Application of tRF-GLU-TTC-3 expression inhibitor in medicine for inhibiting oxidative stress of ovarian granular cells
By inhibiting the expression of tRF-GLU-TTC-3 and increasing the expression of SLC25A17, the problem of oxidative stress in ovarian granulosa cells was resolved, promoting follicle development and improving oocyte quality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-03-13
AI Technical Summary
Oxidative stress in ovarian granulosa cells can affect follicular atresia and oocyte quality, and current technologies lack effective means of regulation.
By inhibiting the expression of tRF-GLU-TTC-3 and using RNA interference technology, the expression level of SLC25A17 was increased, thereby reducing the occurrence of oxidative stress.
It effectively inhibited oxidative stress in ovarian granulosa cells, promoted follicle development, and improved oocyte quality and fertilization capacity.
Smart Images

Figure CN121648150A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of tRF-GLU-TTC-3 expression inhibitors in drugs that inhibit oxidative stress in ovarian granulosa cells. Background Technology
[0002] As an important somatic cell component of the ovary, ovarian granulosa cells play an irreplaceable role in maintaining normal ovarian physiological function. They not only participate in follicle development, maturation, and ovulation, but also undertake the synthesis and secretion of steroid hormones, significantly contributing to the homeostasis of the female reproductive endocrine system. Granulosa cells also play a crucial defensive role in the construction of the ovarian immune defense network, resisting the invasion of pathogenic microorganisms.
[0003] Ovarian granulosa cells, originating from the primordial follicle stage, accompany the development, maturation, and ovulation of the follicle. Based on their location within the follicle and their biological function, they are classified into two types: cumulus granulosa cells and parietal granulosa cells. Cumulus granulosa cells form the pseudostratified epithelial structure surrounding the oocyte, primarily supporting oocyte development. Since the oocyte's ability to utilize glucose is limited, it receives most of its nutrition from the cumulus granulosa cells. Parietal granulosa cells, located in the inner layer of the follicle wall, form a pseudostratified epithelial structure in contact with the basement membrane and adjacent to the outer membrane. As receptors for hormone stimulation, they gradually transform into part of the corpus luteum after ovulation, participating in subsequent hormonal regulation. The close connection between the oocyte and granulosa cells not only compensates for the oocyte's limited ability to absorb small metabolites but also provides the necessary nutrients for oocyte growth. Granulosa cells precisely regulate the metabolic activities of the developing oocyte by controlling the synthesis rate and phosphorylation modification pattern of key proteins. Granulosa cell apoptosis is highly correlated with follicular atresia. In dominant follicles, granulosa cells act as estrogen receptors, maintaining follicular development through multiple mechanisms, including estradiol secretion, gap junction communication, and peroxide scavenging. Therefore, analyzing the abundance of non-apoptotic granulosa cells in sow ovaries can assess the reproductive performance of the breed, and selective breeding targeting ovarian granulosa cells can improve production performance.
[0004] Granulosa cells play an important role in follicular atresia, oocytes acquiring fertilization capacity, embryogenesis regulation, and follicular microenvironment regulation. (1) Granulosa cells participate in the regulation of the entire process of meiotic maturation of follicles. The pre-ovulatory surge of luteinizing hormone (LH) induces meiotic maturation in vivo, but oocytes lack LH receptors, while parietal granulosa cells are receptors for secreting hormones. Therefore, the induced maturation process of follicles is mediated by granulosa cells. Subsequently, granulosa cells induce fully developed oocytes to complete the first meiotic division and arrest again in metaphase II. The meiotic inhibition effect may be due to the transmission of oocyte maturation inhibitory factors from granulosa cells that make up the follicle wall to the oocyte through gap junctions. Subsequently, the cumulus granulosa cells surrounding the germ cells undergo expansion or mucinization, inducing cytoplasmic maturation. Mature cytoplasm includes the deposition of extracellular matrix rich in hyaluronic acid, leading to granulosa cell expansion and separation. The loss of gap junctions caused by the expansion and separation of these cells leads to a reduction in the amount of meiotic inhibitory substances transmitted to the oocytes. However, the stimulation of granulosa cells by gonadotropins may induce the generation of maturation signals, thereby overcoming the meiotic inhibition mechanism of follicles. Finally, the nuclear-matured oocytes are released from meiotic arrest, while metaphase II oocytes are still surrounded by expanded cumulus granulosa cells and are released into the fallopian tube in preparation for fertilization. (2) Granulosa cells participate in the regulation of biological processes such as follicular atresia, follicle development, oocytes acquiring fertilization capacity, and embryogenesis. Gonadotropin-releasing hormone (GnRH) secreted by the hypothalamus regulates the secretion of gonadotropins (FSH) and luteinizing hormone (LH) by