGGGACAGGACCCACTGGGAGACAAGCATTTATACTTTCTTTC (SEQ ID NO: 6)

[0544] Target sequence VI-1: GCAGGCTTGAAGCAGGGTAAGCA (SEQ ID NO:20)

[0545] Target sequence VI-2: GCTGAGGGAGGATGCTTAG (SEQ ID NO:21)

[0546] Target sequence VI-3: CAGAAACAGGAGTCAGGAA (SEQ ID NO:22)

[0547] Target sequence VI-4: CTAAGAAGTTCCCTGGTTTTTCC (SEQ ID NO:23)

[0548] Target sequence VI-5: ACCCACTGGGAGACAAGCATTTATACTTTCTTTC (SEQ ID NO:24) Target sequence VII: GCCTGGCTTATACTTTCTTAATAA (SEQ ID NO:507)

[0549] Target sequence VIII: TACTGTCACAGACTCCACTTCAG (SEQ ID NO:508)

[0550] Target sequence IX: GCTAGCAAGCAGCAAATCCTGGAT (SEQ ID NO:509)

[0551] Target sequence X: CACTCTTTGCTTGAGGATCTTCCGATG (SEQ ID NO: 610)

[0552] Target sequence XI:

[0553] CTCCCAAGATGAGAAAGTCCTCAAGTGAGGGGAGGAGGAAGCAGATAGATGG(SEQ ID NO:611)

[0554] 1.2 Description of the synthesis method:

[0555] Nucleoside monomers are linked sequentially from 3' to 5' along the nucleotide arrangement using a solid-phase phosphorous amide method. Each linkage of a nucleoside monomer involves four steps: deprotection, coupling, oxidation or sulfidation, and capping. When two nucleotides are linked by a phosphate ester, the linkage of the next nucleoside monomer includes these four steps. When two nucleotides are linked by a phosphothiophosphate diester bond or a dithiophosphate diester bond, the linkage of the next nucleoside monomer includes these four steps. The present invention selects nucleotide monomers based on the target synthetic sequence. The selected nucleotide monomers are those commonly used by those skilled in the art; for example, the nucleotide monomer for synthesizing A can be, but is not limited to, adenosine-3-phosphate. It should be understood that these monomers, when present in oligonucleotides, are linked to each other via 5'-3' phosphate diester bonds or 5'-3' phosphothiophosphate diester bonds. When, for example, the last nucleotide in the 5' to 3' direction has a hydroxyl group at the 3' position, this is achieved using conventional methods in the art.

[0556] 1.3 The synthesis conditions are given as follows:

[0557] The nucleoside monomers were provided in 0.1 M acetonitrile solution. The deprotection reaction conditions were the same for each step: 25 °C, 70 seconds, and the deprotection reagent was a dichloromethane solution of dichloroacetic acid (3% v / v). The molar ratio of dichloroacetic acid to the 4,4'-dimethoxytriphenylmethyl protecting group on the solid support was 5:1.

[0558] The coupling reaction conditions were identical for each step, including a temperature of 25°C, a molar ratio of nucleic acid sequence to nucleoside monomer linked on the solid-phase support of 1:10, a molar ratio of nucleic acid sequence to coupling reagent linked on the solid-phase support of 1:65, a reaction time of 600 seconds, and a 0.5 M acetonitrile solution of 5-ethylthio-1H-tetrazole.

[0559] Each oxidation step was performed under identical conditions, including a temperature of 25°C, a reaction time of 15 seconds, and 0.05M iodine solution as the oxidizing agent. The molar ratio of iodine to the nucleic acid sequence linked on the solid-phase support in the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1.

[0560] The conditions for each sulfidation reaction were identical, including a temperature of 25°C, a reaction time of 300 seconds, and the use of hydroflavin as the sulfidation reagent. The molar ratio of the sulfidation reagent to the nucleic acid sequence linked on the solid-phase support in the coupling step was 120:1. The reaction was carried out in a mixed solvent of acetonitrile and pyridine in a ratio of 1:1.

[0561] Each capping step was performed under identical conditions, including a temperature of 25°C and a reaction time of 15 seconds. The capping reagent solution was a 1:1 molar mixture of CapA and CapB, and the molar ratio of the capping reagent to the nucleic acid sequence linked on the solid-phase support was acetic anhydride:N-methylimidazole:nucleic acid sequence linked on the solid-phase support = 1:1:1.

[0562] After the last nucleoside monomer is ligated, the nucleic acid sequence ligated on the solid-phase support is subjected to ammonolysis, purification, and desalting, followed by freeze-drying to obtain the sense and antisense strands; finally, the two strands are heated and annealed to obtain the product, which is then freeze-dried to obtain freeze-dried powder.

[0563] The synthesized siRNAs are shown in Table 1 and Table 1-1, and the synthesized siRNA modifiers are shown in Table 2.

[0564] Example 2: Synthesis of siRNA conjugate (GalNAc-siRNA)

[0565] Taking the synthesis of L96 as an example:

[0566] 2.1 The siRNA conjugate has the structure shown in Formula II:

[0567]

[0568] 2.2 Synthesis process of siRNA conjugates

[0569] The first step involves reacting DMTr-L96 with succinic anhydride to obtain compound L96-A:

[0570]

[0571] Preparation process: DMTr-L96, succinic anhydride, 4-dimethylaminopyridine, and diisopropylethylamine were added to dichloromethane and stirred at 25°C for 24 hours. The reaction solution was then washed with 0.5M triethylamine phosphate, and the aqueous phase was washed three times with dichloromethane. The combined organic phases were evaporated to dryness under reduced pressure to obtain the crude product. Then, column chromatography was used to purify the product to obtain pure L96-A.

[0572] The second step involves reacting L96-A with NH2-SPS to obtain L96-B:

[0573]

[0574] Preparation process: L96-A, O-benzotriazole-tetramethylurea hexafluorophosphate (HBTU), and diisopropylethylamine (DIPEA) were mixed and dissolved in acetonitrile. The mixture was stirred at room temperature for 5 minutes to obtain a homogeneous solution. Aminomethyl resin (NH2-SPS, 100-200 mesh) was added to the reaction solution, and the reaction was initiated at 25°C in a shaker. After 18 hours of reaction, the mixture was filtered. The filter cake was washed successively with dichloromethane and acetonitrile to obtain the filter cake. The obtained filter cake was subjected to a capping reaction with a CapA / CapB mixed solution to obtain L96-B, which is the solid-phase support containing the conjugated molecules.

[0575] The third step is the synthesis of siRNA conjugates:

[0576] Using L96-B as a solid-phase carrier, the sense strand of the siRNA conjugate was synthesized according to the siRNA synthesis method described above. The antisense strand of the siRNA conjugate was then synthesized using the same method. Annealing was performed to generate the siRNA conjugate of this application.

[0577] The synthesized siRNA conjugates are shown in Table 3.

[0578] Example 3: siRNA, siRNA modifiers, and siRNA conjugates inhibit INHBE gene expression

[0579] 3.1 Experimental Materials:

[0580] Huh7 cells were provided by Shanghai WuXi AppTec Co., Ltd.

[0581] RNA extraction kit 96 Kit, item number QIAGEN-74182;

[0582] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number 13778-150;

[0583] Universal U+Probe Master Mix V2, purchased from Vazyme, item number Q513-03;

[0584] Dulbecco's Modified Eagle Medium (DMEM medium), purchased from Gibco, catalog number 11965-092;

[0585] MEM medium, purchased from Gibco, catalog number 41090036;

[0586] The reverse transcription kit (HiScript III RT SuperMix for qPCR (+gDNA wiper)) was purchased from Vazyme, catalog number R313-01;

[0587] Opti-MEM: serum-reduced culture medium, purchased from Gibco, catalog number 31985070;

[0588] The Target INHBE primer was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0589] The INHBE Probe was purchased from Thermo, item number Hs01106908_m1;

[0590] The Target GAPDH primer was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0591] The GAPDH Probe was purchased from Thermo, item number 4326317E.

[0592] 3.2 Experimental Methods:

[0593] 3.2.1 Huh7 cells were seeded in fresh MEM medium in 96-well plates and cultured for 24 hours. The cultured cells were then resuspended in DMEM medium containing 10% (v / v) FBS to form a density of 2.22 × 10⁶ cells / well. 5 Spread 90 μL of cell suspension per well into a 96-well plate, resulting in 10,000 cells per well.

[0594] 3.2.2 The dry powders of the siRNA to be tested, the siRNA modifier, and the siRNA conjugate (collectively referred to as siRNA in the experimental procedure description of this embodiment for ease of description) were centrifuged at low temperature and high speed, and then dissolved in ultrapure distilled water to prepare a 100 μM siRNA stock solution.

[0595] 3.2.3 Prepare 20 nM siRNA dilution solution Z and 2 nM siRNA dilution solution W

[0596] (1) Preparation of 1 μM siRNA stock solution Y and 0.1 μM siRNA stock solution E:

[0597] a. Take 2 μL of the 100 μM siRNA stock solution obtained in step 3.2.2 above, add 18 μL of ultrapure distilled water to obtain siRNA stock solution Q with a final concentration of 10 μM.