activating the hypothalamus-pituitary-ovarian axis. It is noteworthy that during follicular atresia, granulosa cells initiate the apoptosis program earlier than oocytes and theca cells. This time difference suggests that granulosa cells may be the initiating cell type that triggers follicular atresia. The specific mechanism is reflected in the negative feedback effect of the ovary: the androgens produced by the membrane cells are used by the granulosa cells as raw materials for the synthesis of estradiol, while the granulosa cells themselves produce inhibin. Estradiol and inhibin inhibit FSH secretion by synergistically regulating the hypothalamus-pituitary-ovarian axis, thereby hindering the growth and development of secondary follicles. The pleiotropic factors secreted by the granulosa cells (such as gonadotropins, growth factors and cytokines) constitute the local microenvironment, which maintains their own survival and promotes follicle growth. During the selection of dominant follicles, the granulosa cells acquire functional LH receptor expression, and their increased dependence on LH signaling promotes the continuous development of follicles, and finally completes the physiological process of ovulation under the trigger of LH peak. In addition, co-culturing mature oocytes with additional cumulus or parietal granulosa cells can improve the developmental potential of oocytes in many species. This may be because the cumulus granulosa cells and parietal granulosa cells produce specific substances that enable oocytes to acquire the ability to fertilize and develop embryos, but the specific mechanism needs further verification. (3) As the helper cells of oocytes, the functions of cumulus granulosa cells include delivering metabolic substrates and nutrients required for oocyte maturation.The proliferation and differentiation process of this cell population is highly synchronized with the maturation of oocytes, and the two form a functional community through metabolic coupling. However, the oocytes themselves have limited glucose metabolism capacity, and their energy demand mainly depends on the supply of pyruvate produced by the mitochondria of cumulus cells. This transcellular energy transfer mechanism is of great significance for oocytes to acquire maturation capacity. Granulosa cells metabolize glucose captured in the follicular microenvironment through glycolysis and provide pyruvate produced by glycolysis to oocytes through gap junctions. In addition, during follicular growth, cumulus cells produce ATP and increase the supply of ATP to oocytes. Through gap junction communication, they provide key metabolites and energy to developing oocytes, including molecules such as cAMP and ions such as chloride, calcium and sodium. These substances are transferred to oocytes to ensure the acquisition of the molecular mechanisms required to support early embryonic development, thereby helping oocyte development. (4) Because oocytes have insufficient glucose metabolism capacity, they are highly dependent on mitochondrial oxidative phosphorylation (OXPHOS) to obtain energy. Mitochondrial ATP is the primary energy source for FSH-dependent granulosa cell proliferation and differentiation during follicular development, produced through mitochondrial oxidative phosphorylation in the electron transport chain (ETC) complex. During FSH-induced follicular development, the production of reactive oxygen species (ROS) increases significantly due to increased mt-OXPHOS. ROS are an unavoidable natural byproduct of mt-OXPHOS; excessive ROS induces oxidative damage to mtDNA, oxidation of specific amino acids, and lipid peroxidation, reducing granulosa-oocyte communication that affects pre-ovulatory oocyte quality, ultimately inducing apoptosis and cell death. Oocytes themselves lack the capacity to mobilize all necessary antioxidant defense mechanisms; this protection is provided by surrounding granulosa cells, whose metabolites glutathione and melatonin are particularly important during this maturation stage. Furthermore, during glucose metabolism in granulosa cells, reduced nicotinamide adenine dinucleotide phosphate (NADPH) is produced for biosynthesis via the pentose phosphate pathway, contributing to the oocyte's redox balance.
[0005] Female mammals determine their reserve of primordial follicles during embryonic development. Upon reaching puberty, these primordial follicles gradually evolve into antral follicles, eventually maturing and being released from the body. This process is a result of competition among primordial follicles; 99% of follicles undergo atresia and fail to mature. Follicles primarily contain two cell types: granulosa cells and oocytes. Granulosa cells supply energy to oocytes, regulate reactive oxygen species levels within the follicular microenvironment, and establish intercellular functions. Granulosa cell apoptosis and oxidative stress may influence the occurrence of follicular atresia. Currently, novel epigenetic regulatory factors (tRFs) have been shown to participate in the regulation of various biological processes, but research on tRFs in ovarian granulosa cells is still scarce. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides the application of an inhibitor of tRF-GLU-TTC-3 expression in drugs that inhibit oxidative stress in ovarian granulosa cells.
[0007] The application of an inhibitor of tRF-GLU-TTC-3 expression in drugs that inhibit oxidative stress in ovarian granulosa cells, wherein the sequence of tRF-GLU-TTC-3 is TCCCATATGGTCTAGCGGTTAGGATTCCTGG, denoted as SEQ ID NO.1.