[0598] b. Take 2 μL of the 10 μM siRNA stock solution Q prepared in step a, add 18 μL of ultrapure distilled water to obtain siRNA stock solution Y with a final concentration of 1 μM.

[0599] c. Take 2 μL of the 1 μM siRNA stock solution Y prepared in step b, add 18 μL of ultrapure distilled water to obtain siRNA stock solution E with a final concentration of 0.1 μM.

[0600] (2) Take 2 μL of the above-prepared siRNA stock solution Y and add 98 μL of Opti-MEM to obtain 20 nM siRNA dilution solution Z; take 2 μL of the above-prepared siRNA stock solution E and add 98 μL of Opti-MEM to obtain 2 nM siRNA dilution solution W.

[0601] 3.2.4 Transfection of Huh7 cells

[0602] (1) Take 3 μL of RNAiMAX transfection reagent was added to 97 μL of Opti-MEM to obtain... RNAiMAX transfection reagent dilution solution; The RNAiMAX transfection reagent diluent and the 2nM siRNA diluent W prepared in step 3.2.3 are mixed at a 1:1 volume ratio and allowed to stand for 5 minutes. Then, 10 μL of the transfection mixture is added to a 96-well plate to transfect the Huh7 cells cultured in step 3.2.1 (final volume 100 μL, siRNA concentration in this system is 0.1 nM).

[0603] (2) Take 3 μL of RNAiMAX transfection reagent was added to 97 μL of Opti-MEM to obtain... RNAiMAX transfection reagent dilution solution; The RNAiMAX transfection reagent diluent and the 20 nM siRNA diluent Z prepared in step 3.2.3 were mixed at a 1:1 volume ratio to prepare a transfection mixture. After standing for 5 minutes, 10 μL of the transfection mixture was added to a 96-well plate to transfect the Huh7 cells cultured in step 3.2.1 (final volume 100 μL, the concentration of siRNA in this system is 1 nM).

[0604] The cells were cultured for 48 hours after transfection; two replicates were set up for each concentration (1 nM and 0.1 nM).

[0605] 3.2.5 Extract total RNA from Huh7 cells obtained in step 3.2.4 according to the RNA extraction kit instructions.

[0606] 3.2.6 The total RNA obtained in step 3.2.5 was reverse transcribed into cDNA using a reverse transcription kit, following these steps:

[0607] a) Remove gDNA using gDNAase according to Table 5;

[0608] Table 5

[0609] Volume / μL 4×gDNA wiper Mix 4 RNase-free water 4 Sample (RNA) 8

[0610] 42℃, 2 min; 4℃, stand.

[0611] b) Perform the reverse transcription procedure as follows:

[0612] Table 6

[0613] Volume / μL The mixture obtained in step a) 16 5×HiScript III RT SuperMix 4

[0614] 37℃, 15min; 85℃, 5s.

[0615] c) Store the reverse transcription product obtained in step b) at 4°C for real-time PCR analysis.

[0616] 3.2.7 Perform real-time PCR analysis

[0617] a) Prepare the qPCR reaction mixture as shown in the table below. Throughout the entire process, all reagents should be kept on ice.

[0618] Table 7

[0619]

[0620] Table 8

[0621]

[0622] b) Perform the qPCR procedure as described below.

[0623] 95℃, 10 minutes;

[0624] 95℃, 15 seconds, 60℃, 1 minute (this operation is repeated 40 times).

[0625] 3.2.8 Results Analysis

[0626] a) Use Quant Studio 6Flex software with default settings to automatically calculate the Ct value;

[0627] b) Calculate the relative expression level of the gene using the following formula:

[0628] ΔCt=Ct(INHBE gene)–Ct(GAPDH)

[0629] ΔCt = ΔCt(sample group) - ΔCt(mock group)

[0630] mRNA expression relative to the Mock group = 2 -ΔΔCt .

[0631] Mock group: Compared to the test sample group, the group without siRNA was not added.

[0632] Inhibition rate (%) = (Relative expression level of mRNA in the Mock group – Relative expression level of mRNA in the test sample group) / Relative expression level of mRNA in the Mock group × 100%

[0633] 3.3 Results of the Silence Experiment

[0634] The concentrations of 0.1 nM and 1 nM were selected for testing, and the results are shown in Tables 9, 10 and 11 below.

[0635] Table 9

[0636]

[0637]

[0638] Note:" -- ”: Results not shown.

[0639] As shown in Table 9, in the Huh7 cell experiment, the siRNA provided in this application has high INHBE gene inhibitory activity. The concentration of 1 nM generally showed a higher inhibition rate of the INHBE gene than the concentration of 0.1 nM, showing a dose-dependent effect.

[0640] Table 10

[0641]

[0642]

[0643]

[0644] Note:" -- ”: Results not shown.

[0645] As shown in Table 10, in the Huh7 cell experiment, the siRNA modifier disclosed in this paper has a good inhibition rate against the INHBE gene. The concentration of 1 nM generally showed a higher inhibition rate against the INHBE gene than the concentration of 0.1 nM, showing a dose-dependent effect.

[0646] Table 11

[0647]

[0648]

[0649] As shown in Table 11, in the Huh7 cell experiment, the siRNA conjugate disclosed in this paper has a good inhibition rate against the INHBE gene. The concentration of 1 nM generally showed a higher inhibition rate against the INHBE gene than the concentration of 0.1 nM, showing a dose-dependent effect.

[0650] Example 4: siRNA modifiers and siRNA conjugates inhibit INHBE gene expression

[0651] Using a method similar to that in Example 3, the inhibition rates of the following siRNA modifiers and siRNA conjugates at concentrations of 1 nM and 0.1 nM were determined, and the results are shown in Tables 12 and 12-1.

[0652] Table 12

[0653] siRNA ID 1 nM (%) 0.1 nM (%) N-ER-FY046211M47 91.05 91.24 N-ER-FY046212M47 88.49 85.91 N-ER-FY046224M47 92.78 87.23

[0654] Table 12-1

[0655] siRNAID 1 nM (%) 0.1 nM (%) N-ER-FY046226M47L96 99.52 99.45 N-ER-FY046083M47L96 95.31 90.38 N-ER-FY046084M47L96 94.40 93.42 N-ER-FY046148M47L96 95.27 86.80 N-ER-FY046149M47L96 91.55 82.10 N-ER-FY046150M47L96 99.65 91.12 N-ER-FY046152M47L96 90.22 81.14

[0656] As can be seen from Tables 12 and 12-1, in Huh7 cell experiments, the siRNA modifiers and siRNA conjugates disclosed herein have a good inhibition rate against the INHBE gene.

[0657] Example 5: siRNA conjugates inhibit INHBE gene expression

[0658] 5.1 Test Materials:

[0659] Human primary hepatocytes (PHH cells) were provided by Shanghai WuXi AppTec Co., Ltd.

[0660] PHH culture medium: invitroGRO CP Medium, purchased from Bioreclamation, catalog number: S03316;

[0661] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number: 13778-150;

[0662] 96 Kit, purchased from Qiagen, item number: Qiagen-74182;

[0663] FastQuant RT Kit (including gDNase), purchased from TianGen, item number: KR116-02;

[0664] FastStart Universal Probe master, purchased from Roche, item number: 04914058001;

[0665] HiScript III RT SuperMix for qPCR (+gDNA wiper), purchased from Vazyme, catalog number R323-02.

[0666] 5.2 Test Methods

[0667] 5.2.1 siRNA conjugates (final concentrations of siRNA conjugates were 5 nM and 1 nM, in duplicate) were transfected into PHH cells, as described below: Frozen PHH cells were taken, thawed, counted, and adjusted to a cell volume of 6 × 10⁶ cells / well. 5 cells / mL, simultaneously applied The RNAiMAX transfection reagent was used to transfect siRNA conjugates into cells, seeding them at a density of 54,000 cells per well in 96-well plates, with 100 μL of PHH culture medium added to each well. Cells were incubated in a 5% CO2, 37°C incubator. After 48 hours, the culture medium was removed and cells were collected for total RNA extraction. Use according to the kit instructions. Total RNA was extracted using 96Kit.

[0668] 5.2.2 siRNA conjugates (final concentrations of siRNA conjugates were 200 nM and 10 nM, in duplicate) were introduced into PHH cells via free uptake, as described below: Frozen PHH cells were taken, thawed, counted, and adjusted to a cell volume of 6 × 10⁶ cells / well. 5 Cells / mL, along with siRNA conjugate, were seeded into 96-well plates at a density of 54,000 cells per well, with 100 μL of PHH culture medium added to each well. Cells were incubated in a 5% CO2, 37°C incubator. After 48 hours, the culture medium was removed and cells were collected for total RNA extraction. Use according to the kit instructions. Total RNA was extracted using 96Kit.

[0669] Reverse transcription to cDNA was performed using a reverse transcription kit, following these steps:

[0670] (1) Remove gDNA using gDNAase according to Table 13 below;

[0671] Table 13

[0672] Volume / μL 4×gDNA wiper Mix 2 <![CDATA[RNase-free ddH2O]]> 8 Sample (RNA) 80-120ng

[0673] 42℃, 2min.

[0674] (2) Prepare the second-step reverse transcription reaction mixture as shown in Table 14 and mix thoroughly.