[0008] This invention discovered that overexpression of tRF-GLU-TTC-3 induces oxidative stress in ovarian granulosa cells, and tRF-GLU-TTC-3 and SLC25A17 There is a target relationship between them. SLC25A17 Decreased gene levels can lead to oxidative stress in granulocytes, which can be rescued by inhibiting tRF-GLU-TTC-3. SLC25A17 Decreased expression levels lead to oxidative stress in granulocytes.
[0009] Preferably, the expression inhibitor comprises an agent used in RNA interference technology.
[0010] Preferably, the formulation is an inhibitor of tRF-GLU-TTC-3, the sequence of which is shown in SEQ ID NO.2.
[0011] Preferably, the step of inhibiting tRF-GLU-TTC-3 expression includes: introducing the sequence shown in SEQ ID NO.2 into granulocytes.
[0012] Preferably, the dosage form of the drug is either an oral dosage form or an injectable dosage form.
[0013] Preferably, the drug further comprises pharmaceutically acceptable excipients or carriers.
[0014] Preferably, the expression inhibitor shown is used to prepare a drug that promotes follicle development.
[0015] Preferably, the oxidative stress includes SLC25A17 Oxidative stress caused by changes in gene expression levels.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention discovered that overexpression of tRF-GLU-TTC-3 induces oxidative stress in ovarian granulosa cells, and tRF-GLU-TTC-3 and SLC25A17 There is a target relationship between them. SLC25A17Decreased gene levels can lead to oxidative stress in granulocytes, which can be rescued by inhibiting tRF-GLU-TTC-3. SLC25A17 Decreased expression levels lead to oxidative stress in granulocytes. Attached Figure Description
[0017] Figure 1 Poly(i:c) stimulates the innate immune response in follicles and induces follicular atresia. (A) qRT-PCR detection of the expression level of the innate immune response activation maker gene after follicles treated with different concentrations of Poly(i:c) P <0.05); (B) ELISA detection of differences in inflammatory factor expression in Poly(i:c) treated follicles and control group; (C) Phenotypic differences in follicles between Poly(i:c) treated group and control group.
[0018] Figure 2 The following data are presented: (A) PCA analysis of follicles from Poly(i:c) treatment group and control group; (B) Cluster heatmap of differentially expressed genes from transcriptome sequencing data; (C) Volcano plot of differentially expressed genes from transcriptome sequencing data.
[0019] Figure 3 The transcriptome sequencing differential gene GO and KEGG functional enrichment analysis are shown. (A) Transcriptome sequencing differential gene GO functional enrichment analysis; (B) Transcriptome sequencing data differential gene KEGG enrichment analysis.
[0020] Figure 4 The analysis showed the functional enrichment of the differentially expressed RNA gene GSEA, which is used to identify (A) B cell receptor signaling pathway; (B) T cell receptor signaling pathway; (C) primary immune response process; and (D) intercellular communication.
[0021] Figure 5 The results showed that Poly(i:c) induced ovarian innate immunity. (A) qRT-PCR quantified the effects of 5 μg / mL Poly(i:c) treatment and the control group. TLR3 (B) qRT-PCR quantification of differential gene expression in the 5 μg / mL Poly(i:c) treatment group and the control group RIG-1 Differential gene expression; (C) qRT-PCR quantification of 5 μg / mL Poly(i:c) treatment group and control group MDA5 Differential gene expression; (D) Western blotting detection of 5 μg / mL Poly(i:c) treatment group and control group TLR3 , MDA5 Differential protein expression.
[0022] Figure 6 The following data are displayed: (A) tsRNA types in the Poly(i:c) treatment group and the control group; (B) tsRNA length characteristics in the Poly(i:c) treatment group and the control group; (C) tsRNA source statistics in the Poly(i:c) treatment group and the control group; (D) TOP15 tsRNA abundance statistics in the Poly(i:c) treatment group and the control group.
[0023] Figure 7 The source of tsRNA in the Poly(i:c) treatment group and the control group is shown in (A). The source of tsRNA in the Poly(i:c) treatment group and the control group is statistically analyzed by specific tRNA (A) and tRNA corresponding to amino acid classification (B).
[0024] Figure 8 The results show that Poly(i:c) induces oxidative stress in granulosa cells. (A) ROS and mitotraker fluorescence staining were used to observe the reactive oxygen species content and mitochondrial damage in the 5 μg / mL Poly(i:c) treatment group and the control group, respectively, and the fluorescence quantification statistics were plotted. (B) qRT-PCR was used to detect the levels of reactive oxygen species and mitochondrial damage in the 5 μg / mL Poly(i:c) treatment group and the control group. CAT , SOD1 Gene expression level ( P <0.05); (C) Western blotting of 5 μg / mL Poly(i:c) treatment group and control group CAT , SOD1 Protein expression level ( P <0.05).