[0675] Table 14

[0676] The mixture from the previous step 10μL 10×RT Mix 2μL HiScript Ⅲ Enzyme Mix 2μL <![CDATA[Oligo(dT) 20 VN]]> 1μL Random hexamers 1μL <![CDATA[RNase-free ddH2O]]> 4μL

[0677] The qPCR procedure is described below.

[0678] 50℃, 2s;

[0679] 4℃.

[0680] (3) Add 50 μL of enzyme-free sterile water to prepare the qPCR reaction mixture as shown in the table below. All reagents were kept on ice throughout the procedure.

[0681] Table 15

[0682]

[0683] Table 16

[0684]

[0685] The qPCR procedure is described below.

[0686] 95℃, 10 minutes;

[0687] 95℃, 15 seconds, 60℃, 1 minute (this operation is repeated 40 times).

[0688] Results analysis:

[0689] a) Use Quant Studio 7 software with default settings to automatically calculate the Ct value;

[0690] b) Calculate the relative expression level of the gene using the following formula:

[0691] ΔCt=Ct(INHBE gene)–Ct(GAPDH)

[0692] ΔCt = ΔCt(test sample group) – ΔCt(Mock group), where the Mock group represents the group without siRNA conjugate compared to the test sample group;

[0693] mRNA expression relative to the Mock group = 2 -ΔΔCt

[0694] Inhibition rate (%) = (Relative expression level of mRNA in the Mock group – Relative expression level of mRNA in the test sample group) / Relative expression level of mRNA in the Mock group × 100%

[0695] The experimental results are shown in Table 17.

[0696] Table 17 Inhibition rate of siRNA conjugates on INHBE gene expression

[0697]

[0698] Note: "—" indicates the result is not shown.

[0699] As shown in Table 17, the siRNA conjugate disclosed in this paper exhibits a good inhibition rate against the INHBE gene in PHH cell experiments, showing a dose-dependent effect under both transfection and free uptake methods.

[0700] Example 6: siRNA conjugates inhibit INHBE gene expression

[0701] 6.1 Using a method similar to 5.2.2 in Example 5, the inhibition rate of the following siRNA conjugates at concentrations of 200 nM and 10 nM under free uptake was determined, and the results are shown in Table 18.

[0702] Table 18

[0703]

[0704] As shown in Table 18, in PHH cell experiments, the siRNA conjugate disclosed herein exhibits a good inhibition rate against the INHBE gene, showing a dose-dependent effect under free uptake conditions.

[0705] 6.2IC 50 Measurement results

[0706] The following concentration range (nM) for the siRNA conjugate assay was set as follows: starting from 500 nM, 4-fold dilution, 8 concentration gradients; the siRNA conjugates (final concentrations of siRNA conjugates were 500, 125, 31.25, 7.8125, 1.9531, 0.4883, 0.1221 and 0.03052 nM, in duplicate wells) were introduced into PHH cells via free uptake, and then the IC50 was measured using a method similar to 5.2.2.

[0707] Results analysis:

[0708] a) Use Quant Studio 6Flex software with default settings to automatically calculate the Ct value;

[0709] b) Calculate the relative expression level of the gene using the following formula:

[0710] ΔCt=Ct(INHBE gene)–Ct(GAPDH)

[0711] ΔCt = ΔCt(test sample group) – ΔCt(Mock group), where the Mock group represents the group without siRNA conjugate compared to the test sample group;

[0712] mRNA expression relative to the Mock group = 2 -ΔΔCt

[0713] Inhibition rate (%) = (Relative expression level of mRNA in the Mock group – Relative expression level of mRNA in the test sample group) / Relative expression level of mRNA in the Mock group × 100%

[0714] Calculation process: The log value of siRNA conjugate concentration was used as the X-axis, and the percentage inhibition rate was used as the Y-axis. The dose-response curve was fitted using the "log (inhibitor) vs. response – variable slope" function in GraphPad Prism 8 software to obtain the IC50 of each siRNA conjugate. 50 value.

[0715] The fitting formula is: Y = Bottom + (Top – Bottom) / (1 + 10^(logIC)) 50 –X)×HillSlope))

[0716] Where: Top represents the percentage inhibition rate at the top plateau, and the standard for the Top of the curve is generally between 80% and 120%; Bottom represents the percentage inhibition rate at the bottom plateau, and the Bottom of the curve is generally between -20% and 20%; HillSlope represents the slope of the percentage inhibition rate curve.

[0717] The results are shown in Table 19 below.

[0718] Table 19

[0719] <![CDATA[ siRNA ID ]]> <![CDATA[ IC 50 (nM) ]]> N-ER-FY046226M47L96 1.405 N-ER-FY046083M47L96 0.721 N-ER-FY046084M47L96 1.514

[0720] As can be seen from Table 19, in the PHH cell experiment, the siRNA conjugate disclosed in this paper has a good inhibition rate against the INHBE gene.

[0721] Example 7: siRNA and siRNA modifiers inhibit INHBE gene expression

[0722] Using a method similar to that in Example 3, the inhibition rates of the following test siRNAs and siRNA modifiers at concentrations of 1 nM and 0.1 nM were determined, and the results are shown in Tables 20 and 21.

[0723] Table 20

[0724]

[0725] As shown in Table 20, in the Huh7 cell experiment, the siRNA provided in this application has high INHBE gene inhibitory activity. The concentration of 1 nM generally showed a higher inhibition rate of the INHBE gene than the concentration of 0.1 nM, showing a dose-dependent effect.

[0726] Table 21

[0727]

[0728] As shown in Table 21, in the Huh7 cell experiment, the siRNA modifier disclosed in this paper has a good inhibition rate against the INHBE gene. The concentration of 1 nM generally showed a higher inhibition rate against the INHBE gene than the concentration of 0.1 nM, showing a dose-dependent effect.

[0729] Example 8: IC 50 Measurement results

[0730] The following concentration range (nM) for the siRNA conjugate assay was set as follows: starting from 10 nM, 4-fold dilution, 8 concentration gradients; then IC50 was performed using a method similar to 3.2. 50 Measurement.

[0731] Results analysis:

[0732] a) Use Quant Studio 6Flex software with default settings to automatically calculate the Ct value;

[0733] b) Calculate the relative expression level of the gene using the following formula:

[0734] ΔCt=Ct(INHBE gene)–Ct(GAPDH)

[0735] ΔCt = ΔCt(test sample group) – ΔCt(Mock group), where the Mock group represents the group without siRNA conjugate compared to the test sample group;

[0736] mRNA expression relative to the Mock group = 2 -ΔΔCt

[0737] Inhibition rate (%) = (Relative expression level of mRNA in the Mock group – Relative expression level of mRNA in the test sample group) / Relative expression level of mRNA in the Mock group × 100%

[0738] Calculation process: The log value of siRNA conjugate concentration was used as the X-axis, and the percentage inhibition rate was used as the Y-axis. The dose-response curve was fitted using the "log (inhibitor) vs. response – variable slope" function in GraphPad Prism 8 software to obtain the IC50 of each siRNA conjugate. 50 value.

[0739] The fitting formula is: Y = Bottom + (Top – Bottom) / (1 + 10^(logIC)) 50 –X)×HillSlope))

[0740] Where: Top represents the percentage inhibition rate at the top plateau, and the standard for the Top of the curve is generally between 80% and 120%; Bottom represents the percentage inhibition rate at the bottom plateau, and the Bottom of the curve is generally between -20% and 20%; HillSlope represents the slope of the percentage inhibition rate curve.

[0741] The results are shown in Table 22 below.

[0742] Table 22

[0743] siRNA ID <![CDATA[IC 50 (nM)]]> N-ER-FY046227M47L96 0.0513

[0744] As can be seen from Table 22, the siRNA conjugate disclosed herein exhibits a good inhibition rate against the INHBE gene in Huh7 cell experiments.

[0745] Example 9: siRNA conjugates inhibit INHBE gene expression

[0746] 9.1 Using a method similar to 5.2.2 in Example 5, the inhibition rate of the following siRNA conjugates at concentrations of 200 nM and 10 nM under free uptake was determined, and the results are shown in Table 23.

[0747] Table 23

[0748]

[0749] 9.2IC 50 Measurement results

[0750] Using a method similar to 6.2 in Example 6, the IC50 of the following siRNA conjugates was determined. 50 The results are shown in Table 24.

[0751] Table 24

[0752] siRNA ID <![CDATA[IC 50 (nM)]]> N-ER-FY046148M47L96 0.139 N-ER-FY046149M47L96 0.397 N-ER-FY046150M47L96 0.154 N-ER-FY046152M47L96 0.231 N-ER-FY046211M47L96 0.202 N-ER-FY046212M47L96 0.215 N-ER-FY046224M47L96 0.054 N-ER-FY046256M47L96 0.158 N-ER-FY046256M85L96 0.147

[0753] As can be seen from Table 24, the siRNA conjugate disclosed herein exhibits a good inhibition rate against the INHBE gene in PHH cell experiments.