[0025] Figure 9 The results show the trend of tsRNA in mouse granulosa cells detected by qRT-PCR with 5 μg / mL Poly(i:c) treatment, and the trend of tsRNA in mouse granulosa cells with 5 μg / mL Poly(i:c) treatment with sequencing results is consistent with that detected by (AF)qRT-PCR.
[0026] Figure 10 The following are examples of GO and KEGG enrichment analyses of downstream target genes of tRF-1:31-Glu-TTC-3: (A) GO enrichment analysis of downstream target genes of tRF-1:31-Glu-TTC-3; (B) KEGG enrichment analysis of downstream target genes of tRF-1:31-Glu-TTC-3.
[0027] Figure 11The expression of tRF-GLU-TTC-3 induced oxidative stress in mouse granulosa cells. (A) ROS and mitotraker fluorescence staining in 5 μg / mL Poly(i:c) treatment and control group; (B) qRT-PCR detection of 5 μg / mL Poly(i:c) treatment and control group. CAT , SOD1 Changes in gene expression levels (P<0.05); (C) Western blotting of 5 μg / mL Poly(i:c) treatment and control group CAT , SOD1 Changes in protein expression levels (P<0.05).
[0028] Figure 12 Display tRF-GLU-TTC-3 and SLC25A17 Target relationship verification, (A) qRT-PCR verification of Poly(i:c) treatment and overexpression or inhibition of tRF-GLU-TTC-3 SLC25A17 Changes in gene expression levels (P<0.05). (B) DAVID online prediction of tRF-GLU-TTC-3 and SLC25A17 The target relationship. (C) Dual-luciferase activity assay to verify tRF-GLU-TTC-3 and SLC25A17 The target relationship between them.
[0029] Figure 13 show SLC25A17 Downregulation of expression induced oxidative stress in granulosa cells. (A) ROS staining statistical analysis of the control group. SLC25A17 The knockdown group and the si-SLC25A17+tRF-GLU-TTC-3 inhibitor group showed low levels of reactive oxygen species. (B) qRT-PCR results showed that the antioxidant maker gene was present in all three treatment groups. CAT , SOD1 The gene expression level (P<0.05).
[0030] Figure 14 This is the structure of Poly(i:c). Detailed Implementation
[0031] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.
[0032] Test methods 1. Collect pig ovaries and separate follicles. After thorough rinsing with pre-warmed physiological saline at 38±1℃ to remove blood contamination, porcine ovaries were immediately transferred to 1×PBS preservation medium containing 1% penicillin and streptomycin antibiotics and stored in an incubator pre-temperatured to 38.6℃ to maintain physiological temperature conditions before transport to the laboratory. Ovarian specimens were first rinsed twice with sterile 1×PBS buffer, followed by surface disinfection with 75% ethanol (analytical grade) for 15 seconds, and then rinsed a second time with 1×PBS buffer. The ovarian cortex was then incised with a sterile scalpel, and the cortical tissue was carefully torn apart using ophthalmic forceps. Follicle separation was performed using fine forceps. Specifically, the connective tissue surrounding the follicle was completely dissected, and the follicle was gently agitated along the base of the medulla to ensure complete detachment from the ovarian matrix. The separated follicles were washed twice with DME / F12 culture medium containing 1% penicillin and streptomycin antibiotics and then transferred to pre-sterilized cell culture dishes. The culture system used DME / F12 complete culture medium containing 1% penicillin and streptomycin, and the culture conditions were set at a constant temperature of 37℃ and a cell culture incubator with a concentration of 5% CO2 for in vitro culture.
[0033] 2. Preparation of transcriptome sequencing samples After connective tissue removal, follicles were transferred to a sterile operating table, and residual culture medium on the follicle surface was thoroughly absorbed using sterile filter paper. A single wash was performed using PBS buffer containing 1% penicillin and streptomycin, followed immediately by a second absorption using sterile filter paper to ensure no liquid residue remained on the sample surface. The dried follicles were then rapidly transferred to liquid nitrogen for ultra-low temperature freezing. Once all samples were collected, the cryovials were transferred to a -80°C cryogenic storage chamber for long-term storage; the chamber temperature was monitored in real-time using an electronic monitoring system. Three control samples and three Poly(i:c) treated samples were ultimately selected for transcriptome analysis.