[0754] Example 10: In vitro stability experiment of rat liver homogenate of siRNA conjugate

[0755] 10.1 Experimental Reagents and Consumables

[0756] Table 25

[0757] Reagent Name brand Item number / CAS number <![CDATA[1M MgCl2]]> Beyotime ST269 ammonium bicarbonate Tianjin Guangfu Fine Chemical GB663-78 Sodium dihydrogen phosphate Tianjin Guangfu Fine Chemical GB / T1267-1999 disodium hydrogen phosphate Tianjin Guangfu Fine Chemical 10039-32-4 Acetonitrile Honeywell AH015-4HC methanol Honeywell AH230-4HC 0.5M EDTA Beyotime ST066

[0758] 10.2 Experimental Procedure 10.2.1 Preparation of Liver Homogenate

[0759] 10.2.1.1 Grinding Fluid Preparation

[0760] Table 26

[0761] Reagent Name Preparation method 5mM EDTA solution Take 1 mL of 0.5 M EDTA into a 100 mL volumetric flask, dilute to the mark with purified water, and shake well. 100mM magnesium chloride solution Take 1 mL of 1M magnesium chloride into a 10 mL volumetric flask, dilute to the mark with purified water, and shake well. Grinding fluid Add 1 mL of 5 mM EDTA solution, 1 mL of 100 mM magnesium chloride solution, and 98 mL of purified water to adjust the pH to 6.0.

[0762] 10.2.1.2 Tissue Homogenization

[0763] Rat liver tissue (collected from SD rats, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) was mixed with homogenizing solution at a ratio of 100mg:5mL to prepare liver homogenate (concentration of 20mg / mL). After preparation, the homogenate was added to a homogenizer and the homogenization parameters were set as follows.

[0764] Table 27

[0765] Running speed 60Hz runtime 30s Pause time 15s Number of runs 4 times Operating temperature -20℃

[0766] 10.2.2 Sample Preparation

[0767] The siRNA conjugate sample was prepared into a 1 mg / mL solution using enzyme-free water and set aside for use. The internal standard sample was prepared into a 0.125 mg / mL solution using enzyme-free water.

[0768] 10.2.3 Sample incubation

[0769] (1) Add 250 μL of the prepared liver homogenate to a 2 mL enzyme-free tube.

[0770] (2) Add 50 μL of siRNA conjugate sample solution based on step (1);

[0771] (3) The system is a 300 μL biological sample solution. Vortex and let stand for 5 min.

[0772] (4) Divide into 2 tubes, each containing 100 μL;

[0773] (5) The system was incubated at 37°C for 48 hours.

[0774] 10.2.4 Biological Sample Processing

[0775] Vortex each 100 μL biological sample system, mix well, add 300 μL of Clarity OTX lysis buffer (Clarity OTX Lysis-loading Buffer, purchased from Agilent-FinnoMed, catalog number AL0-8579), vortex, let stand for 30 min, add 100 μL of internal standard solution, vortex, centrifuge at low speed for 5 min at 1500 rpm, and set aside for use (total sample volume approximately 500 μL).

[0776] 10.2.5 Solid-phase extraction

[0777] (1) Preparation of solid phase extraction reagent

[0778] Activator: Add 200 mL of methanol to the mobile phase bottle and label it as activator;

[0779] Equilibrium buffer: Prepare 1M phosphate buffer solution [877mL sodium dihydrogen phosphate (1.56g / L) + 123mL disodium hydrogen phosphate (3.58g / L)], dilute 100 times, adjust pH to 5.5 with phosphate, and label as equilibrium buffer;

[0780] Rinse solution: Take 500 mL of equilibrium solution into a 1 L mobile phase bottle, add 500 mL of acetonitrile, mix well, and label as rinsing solution;

[0781] Eluent: Weigh 7.9g of ammonium bicarbonate into a 1L mobile phase bottle, add 1L of water, adjust the pH to 9 using sodium hydroxide, take 500mL of the adjusted ammonium bicarbonate solution into a 1L mobile phase bottle, add 500mL of acetonitrile, mix well, and label it as eluent.

[0782] (2) The extraction steps are as follows:

[0783] Table 28

[0784] step process Equilibrium time activation 1 mL of the activator from the above steps 10min balance 2×1mL of the equilibration solution from the above steps 10 minutes each time Sample A biological sample of a certain volume (4 / 5 of the total volume) 10min rinse 2 × 1 mL of the equilibration solution from the above steps; 4 × 1 mL of the rinsing solution from the above steps 20 minutes each time Washout 3 × 0.75 mL of the eluent from the above steps 20 minutes each time

[0785] 10.2.6 Post-processing

[0786] Take the eluent (600 μL in three portions, totaling 1800 μL) and place it in a 2 mL EP tube. Concentrate under vacuum (or dry under nitrogen at 40 °C) for 10 hours at 1800 rpm. Reconstitute the concentrated sample with 100 μL of mobile phase (initial ratio) and centrifuge at 12000 rpm for 20 min at 15 °C. Inject 10 μL of the supernatant into a high-resolution mass spectrometer. The antisense strand percentage of the siRNA conjugate in this application was semi-quantitatively determined using LC-MS / MS. The calculation formula is: AS strand remaining percentage % = AS... MSintensity The sum of / AS chains and all related degradation products MSIntensity × 100%, where MS intensity is the mass spectrometry intensity signal value. The metabolic results after in vitro incubation in rat liver homogenate for 48 hours are shown in Table 29 below.

[0787] Table 29. Remaining antisense strand percentage of siRNA conjugates

[0788]

[0789]

[0790] Where AS represents the antisense strand of the siRNA conjugate, a larger remaining AS indicates better drug stability and longer-lasting effect. Table 29 shows that the siRNA conjugate disclosed in this invention exhibits excellent in vitro stability in rat liver homogenate.

[0791] Example 11: Silent effect of siRNA conjugates on mice expressing the human INHBE (hINHBE) gene

[0792] 11.1 Constructing a mouse model overexpressing the hINHBE gene using AAV8

[0793] Six- to eight-week-old male C57BL / 6 mice (provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.) were introduced into the facility. A single tail vein injection of adeno-associated virus AAV8 (pAAV[Exp]-CBh>SEAP:{INHBE partCDS+part 3UTR}, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) was administered to induce target gene overexpression. The administration volume was 100 μL (10 × 10⁻⁶). 11 vg) / animal, then fed with regular feed.

[0794] 11.2 In vivo efficacy study of silencing siRNA conjugates in hINHBE mouse model

[0795] Fourteen days after AAV8 virus injection, mice were divided into groups of five. Mice were subcutaneously administered a single 3 mg / kg (mpk) dose of the siRNA conjugate described in this application at a volume of 5 μL / g in sterile PBS without RNase. The control group received the same volume of sterile PBS without RNase. SEAP protein expression (i.e., hINHBE protein expression) was measured on days 7, 14, 21, 28, 35, 42, 49, 56, 63, and 70 post-administration. The gene expression inhibition rate was calculated using the formula: Inhibition rate % = (1 - Average protein expression in the administered group / Average protein expression in the control group) * 100%. The inhibition rate (%) results are shown in Table 30 below.

[0796] Table 30

[0797] siRNA ID D7 D14 D21 D28 D35 D42 D49 D56 D63 D70 N-ER-FY046083M47L96-3mpk 68.08 72.47 81.28 79.19 74.19 74.54 73.95 70.53 72.65 69.02 N-ER-FY046226M47L96-3mpk 30.48 23.00 27.59 49.16 53.85 59.43 59.94 44.50 -- -- N-ER-FY046084M47L96-3mpk 49.90 54.70 64.03 66.31 66.44 62.27 68.78 62.61 68.39 59.40 N-ER-FY046149M47L96-3mpk 63.16 72.71 77.71 80.89 76.29 78.49 80.00 76.50 75.14 75.95

[0798] Note: "--": The result is not shown.

[0799] As can be seen from Table 30, the siRNA conjugate of this application has high inhibitory activity against the hINHBE gene in vivo, and can reduce the expression level of hINHBE for a long time, with long-lasting inhibition in vivo.

[0800] Example 12: Inhibitory effect of siRNA conjugates on INHBE gene expression in wild-type mice

[0801] Wild-type C57BL / 6 male mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) aged 6-8 weeks were randomly divided into groups of 5 mice each based on body weight. They were subcutaneously administered a single dose of the siRNA conjugate of this application and PBS (purchased from Gibco, catalog number 10010-023) at a volume of 5 μL / g. The mice were euthanized 14 days after administration. Two 30 mg portions of left lobe liver tissue were collected from the mice, flash-frozen in liquid nitrogen, and homogenized into tissue slurries. RNA was extracted from the tissues, and the mRNA inhibition rate of the target gene was detected.

[0802] 12.1 Experimental Reagents:

[0803] RNA extraction kit, purchased from QIAGEN, catalog number: 74106;

[0804] Reverse transcription kit, purchased from Vazyme, catalog number R312-02;

[0805] Target INHBE probe, purchased from Thermo, part number Hs01033038-g1(FAM);

[0806] ACTB probe, purchased from Thermo, part number Mm02619580-g1(VIC);

[0807] TaqMan TM Gene expression premix, purchased from Applied Biosystems, catalog number 4369016.