[0034] 3. Follicle sample processing Follicles were gently inserted into 6-well cell culture plates using ophthalmic forceps, and 5 mL of F12 serum-free medium was added to each well. For the control group, 5 μL of ultrapure water was added per milliliter. In the 2 μg / mL, 5 μg / mL, and 10 μg / mL treatment groups, 10 μL, 25 μL, and 50 μL of Poly(i:c) solution, pre-diluted with ultrapure water to 1 mg / mL, were added to each well, respectively. After addition, the mixture was gently shaken to mix, and then incubated at 37°C in a 5% CO2 incubator for 24 hours.
[0035] 4. Degree of follicular atresia assessment Freshly collected follicle samples were blotted with sterile filter paper to remove any residual PBS solution containing 1% penicillin and streptomycin. The follicle diameter was then precisely measured using calipers, and samples of 4-5 mm were selected for subsequent testing. After pretreatment, follicles were classified according to their morphological characteristics: healthy follicles appeared pink with a clear vascular network and good translucency; early atretic follicles appeared pale pink with a few visible vascular structures but significantly reduced translucency; late atretic follicles appeared milky white to pale yellow with no vascular structures on the surface and obvious internal turbidity. The judgment criteria are shown in Table 3.
[0036] Table 3: Criteria for Judging the Degree of Follicular Atresia 5. Resuscitation and Culture of Mouse Granulosa Cell Lines (1) Quickly remove the frozen MGC mouse granulocytes from the liquid nitrogen tank and place them in a 37°C constant temperature water bath to stir and thaw.
[0037] (2) Quickly place the cryopreservation tube in a clean bench, use a pipette to aspirate the cryopreservation solution into a 15mL centrifuge tube, add 1mL of complete culture medium containing 10% fetal bovine serum, and centrifuge at 1500rpm for 3min.
[0038] (3) After centrifugation, observe whether there is cell precipitation. If so, discard the supernatant, add 5 mL of complete culture medium containing 10% fetal bovine serum, gently pipette the cells to form a cell suspension, and finally inoculate them into T25 cell culture flasks. Place the culture flasks in a constant temperature incubator with 5% carbon dioxide and 37°C for culture. Observe the cell morphology after 24 hours and passage the cells.
[0039] 6. Cell passage (1) Pre-place trypsin, complete culture medium containing 10% fetal bovine serum and phosphate buffer (PBS) in a 37°C water bath to ensure that the reagents reach the optimal reaction temperature.
[0040] (2) Remove the cell culture flask to be passaged from the incubator, remove the original culture medium, and add pre-warmed PBS for a single wash to remove residual serum.
[0041] (3) Add 1 mL of pre-warmed trypsin digestion solution and immediately put the culture container back into the incubator for 1 minute of enzymatic digestion.
[0042] (4) Take out the cell culture flask and add 3 mL of complete culture medium containing 10% fetal bovine serum to terminate the enzymatic digestion process.
[0043] (5) Transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 1200 rpm for 3 minutes, discard the supernatant, add 10 mL of complete culture medium, resuspend the cells, and evenly distribute them into two T25 culture flasks. (6) Place the culture flask in a 5% CO2, 37℃ incubator for incubation.
[0044] 7. Cell transfection (1) Mouse granule cells were seeded into cell culture plates and transfected when the cell density reached 70%.
[0045] (2) Prepare transfection solution A: Take 3 μL / 0.3 μL Lipofectamine TM Add 3000 to 50 μL / 5 μL of Opti-MEM (corresponding to 12-well plate / 96-well plate), gently pipette to mix well, and incubate at room temperature for 5 min.
[0046] (3) Prepare transfection solution B: Take 50 μL / 5 μL minics (inhibitor is 100 μL / 10 μL) and add it to 50 μL / 5 μL Opti-MEM, mix well by pipetting, and incubate at room temperature for 5 min.
[0047] (4) Mix solution A and solution B, blow them evenly, and incubate at room temperature for 15 minutes.
[0048] (5) Add the incubated transfection solution to the cell culture plate, place it in a 5% carbon dioxide incubator at 37°C, and replace with fresh complete culture medium after 6 hours of culture.
[0049] 8. Collection of cell and tissue samples and extraction of RNA (1) After washing with phosphate-buffered saline (PBS), add 1 mL of TRIzol reagent to the cell culture wells and lyse at room temperature for 2 minutes. Ensure complete cell lysis by repeatedly pipetting, and then transfer the lysate to a 1.5 mL enzyme-free centrifuge tube.
[0050] (2) Weigh an appropriate amount of follicular tissue sample and place it in a 1.5 mL enzyme-free centrifuge tube. After cutting the tissue into small pieces with sterile surgical scissors, add 1 mL of TRIzol reagent and let it stand at room temperature for 5 minutes to ensure that the tissue is fully lysed.