[0808] 12.2 Experimental Procedure:

[0809] 12.2.1 Tissue Homogenization

[0810] 1) Take the right half of the left lobe of the mouse liver and add 1 mL of lysis buffer;

[0811] 2) Homogenize at 60Hz for 30 seconds, pause for 15 seconds, repeat 10 times, and then briefly centrifuge.

[0812] 3) Add the remaining RLT (lysate) to a uniform concentration according to the liver weight; vortex to mix.

[0813] 12.2.2 RNA Extraction

[0814] Total RNA was extracted from the tissue homogenate obtained in step 12.2.1 according to the RNA extraction kit instructions.

[0815] 12.2.3 The total RNA obtained in step 12.2.2 was reverse transcribed into cDNA using a reverse transcription kit, following these steps:

[0816] 1) Prepare the first-step reverse transcription reaction mixture as described in Table 31 and mix thoroughly. Throughout the procedure, all reagents should be kept on ice.

[0817] Table 31

[0818] 5×gDNA wiper Mix 2μL Total RNA 400ng <![CDATA[RNase-free ddH2O]]> Add to 10 μL

[0819] 42℃, 2min;

[0820] 2) Prepare the second-step reverse transcription reaction mixture as described in Table 32 and mix thoroughly;

[0821] Table 32

[0822] The mixture from the previous step 10μL 10×RT Mix 2μL HiScriptⅢEnzyme Mix 2μL <![CDATA[Oligo(dT) 20 VN]]> 1μL random primers 1μL <![CDATA[RNase-free ddH2O]]> 4μL

[0823] The reverse transcription procedure is shown in Table 33:

[0824] Table 33

[0825] 50℃, 15min 85℃,5s 4℃

[0826] 12.2.4 Amplification and Analysis

[0827] 1) Prepare the qPCR reaction mixture as shown in Tables 34 and 35. All reagents were kept on ice throughout the procedure.

[0828] Table 34

[0829]

[0830] Table 35

[0831]

[0832] 2) Perform the qPCR procedure as shown in Table 36:

[0833] Table 36

[0834]

[0835] 3) Data Analysis

[0836] Using the default settings, the Ct value is automatically calculated in Quant Studio 6Flex software.

[0837] The relative expression level of a gene is calculated using the following formula:

[0838] ΔCt = Ct(INHBE gene) – Ct(ACTB)

[0839] ΔCt = ΔCt(sample group) - ΔCt(mock group)

[0840] mRNA expression relative to the Mock group = 2 -ΔΔCt .

[0841] Mock group: The group without siRNA conjugates compared to the test sample group.

[0842] Inhibition rate (%) = (Relative expression level of mRNA in the Mock group - Relative expression level of mRNA in the test sample group) / Relative expression level of mRNA in the Mock group × 100%

[0843] Table 37

[0844]

[0845] As can be seen from Table 37, the siRNA conjugate of this application has high inhibitory activity against the INHBE gene in vivo and can reduce the expression level of INHBE for a long time.

[0846] Example 13: Inhibitory effect of siRNA conjugates on human INHBE gene expression in humanized mice

[0847] Six- to eight-week-old C57BL / 6-hINHBE mice (provided by Shanghai Southern Model Biotechnology Co., Ltd.) were placed in a breeding facility and administered the siRNA conjugate of this application subcutaneously at a single dose of 3 mg / kg (n=5 per group). Fourteen days after administration, the mice were euthanized, and two 30 mg portions of left lobe liver tissue were collected and rapidly frozen in liquid nitrogen. After being cryogenically homogenized, tissue RNA was extracted, and the mRNA inhibition rate of the target gene was detected using the same method as in Example 12. The results are shown in Table 38.

[0848] Table 38 shows the inhibition rate of siRNA conjugates on INHBE mRNA.

[0849]

[0850] The sequence of N-ER-FY046Y04L96 is shown in Table 39.

[0851] Table 39

[0852]

[0853] Among them, "dG", "dA", and "dT" are deoxygenated nucleotides.

[0854] As can be seen from Table 38, the siRNA conjugate of this application has high inhibitory activity against the INHBE gene in vivo and can reduce the expression level of INHBE for a long time.

[0855] Example 14: In vitro off-target experiment

[0856] 14.1 Main Reagents and Consumables

[0857] InvitroGRO CP Medium, serum-free, purchased from Bioreclamation, product number IVT-S03316.

[0858] Fetal bovine serum was purchased from ExCellBio, catalog number: FSP500.

[0859] Penicillin / streptomycin was purchased from Hyclone, catalog number: SV30010.

[0860] AO / PI staining solution was purchased from Countstar, catalog number: RE010212.

[0861] Nuclease-free water was purchased from Invitrogen, product number: AM9932.

[0862] The ribonucleic acid extraction kit (miRNeasy Tissue / Cells Advanced Mini Kit) was purchased from Qiagen, catalog number: 217604.

[0863] The Agilent RNA 6000 Nano Kit was purchased from Agilent, catalog number 5067-1511.

[0864] Transcriptome library construction kit The Universal V10RNA-seq Library Prep Kit for Illumina was purchased from Vazyme, catalog number: NR606-02.

[0865] The high-sensitivity double-stranded deoxyribonucleic acid concentration assay kit (Qubit 1X dsDNA HS Assay Kit) was purchased from Thermo Fisher Scientific, catalog number: Q33231.

[0866] The High Sensitivity D1000 ScreenTape pre-fabricated deoxyribonucleic acid electrophoresis strip was purchased from Agilent, catalog number: 5067-5584.

[0867] The NovaSeq 6000S4 Reagent Kit v1.5 (300 cycles) was purchased from Illumina, catalog number: 20028312.

[0868] Human primary hepatocytes (PHH) (batch: BXU) were provided by Shanghai WuXi AppTec New Drug Development Co., Ltd.

[0869] 14.2 Main Instruments

[0870] Biosafety cabinet (Lixin (Shanghai) Instrument Co., Ltd., Hfsafe-1800LCA2), micro-volume UV-Vis spectrophotometer (NanoDrop One, Thermo Fisher Scientific), Agilent 2100 Bioanalyzer (Agilent), thermal cycler (T100 thermal cycler, Bio-Rad), fluorescence meter (Qubit4fluorometer, Thermo Fisher Scientific), Agilent 4200 automated electrophoresis system (Agilent4200 TapeStation), sequencer (NovaSeq 6000 (Illumina)), fully automated cell fluorescence analyzer (Rigel S2, Countstar).

[0871] 14.3 Culture medium formulation

[0872] The cell culture medium preparation system containing 10% fetal bovine serum in 20 mL consists of: 17.8 mL of serum-free in vitro culture medium InvitroGRO CP Medium (Bioreclamation IVT-S03316), 2 mL of fetal bovine serum (ExCellBio-FSP500), and 0.2 mL of penicillin / streptomycin (Hyclone-SV30010).

[0873] 14.4 Experimental Procedure

[0874] 14.4.1 Cell Plating

[0875] The conjugate N-ER-FY046149M47L96 enters human primary hepatocytes via free uptake, as described below:

[0876] (1) Dilute the conjugate N-ER-FY046149M47L96 with nuclease-free water to 10 times the final concentration (final concentrations are 20 nM and 100 nM).

[0877] (2) Remove one vial of cryopreserved human primary hepatocytes (PHH) from the liquid nitrogen tank, gently agitate in a water bath until the cryopreservation solution thaws, transfer the cells to a cell culture medium containing 10% fetal bovine serum, and adjust the final cell density to 6.7*102. 5 cells / mL.

[0878] (3) Take 50 μL of the conjugate from step (1) into a collagen-coated 24-well cell plate, and then add 450 μL of cell suspension from step (2) to achieve a final cell density of 300,000 per well. The final concentrations of N-ER-FY046149M47L96 are 20 nM and 100 nM. Each conjugate is tested in triplicate, and the wells without the conjugate are used as the control group.

[0879] (4) After culturing for 72 hours, each well was washed with PBS and then 260 μL of lysis buffer was added to lyse the cells for subsequent experiments.

[0880] 14.4.2 Next-Generation Sequencing

[0881] (1) Purify total RNA from cells according to the manufacturer’s (Qiagen-217604_miRNeasy Tissue / Cells Advanced Mini Kit) instructions.

[0882] (2) The concentration of total RNA was detected using NanoDrop One, and RNA integrity was analyzed according to the manufacturer’s (Agilent 2100 Bioanalyzer\Agilent-5067-1511_Agilent RNA 6000 Nano Kit) guidelines.

[0883] (3) According to the manufacturer ( Library preparation was performed using the Universal V10RNA-seq Library PrepKit for Illumina.

[0884] (4) Detect the library concentration according to the manufacturer's (Thermo Fisher Scientific-Qubit 4fluorometer\ThermoFisher Scientific-Q33231_Qubit 1X dsDNA HS Assay Kit) guidelines, and analyze the library fragment size according to the manufacturer's (Agilent 4200TapeStation\Agilent-5067-5584_High Sensitivity D1000ScreenTape) guidelines.

[0885] (5) Perform library sequencing according to the manufacturer's (Illumina-NovaSeq 6000\Illumina-20028312_NovaSeq6000S4Reagent Kit v1.5(300cycles)) guidelines.