[0051] (3) Initial centrifugation: Centrifuge at 12000 rpm for 5 minutes at 4℃, and carefully transfer the upper aqueous phase to a new 1.5 mL enzyme-free centrifuge tube.
[0052] (4) Chloroform extraction: Add 200 μL of chloroform, shake vigorously for 15 seconds to mix thoroughly, and let stand at room temperature for 5 minutes.
[0053] (5) Second centrifugation: Centrifuge at 12,000 rpm for 15 minutes at 4°C, and transfer the upper aqueous phase to a new centrifuge tube.
[0054] (6) RNA precipitation: Add an equal volume of isopropanol, gently invert to mix, and let stand at room temperature for 10 minutes.
[0055] (7) Precipitation collection: Centrifuge at 12,000 rpm for 10 minutes at 4°C and carefully discard the supernatant.
[0056] (8) Washing steps: Add 1 mL of pre-cooled 75% ethanol and gently invert to suspend the white RNA precipitate.
[0057] (9) Final centrifugation: Centrifuge at 12,000 rpm for 5 minutes at 4°C and discard the supernatant.
[0058] (10) Dissolution and preservation: Dry at room temperature for 2-5 minutes until the ethanol is completely evaporated, add 30-50 μL of enzyme-free water to dissolve the RNA, mix well, and then aliquot and store in an ultra-low temperature freezer at -80℃.
[0059] 9. mRNA reverse transcription The steps for mRNA reversal are shown in Table 4: Table 4: mRNA Reversal Components and Procedures 10. tRFs reverse transcription Table 5: Reversal components and steps of tRFs 11. qRT-PCR (1) The qRT-PCR reaction solution was prepared using a reverse PCR kit for mRNA and miRNA. The kit was manufactured by Takara. The primers were the universal upstream and downstream primers provided in the kit. The reaction solution was added to the qRT-PCR plate, and three technical replicates were set up for each sample. See Tables 6 and 7.
[0060] Table 6: mRNA qRT-PCR reaction steps and system Table 7: tRFs qRT-PCR reaction steps and system (2) Place the quantification plate in the groove inside the quantification machine, close the machine lid, and set the amplification program: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 5 s, optimal mRNA annealing temperature for 30 s, and 40 cycles at 72℃. The relative gene expression levels were calculated using the 2-ΔΔCt method. The quantification results for mRNA were corrected using ACTB as an internal reference, and the quantification results for tRFs were corrected using U6 as an internal reference. See Table 8:
[0061] Table 8: mRNA primer sequences 12. Protein content detection (1) Take 0.8 mL of protein standard preparation solution and add it to a protein standard tube containing 20 mg BSA. After dissolving completely, prepare a protein standard stock solution of 25 mg / mL.
[0062] (2) Transfer 20 μL of the stock solution and mix it with 980 μL of PBS buffer to dilute and prepare a protein standard working solution with a concentration of 0.5 mg / mL.
[0063] (3) Based on the number of samples to be tested, mix BCA reagent A solution and B solution at a volume ratio of 50:1 to prepare an appropriate amount of BCA working solution. After thorough mixing, it is ready for use.
[0064] (4) Add 0, 1, 2, 4, 8, 12, 16 and 20 μL of protein standard working solution to the standard wells of the 96-well plate in sequence, and dilute to 20 μL with standard diluent to form a concentration gradient.
[0065] (5) Transfer 1 μL of the sample to be tested into the sample well of the 96-well plate and add PBS buffer to make up the volume to 20 μL.
[0066] (6) Add 200 μL of BCA working solution to all standard wells and sample wells, seal and incubate at 60°C for 30 minutes.
[0067] (7) Use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance of each well at a wavelength of 562 nm.
[0068] (8) Plot a standard curve based on the absorbance values of the standard wells, and calculate the original protein concentration of the sample by combining the absorbance values of the sample wells and the dilution factor through a linear regression equation.
[0069] 13. Western blotting (1) Protein extraction and quantification: Total protein was extracted from cells using RIPA cell lysis buffer (Beyotime, Shanghai, China) and quantified using BCA protein concentration assay kit (Beyotime, Shanghai, China).
[0070] (2) Gel preparation and electrophoresis: Polyacrylamide gels of the required concentration were prepared using an SDS-PAGE rapid gel preparation kit. Three-color pre-stained protein markers were added to both lanes of the gel, and approximately 20 μg of protein was loaded into the middle lane. Electrophoresis was first performed at a constant voltage of 80 V until the bromophenol blue indicator entered the separating gel. Then the voltage was adjusted to 120 V and electrophoresis was continued until the proteins were fully separated.