[0886] This study, based on next-generation sequencing technology, investigated the effect of free uptake of the test sample (N-ER-FY046149M47L96) by human hepatocytes on transcriptome expression. |log2(FoldChange)|>1 & padj.<0.05 was set as the screening criterion for differentially expressed genes.

[0887] IC50 in 14.5 PHH cells 50 test

[0888] The concentration range (nM) for the N-ER-FY046149M47L96 assay of the siRNA conjugate to be tested was set as follows: 500, 125, 31.25, 7.8125, 1.9531, 0.4883, 0.1221, and 0.03052 nM. IC50 analysis was then performed using the same method as in Example 6. 50 The free uptake in PHH cells was determined, and the IC50 of N-ER-FY046149M47L96 in human hepatocytes was obtained. 50 The value was 0.397 nM. The inhibition rates at various concentrations are shown below. Figure 1 As shown.

[0889] Sequencing N-ER-FY046149M47L96 at concentrations of 20 nM and 100 nM revealed 0 and 4 differentially expressed genes (ENSG00000217702, ENSG00000260621, ENSG00000271984, and ENSG00000257303) with |log2(FoldChange)|>1&padj<0.05 at the two concentrations, respectively. Figure 2 and Figure 3As shown in the figure, the differentially expressed genes at the two concentrations did not overlap, indicating that there was no dose-dependent effect on the differentially expressed genes. Therefore, no off-target genes were found in N-ER-FY046149M47L96 in in vitro PHH cell experiments. The IC50 of N-ER-FY046149M47L96 in PHH cells... 50 The concentration was 0.397 nM, and the two selected off-target concentrations were IC50 and IC50, respectively. 50 The safety window of the conjugate is 50 times and 252 times that of the target, indicating that it has a safety window of more than 50 times. Therefore, it has a low risk of off-target effects in vivo, good safety, and good drug-like properties.

[0890] Example 15: Silent effect of siRNA conjugates on mice expressing the human INHBE (hINHBE) gene

[0891] 15.1 Constructing a mouse model overexpressing the hINHBE gene using AAV8

[0892] Six- to eight-week-old male C57BL / 6 mice (provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.) were introduced into the facility. A single tail vein injection of adeno-associated virus AAV8 (pAAV[Exp]-CBh>SEAP:{hINHBE partCDS+3'UTR new}, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) was administered to induce target gene overexpression. The administration volume was 100 μL (10 × 10⁻⁶). 11 (vg) / animal, fed with regular feed.

[0893] 15.2 In vivo efficacy study of silencing siRNA conjugates in hINHBE mouse model

[0894] Fourteen days after AAV8 virus injection, mice were divided into groups of five. Mice were subcutaneously administered a single 3 mg / kg (mpk) dose of the siRNA conjugate described in this application at a volume of 5 μL / g in sterile PBS without RNase. The control group received the same volume of sterile PBS without RNase. SEAP protein expression (i.e., hINHBE protein expression) was measured on days 7, 14, 21, 28, 35, and 42 post-administration. The gene expression inhibition rate was calculated using the formula: Inhibition rate % = (1 - Average protein expression in the administered group / Average protein expression in the control group) * 100%. The inhibition rate (%) results are shown in Table 40 below.

[0895] Table 40

[0896] siRNA ID D7 D14 D21 D28 D35 D42 N-ER-FY046148M47L96-3mpk 85.14 84.89 83.83 80.46 79.73 71.42 N-ER-FY046152M47L96-3mpk 80.00 80.99 80.98 81.75 77.44 73.42 N-ER-FY046256M47L96-3mpk 83.02 84.53 84.49 82.61 80.21 74.35 N-ER-FY046256M85L96-3mpk 82.19 85.27 84.99 83.08 81.02 77.25

[0897] As can be seen from Table 40, the siRNA conjugate of this application has high inhibitory activity against the hINHBE gene in vivo, and can reduce the expression level of hINHBE for a long time, with long-lasting inhibition in vivo.

[0898] Example 16: Silent effect of siRNA conjugates on mice expressing the human INHBE (hINHBE) gene

[0899] 16.1 Constructing a mouse model overexpressing the hINHBE gene using AAV8

[0900] Six- to eight-week-old male C57BL / 6 mice (provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.) were introduced into the facility. A single tail vein injection of adeno-associated virus AAV8 (pAAV[Exp]-CBh>SEAP:{INHBE partCDS+part 3UTR}, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) was administered to induce target gene overexpression. The administration volume was 100 μL (10 × 10⁻⁶). 11 vg) / animal, then fed with regular feed.

[0901] 16.2 In vivo efficacy study of silencing siRNA conjugates in hINHBE mouse model

[0902] Fourteen days after AAV8 virus injection, mice were divided into groups of five. Mice were subcutaneously administered a single 3 mg / kg (mpk) dose of the siRNA conjugate described in this application at a volume of 5 μL / g in sterile PBS without RNase. The control group received the same volume of sterile PBS without RNase. SEAP protein expression (i.e., hINHBE protein expression) was measured on days 7, 14, and 21 post-administration. The gene expression inhibition rate was calculated using the formula: Inhibition rate % = (1 - Average protein expression in the administered group / Average protein expression in the control group) * 100%. The inhibition rate (%) results are shown in Table 41 below.

[0903] Table 41

[0904] siRNA ID D7 D14 D21 N-ER-FY046195M47L96-3mpk 66.00 72.08 76.69

[0905] As can be seen from Table 41, the siRNA conjugate of this application has high inhibitory activity against the hINHBE gene in vivo and can reduce the expression level of hINHBE for a long time.

[0906] Example 17: Inhibitory effect of siRNA conjugates on human INHBE gene expression in humanized mice

[0907] Six- to eight-week-old C57BL / 6-hINHBE mice (provided by Biocytogen Jiangsu Gene Biotechnology Co., Ltd.) were placed in a breeding facility and administered the siRNA conjugate of this application subcutaneously at a single dose of 10 mg / kg (5 mice per group). Fourteen days after administration, the mice were euthanized, and two 30 mg portions of left lobe liver tissue were collected and rapidly frozen in liquid nitrogen. After being freeze-ground into tissue homogenates, tissue RNA was extracted, and the inhibition rate of the target gene mRNA was detected using the same method as in Example 12. The results are shown in Table 42.

[0908] Table 42 Inhibition rate of siRNA conjugates on INHBE mRNA

[0909]

[0910] The sequence of AC004285 is shown in Table 43.

[0911] Table 43

[0912]

[0913] The structure of (NAG37)s is as follows:

[0914]

[0915] As can be seen from Table 42, the siRNA conjugate of this application has high inhibitory activity against the hINHBE gene in vivo, and its inhibitory ability is better than that of the positive control AC004285.

[0916] Example 18: Silent effect of siRNA conjugates on mice expressing the human INHBE (hINHBE) gene

[0917] Using a method similar to that in Example 15, the in vivo inhibition rate (%) of the following test siRNA conjugates against the hINHBE mouse model was determined, and the results are shown in Table 44.

[0918] Table 44

[0919] siRNA ID D7 D14 D21 N-ER-FY046211M47L96-3mpk 46.39 28.87 35.20 N-ER-FY046212M47L96-3mpk 60.74 66.50 70.22 N-ER-FY046224M47L96-3mpk 82.94 88.31 90.51

[0920] As can be seen from Table 44, the siRNA conjugate of this application has high inhibitory activity against the hINHBE gene in vivo and can reduce the expression level of hINHBE for a long time.

[0921] The embodiments described above are merely examples for clearly illustrating the present disclosure and are not intended to limit the implementation of the present disclosure. Those skilled in the art can make other variations or modifications based on the above description. It is neither necessary nor possible to exhaustively describe all possible implementations. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this disclosure should be included within the scope of protection of the claims of this disclosure.

Claims

1. A double-stranded ribonucleic acid that inhibits expression of an INHBE gene, the double-stranded ribonucleic acid comprising a sense strand and an antisense strand that are reverse complemented and / or substantially reverse complemented to form a double-stranded region of the double-stranded ribonucleic acid; wherein the sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in a target sequence, the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complement of at least 15 consecutive nucleotides in the target sequence; the target sequence is selected from the group consisting of the nucleotide sequence set forth in any one of SEQ ID NOs: 1-6, 507-509, 610, 611 and a sequence comprising at least 15 consecutive nucleotides contained in any one of SEQ ID NOs: 1-6, 507-509, 610, 611.

2. The double-stranded ribonucleic acid of claim 1, wherein, the target sequence is selected from the group consisting of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611, the sense strand comprises a sequence A consisting of at least 15 consecutive nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611, and the antisense strand comprises a sequence B that is reverse complemented and / or substantially reverse complemented to a sequence consisting of at least 15 consecutive nucleotides of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611.

3. The double-stranded ribonucleic acid of claim 1 or 2, wherein, the sense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, more preferably 19, 20, 21 or 23 nucleotides.

4. The double-stranded ribonucleic acid of claim 3, wherein, the nucleotide sequence of the sense strand is a sequence A that differs by no more than 1 nucleotide from a sequence consisting of 15-28 consecutive nucleotides, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, more preferably 19, 20, 21 or 23 nucleotides, of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611.

5. The double-stranded ribonucleic acid of any of claims 1-4, wherein, the antisense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, more preferably 19, 21 or 23 nucleotides.

6. The double-stranded ribonucleic acid of claim 5, wherein, the nucleotide sequence of the antisense strand is a sequence B that differs by no more than 1 nucleotide from the reverse complement of a sequence consisting of 15-28 consecutive nucleotides, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides, of the nucleotide sequence set forth in any one of SEQ ID NOs: 7-24, 504-509, 610, 611.

7. The double-stranded ribonucleic acid of any of claims 1-6, wherein, the double-stranded region has a length of 15-25 nucleotides, preferably 19-23 nucleotides, more preferably 19, 20, 21 or 23 nucleotides.

8. The double-stranded ribonucleic acid of any one of claims 1-7, wherein, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, 9. The double-stranded ribonucleic acid of any of claims 1-8, wherein, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, 10. The double-stranded ribonucleic acid of any of claims 1-9, wherein, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, 11. The double-stranded ribonucleic acid of any of claims 1-10, wherein, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, 12. The double-stranded ribonucleic acid of any of claims 1-11, wherein, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, 13. The double-stranded ribonucleic acid of any of claims 1-12, wherein, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, 14. The double-stranded ribonucleic acid of any of claims 1-13, wherein, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, the 3' end of the sense strand has 1-3 overhanging nucleotides extending out of the double-stranded Optionally, the nucleotide sequence of the sense strand of the double-stranded RNAi agent comprises sequence A and sequence D, the 3' end of sequence A in the sense strand is linked to sequence D consisting of 1-3 nucleotides, preferably sequence D consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the antisense strand of the double-stranded RNAi agent comprises sequence B and sequence E, the 3' end of sequence B in the antisense strand is linked to sequence E consisting of 1-3 nucleotides, preferably sequence E consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the sense strand of the double-stranded RNAi agent comprises sequence A', the 3' end of sequence A in the sense strand is excluded 1-3 nucleotides to form the sequence A'; Optionally, the sense strand and the antisense strand of the double-stranded RNAi agent are selected from the following sequence combinations: the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked with sequence E; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A linked with sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A linked with sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked with sequence E; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; or, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B linked with sequence E.

16. The double-stranded ribonucleic acid modification of claim 15, wherein, the modification of the nucleotide is selected from 2'-fluoro modification, 2'-alkoxy modification, 2'-substituted alkoxy modification, 2'-alkyl modification, 2'-substituted alkyl modification, 2'-deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof; preferably, the modification of the nucleotide is selected from 2'-F modification, 2'-O-CH3 modification, 2'-O-CH2-CH2-O-CH3 modification, 2'-O-CH2-CH=CH2 modification, 2'-CH2-CH2-CH=CH2 modification, 2'-deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof.

17. The double-stranded ribonucleic acid modification of claim 15 or 16, wherein, the nucleotide derivative in the nucleotide derivative modification is selected from iso-nucleotide, LNA, ENA, cET, UNA, or GNA.

18. The double stranded ribonucleic acid modification of any one of claims 15-17, wherein, from the 7th, 9th, 10thand 11thpositions in the 5' end to the 3' end direction, the ribonucleotides in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 5, 7, 8, and 9 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 7, 9, 11, and 13 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 8, and 9 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; 19. The double stranded ribonucleic acid modification of any one of claims 15-18, wherein, or, along the 5' end to the 3' end direction, the ribose nucleotides at positions 3, 7, 9, and 11 in the sense strand are 2'-F modified ribose nucleotides, and the ribose nucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribose nucleotides; 20. The double stranded ribonucleic acid modification of any one of claims 15-19, wherein, neither the 5' end nor the 3' end of the sense strand is connected to an inverted abasic deoxyribose residue, or the 5' end or the 3' end nucleotide of the sense strand is connected to an inverted abasic deoxyribose residue, or the 5' end and the 3' end nucleotides of the sense strand are respectively connected to inverted abasic deoxyribose residues. along the 5' end to the 3' end direction, the sense strand comprises a phosphorothioate linkage at a position selected from: between the 1st and 2nd nucleotides from the 5' end of the sense strand; between the 2nd and 3rd nucleotides from the 5' end of the sense strand; between the 1st and 2nd nucleotides from the 3' end of the sense strand; between the 2nd and 3rd nucleotides from the 3' end of the sense strand; or, along the 5' end to the 3' end direction, the sense strand comprises a phosphorothioate linkage at a position selected from: between the 1st and 2nd nucleotides from the 5' end of the sense strand; between the 2nd and 3rd nucleotides from the 5' end of the sense strand; or, when the 3' terminal nucleotide of the sense strand is linked to an inverted deoxyabasic deoxyribose residue, the sense strand comprises phosphorothioate linkages at positions: between the 1st and 2nd nucleotides from the 5' terminus of the sense strand; and between the 2nd and 3rd nucleotides from the 5' terminus of the sense strand; and between the inverted deoxyabasic deoxyribose residue from the 5' terminus of the sense strand and the 1st nucleotide; when the 5' and 3' terminal nucleotides of the sense strand are linked to inverted deoxyabasic deoxyribose residues, the sense strand comprises phosphorothioate linkages at positions: between the inverted deoxyabasic deoxyribose residue from the 5' terminus of the sense strand and the 1st nucleotide; between the 1st and 2nd nucleotides from the 5' terminus of the sense strand; and between the inverted deoxyabasic deoxyribose residue from the 3' terminus of the sense strand and the 1st nucleotide.

21. The double stranded ribonucleic acid modification of any one of claims 15-20, wherein, in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense strand is a ribonucleotide derivatized with a GNA modification, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in the antisense strand is a ribonucleotide derivatized with a GNA modification, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; in the direction from the 5' terminus to the 3' terminus, the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; or, along the direction from the 5' end to the 3' end, the ribose nucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in the antisense strand are 2'-F modified ribose nucleotides, the ribose nucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribose nucleotide, and the ribose nucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribose nucleotides; or, along the direction from the 5' end to the 3' end, the ribose nucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in the antisense strand are 2'-F modified ribose nucleotides, the ribose nucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribose nucleotide, and the ribose nucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribose nucleotides; or, along the direction from the 5' end to the 3' end, the ribose nucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in the antisense strand are 2'-F modified ribose nucleotides, the ribose nucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribose nucleotide, and the ribose nucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribose nucleotides.

22. The double stranded ribonucleic acid modification of any one of claims 15-21, wherein, The 5' end nucleotide of the antisense strand is not linked with a 5' phosphate group or a 5' phosphate derivative group, or the 5' end nucleotide of the antisense strand is linked with a 5' phosphate group or a 5' phosphate derivative group.

23. The double stranded ribonucleic acid modification of any one of claims 15-22, wherein, The antisense strand comprises a phosphorothioate bond or a phosphorodithioate bond at the following positions: The antisense strand comprises a phosphorothioate bond or a phosphorodithioate bond at the following positions: between the 1st and 2nd nucleotides from the 5' end of the antisense strand; between the 2nd and 3rd nucleotides from the 5' end of the antisense strand; between the 1st and 2nd nucleotides from the 3' end of the antisense strand; between the 2nd and 3rd nucleotides from the 3' end of the antisense strand; or, The antisense strand comprises a phosphorothioate bond and a phosphorodithioate bond at the following positions: between the 1st and 2nd nucleotides from the 5' end of the antisense strand; between the 2nd and 3rd nucleotides from the 5' end of the antisense strand; between the 1st and 2nd nucleotides from the 3' end of the antisense strand.

24. The double stranded ribonucleic acid modification of any one of claims 15-23, wherein, The sense strand of the double-stranded ribonucleic acid modifier has the structure as set forth in any one of (a1)-(a 14 ) above: (a1) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (a2) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (a3) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (a4) 5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3' (a5) 5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3' (a6) 5'-mN1- (s) -mN2- (s) -mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 - N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3 ', (a7) 5'-mN1- (s) -mN2- (s) -mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 - N 11 f-mN 12 - N 13 f-mN 14 - mN 15 - mN 16 - mN 17 - mN 18 - mN 19 -3 ', (a8) 5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3 ', (a9) 5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 - N 11 f-mN 12 - N 13 - N 14 - N 15 - N 16 - N 17 - N 18 - N 19 -3', (a 10 )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-3', (a 11 )5'-(invAb)-(s)-mN1-(s)-mN2-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-(invAb)-3', (a 12 )5’-mN 19 -(s)-mN 18 -(s)-N 17 f-mN 16 -mN 15 -mN 14 -N 13 f-N 12 f-N 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3’ (a 13 )5’-mN 21 -(s)-mN 20 -(s)-mN 19 -mN 18 -N 17 f-mN 16 -mN 15 -mN 14 -N 13 f-N 12 f-N 11 f-mN 10 -mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3’ (a 14 )5'-mN 20 -(s)-mN 19 -(s)-mN 18 -mN 17 -N 16 f-mN 15 -mN 14 -mN 13 -N 12 f-N 11 f-N 10 f-mN9-mN8-mN7-mN6-mN5-mN4-mN3-mN2-mN1-(s)-(invAb)-3', wherein N1-N 23 are independently of each other selected from ribonucleotides having a base which is A, U, C or G, The capital letter T represents a deoxyribonucleotide with a base of thymine, the lower case letter m represents that the ribose nucleotide adjacent to the right of the letter m is a 2'-O-CH3 modified ribose nucleotide, the lower case letter f represents that the ribose nucleotide adjacent to the left of the letter f is a 2'-F modified ribose nucleotide, (invAb): represents an inverted dealkylated deoxyribose residue, -(s)- represents that the two nucleotides adjacent to the front and back are linked by a phosphorothioate bond, Optionally, the ribose group of the 5' end nucleotide of the sense strand has a 5' hydroxyl group.