[0071] (3) Wet electrotransfer: The separated protein was transferred to a polyvinylidene fluoride (PVDF) membrane (ThermoScientific, Madison, WI, USA) using wet electrotransfer technology.
[0072] (4) Membrane blocking and washing: The PVDF membrane was immersed in TBST blocking solution containing 5% skim milk and blocked at room temperature for 2 hours. After blocking, the membrane was washed 5 times with TBST buffer, each time for 5 minutes.
[0073] (5) Antibody incubation and color development: The washed PVDF membrane was incubated overnight with the primary antibody at 4°C, followed by washing three times with TBST buffer for 10 minutes each time. After washing, the membrane was incubated with the secondary antibody at room temperature for 1 hour, followed by washing four more times with TBST buffer for 5 minutes each time. Finally, the color reaction was performed using a high-sensitivity ECL chemiluminescence kit (ThermoScientific, Madison, WI, USA).
[0074] (6) Image acquisition and analysis: Exposure and image acquisition were performed using the Tanon 5200 chemiluminescence imaging analysis system (Tanon, Shanghai, China).
[0075] 14. Dual-luciferase reporter assay (1) The recombinant plasmid (Qingke, Beijing, China), tRFs / microRNA mimics and vector were co-transfected into cells.
[0076] (2) After 36 hours, cells were collected, PLB lysis buffer was added to lyse the cells, centrifuged at 12000 rpm for 5 min, and the supernatant was taken for analysis.
[0077] (3) Add 20 μL of the supernatant sample to be tested to each well of the ELISA plate.
[0078] (4) Add 100 μL of firefly reagent to each well and measure the chemiluminescence value.
[0079] (5) Add 100 μL of Renshin reagent to each well and measure the chemiluminescence value.
[0080] (6) Relative luciferase activity was determined by normalization of luciferase activity.
[0081] 15. ROS staining The probe was diluted 1:1000 with serum-free medium and added to a cell culture plate. The cell plate was incubated in an incubator for 30 minutes. The medium was then aspirated and the plate was washed three times with PBS. The plate was then photographed under an inverted fluorescence microscope.
[0082] 16. mitotraker dyeing Take 50 μg of MitoTracker powder and add it to 94.06 μL of DMSO to prepare a 1 mM stock solution for later use. Dilute the stock solution to 500 nM with serum-free medium and add it to a cell culture plate. After incubation for 30 min, wash the cells twice with preheated 1xPBS, fix the cells with 4% paraformaldehyde fixative for 15 min, and then observe them under a fluorescence microscope.
[0083] Data statistics and analysis All data were statistically analyzed using GranphPad Prism 8. A p-value < 0.05 was considered statistically significant. Data are expressed as mean ± standard deviation (mean ± SD).
[0084] result 1. Poly(i:c) stimulates the innate immune response in follicles. (1) Poly(i:c) stimulates the ovarian innate immune response and induces follicular atresia. This invention treats isolated porcine follicles with three different concentrations of Poly(i:c): 2 μg / mL, 5 μg / mL, and 10 μg / mL. The activation of three marker genes by the innate immune response after treatment with different concentrations of Poly(i:c) was detected by qRT-PCR. TLR3 , RIG-1 , MDA5 Changes in expression levels ( Figure 1 A). It was found that the expression of three maker genes was most significantly upregulated in the 5 μg / mL Poly(i:c) treatment group. Subsequent follicle assays and sequencing samples were treated with 5 μg / mL Poly(i:c). ELISA results showed... TLR-3 , RIG-1 , MAD5 Downstream inflammatory factors TNF-α , IL-1β The expression levels of all three showed an upregulation trend, further confirming that Poly(i:c) can stimulate the occurrence of innate immune responses in follicles. Figure 1B). Observing the phenotypic differences of follicles treated with 5 μg / mL Poly(i:c) and those in the control group, it was found that the blood color of follicles in the 5 μg / mL Poly(i:c) treatment group was lighter, and white turbid follicles appeared. The results showed that Poly(i:c) can induce follicular atresia.
[0085] (2) GO and KEGG enrichment analysis of differentially expressed genes by follicle RNA-seq Differentially expressed genes in the follicle follicles treated with 5 μg / mL Poly(i:c) were determined using RNA-seq between the treatment and control groups. PCA analysis showed significant differences in principal component characteristics between the 5 μg / mL Poly(i:c) treatment and control groups. Figure 2 A). Based on RNA-seq results, 399 downregulated genes and 148 upregulated genes were identified. P <0.05) and cluster analysis was performed on differentially expressed genes ( Figure 2 B, C). This invention performs GO and KEGG functional enrichment analysis on differentially expressed genes to understand their main functional roles. Figure 3 (A, B). In the secondary functional annotation of GO enrichment analysis, the BP process mainly focused on immune response, innate immune response, and inflammatory response; the CC process mainly focused on plasma membrane, cytoplasm, cytosol, and extracellular space; and the MF process mainly focused on protein binding and integrin binding. In biological processes, differentially expressed genes were observed to mainly cluster in immune and primary immune responses, further confirming that Poly(i:c) can activate the occurrence of follicular innate immune responses. KEGG enrichment analysis of differentially expressed genes showed that their functions were mainly enriched in pathways such as the PI3K-AKT signaling pathway and cytokine-cytokine receptor interaction. The Toll-like receptor signaling pathway was also found in these enriched pathways; the Toll-like receptor signaling pathway is a key pathway for triggering innate immune responses.