25. The double stranded ribonucleic acid modification of any one of claims 15-24, wherein, The antisense strand of the double-stranded ribonucleic acid modification has a structure as set forth in any one of (b1)-(b 32 ) above: (b1)5’-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’, (b2) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3 ', (b3) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN10- 3' 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b4) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN10-N11f- 3 ', wherein 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3 ', (b5)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3', (b6) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 - mN 11 - mN 12 - mN 13 - N 14 f-mN 15 - N 16 f-mN 17 - mN 18 - mN 19 -(s)-mN 20 -(s)-mN 21 -3 ', (b7)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3', (b8)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3', (b9)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3', (b 10 ) 5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3 ', (b 11 )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 12 )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 13 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 14 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 15 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 16 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 17 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 18 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 19 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 20 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 21 ) 5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 22 )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 23 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 24 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 25 ) 5'-EVP mN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 26 ) 5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 27 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 28 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3' (b 29 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3', (b 30 ) 5'-EVP mN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN 20 -mN 21 -mN 31 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -(s)-mN 17 -(s)-mN 18 -3' (b 31 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3' (b 32 )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -(ss)-mN 21 -3' wherein N1-N 23 are independently of each other selected from ribonucleotides having a base which is A, U, C or G, The capital letter T represents a deoxyribonucleotide with a base of thymine, the lower case letter m represents that the ribose nucleotide adjacent to the right of the letter m is a 2'-O-CH3 modified ribose nucleotide, lowercase letter f means the ribose nucleotide adjacent to the left of the letter f is a 2'-F modified ribose nucleotide, P1 means the nucleotide adjacent to the right of the letter is a 5'-phosphate nucleotide, EVP means the nucleotide adjacent to the right of the letter combination is a 5'-trans-vinyl phosphonate nucleotide, -(s)- means the two nucleotides adjacent to the front and back are connected by a phosphorothioate bond, -(ss)- means the two nucleotides adjacent to the front and back are connected by a phosphorodithioate bond, [GNA] means the ribose nucleotide adjacent to the right of the letter is a GNA modified ribose nucleotide, Optionally, the 5' terminal nucleotide of the antisense strand is not bearing P1 or EVP, which means the ribose group of the nucleotide has 5' hydroxyl.

26. The double stranded ribonucleic acid modification of any one of claims 15-25, wherein, the sense strand and the antisense strand are selected from the following combinations: the sense strand comprises the sense strand of any one of the double-stranded ribonucleic acid modifications shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding double-stranded ribonucleic acid modification; Preferably, the sense strand and the antisense strand are selected from the following combinations: the sense strand comprises the sense strand of any one of siRNA 414, siRNA 436-siRNA 440, siRNA 449, siRNA 472, siRNA 488-siRNA 489 shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.

27. A double-stranded ribonucleic acid modification, which comprises the modification that the 3' terminal end of the sense strand of the double-stranded ribonucleic acid modification of any one of claims 15-26 is modified to be a blunt end, optionally by excluding the overhanging nucleotide of the 3' end of the double-stranded ribonucleic acid modification sense strand of any one of claims 15-26 extending out of the double-stranded region.

28. A double-stranded ribonucleic acid conjugate, wherein, the double-stranded ribonucleic acid conjugate comprises the double-stranded ribonucleic acid of any one of claims 1-14, or the double-stranded ribonucleic acid modification of any one of claims 15-27; and, a conjugate group conjugated to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modification.

29. The double-stranded ribonucleic acid conjugate of claim 28, wherein, the conjugate group has the structure of any one of the following:

30. The double-stranded ribonucleic acid conjugate of claim 28 or 29, wherein, the conjugate group is conjugated to the 3' terminal end of the sense strand.

31. The double-stranded ribonucleic acid conjugate of any of claims 28-30, wherein, the conjugate group is conjugated to the 3' terminal end of the sense strand by a phosphodiester bond or a phosphorothioate bond; Preferably, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3' terminal end of the sense strand forms a blunt end, and the 3' terminal end of the antisense strand has 1-3 overhanging nucleotides extending out of the double-stranded region. or, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3' terminal end of the sense strand forms a blunt end, and the 3' terminal end of the antisense strand forms a blunt end.

32. The double-stranded ribonucleic acid conjugate of any one of claims 28-31, wherein, the double-stranded ribonucleic acid conjugate has the structure of the following: wherein the double helix structure is a double-stranded ribonucleic acid or a double-stranded ribonucleic acid modification.

33. The double-stranded ribonucleic acid conjugate of any one of claims 28-32, wherein, the double-stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting the expression of INHBE gene.

34. The double-stranded ribonucleic acid conjugate of any one of claims 28-33, wherein, The double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNAs shown in Table 1 and Table 1-1 herein with a conjugate group, or the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNA modifiers shown in Table 2 herein with a conjugate group; Preferably, the double-stranded ribonucleic acid conjugate, wherein the sense strand and the antisense strand are selected from the following combinations: The sense strand comprises the sense strand of any one of the siRNA conjugates shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate; More preferably, the sense strand and the antisense strand are selected from the following combinations: The sense strand comprises the sense strand of any one of siRNA 417, siRNA 451-siRNA 455, siRNA 464, siRNA 476, siRNA 490-siRNA 491 shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.

35. A prodrug of the double-stranded ribonucleic acid of any one of claims 1-14, the double-stranded ribonucleic acid modifier of any one of claims 15-27, or the double-stranded ribonucleic acid conjugate of any one of claims 28-34.

36. A pharmaceutical composition, wherein, The pharmaceutical composition comprises at least one of the following: the double-stranded ribonucleic acid of any one of claims 1-14, the double-stranded ribonucleic acid modifier of any one of claims 15-27, the double-stranded ribonucleic acid conjugate of any one of claims 28-34, or the prodrug of claim 35.

37. The pharmaceutical composition of claim 36, wherein, The pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, and optionally further comprises one or more additional therapeutic agents.

38. Use of the double-stranded ribonucleic acid of any one of claims 1-14, the double-stranded ribonucleic acid modifier of any one of claims 15-27, the double-stranded ribonucleic acid conjugate of any one of claims 28-34, the prodrug of claim 35, or the pharmaceutical composition of claim 36 or 37 in at least one of the following: (1) inhibiting INHBE gene expression in vivo or in vitro, or preparing a medicament for inhibiting INHBE gene expression; (2) for preventing or treating a disease associated with abnormal expression of INHBE gene, or preparing a medicament for preventing or treating a disease associated with abnormal expression of INHBE gene; (3) for treating a subject suffering from a disease that would benefit from a reduction in INHBE gene expression, or preparing a medicament for treating a subject suffering from a disease that would benefit from a reduction in INHBE gene expression.

39. The use of claim 38, wherein, The disease associated with abnormal expression of INHBE gene is selected from the group consisting of: obesity (such as abdominal obesity), non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic steatohepatitis, liver cirrhosis, liver fibrosis, elevated liver enzyme levels (ALT, AST, ALP), hepatocellular carcinoma, hypercholesterolemia and related cardiovascular diseases (such as coronary heart disease), insulin resistance, impaired glucose tolerance, hyperglycemia, type II diabetes, and metabolic syndrome.

40. A method for inhibiting expression of an INHBE gene in a cell in vivo or in vitro, wherein, The method comprises contacting the cell with the double-stranded ribonucleic acid according to any one of claims 1-14, the double-stranded ribonucleic acid modification according to any one of claims 15-27, the double-stranded ribonucleic acid conjugate according to any one of claims 28-34, the prodrug according to claim 35, or the pharmaceutical composition according to claim 36 or 37. The prodrug according to claim 35 or the pharmaceutical composition according to claim 36 or 37 is contacted.

41. The method of claim 40, wherein, The cell is an in vivo cell or an in vitro cell.

42. The method of claim 40 or 41, wherein, The cell is in a subject; Preferably, the subject is a mammal, more preferably a human; Preferably, the subject has at least one of the following characteristics: Abnormal expression of the INHBE gene in vivo, more specifically abnormal high expression of the INHBE gene; Suffering from a disease associated with abnormal expression of the INHBE gene; Suffering from a disease that would benefit from a reduction in the expression of the INHBE gene.

43. The double-stranded ribonucleic acid according to any one of claims 1-14, the double-stranded ribonucleic acid modification according to any one of claims 15-27, the double-stranded ribonucleic acid conjugate according to any one of claims 28-34, the prodrug according to claim 35, or the pharmaceutical composition according to claim 36 or 37 for use in therapy.

Images