[0086] (3) RNA-seq differential gene enrichment analysis using GSEA This invention further uses GSEA enrichment analysis on differentially expressed genes to determine that these genes are associated with the occurrence of follicular innate immunity. The experiment revealed that these differentially expressed genes were enriched in the B cell receptor signaling pathway, T cell receptor signaling pathway, primary immune response process, and intercellular communication, further confirming the fact that Poly(i:c) activates the follicular innate immune response.
[0087] 2. Poly(i:c) mediates tRF-GLU-TTC-3 / SLC25A17 Axis regulation of oxidative stress in granulosa cells (1) Poly(i:c) induces innate immune responses in granulocytes This invention treated granulosa cells with three different concentrations of Poly(i:c): 2 μg / mL, 5 μg / mL, and 10 μg / mL, and detected the activation of three marker genes in the innate immune response after treatment with different concentrations of Poly(i:c) by qRT-PCR. TLR3 , RIG-1 , MDA5 Changes in expression levels ( Figure 5 A). The results showed that the expression of the three maker genes was most significantly different in the 5 μg / mL Poly(i:c) treatment group. Subsequent experiments used 5 μg / mL Poly(i:c) treatment to treat mouse granulosa cells. Western blotting results showed that the 5 μg / mL Poly(i:c) treatment group was significantly different from the control group. TLR3 and MDA5 Both maker genes showed a significant upregulation trend. Figure 5 B). Therefore, it is believed that Poly(i:c) can activate the innate immune response of mouse granulocytes.
[0088] (2) Differential tsRNA characterization This invention identified 345 tsRNAs in the 5 μg / mL Poly(i:c) treatment group and the control group using high-throughput sequencing, of which 323 tsRNAs were co-expressed in both groups. Figure 6 A). These tsRNAs are mainly distributed in lengths of 29-34 nucleotides (A). Figure 6 B). Statistical analysis of tsRNA types revealed that the most prevalent tsRNA type in both the Poly(i:c) treatment group and the control group was tRF-5c ( Figure 6 C). Abundance analysis of each tsRNA revealed that tRF-1: 32-Gly-GCC-1 had the highest abundance in both groups. Figure 6 D).
[0089] Statistical analysis of the sources of tsRNA in the Poly(i:c) treatment group and the control group revealed that tsRNAs generated by Glu-TTC and Gly-GCC accounted for the highest proportion of all tsRNAs. Among all generated tsRNAs, tRNA-Ala was the most abundant, followed by tRNA-Arg, tRNA-Asn, tRNA-Asp, tRNA-Cys, tRNA-Gln, and tRNA-Glu. Figure 7 A).
[0090] (3) Poly(i:c) induces oxidative stress in granulosa cells Granulosa cell oxidative stress is closely related to follicular atresia. Excessive reactive oxygen species (ROS) generated under oxidative stress can induce granulosa cell apoptosis through multiple pathways, leading to follicular atresia. Previous experiments have verified that Poly(i:c) invasion leads to follicular atresia. To explore the specific mechanisms by which Poly(i:c) may cause follicular atresia, this invention verifies common phenotypes that induce follicular atresia (granulosa cell oxidative stress).
[0091] Firstly, ROS and mitotraker fluorescence staining results showed that in the 5 μg / mL Poly(i:c) treatment group, the content of reactive oxygen species increased (enhanced green fluorescence), and the number of healthy mitochondria decreased (weakened red fluorescence). Figure 8 A). The experiment further used qRT-PCR and WB methods to identify the antioxidant maker gene at the gene and protein levels. CAT , SOD1 Changes in gene and protein expression levels after treatment with 5 μg / mL Poly(i:c) were observed. Treatment of granulosa cells with 5 μg / mL Poly(i:c) revealed changes in intracellular... CAT , SOD1 Gene expression levels showed a significant downregulation trend. CAT While protein levels showed a significant downward trend, SOD1 No significant changes were observed at the protein level.
[0092] (4) Functional enrichment analysis of tRF-GLU-TTC-3 target genes This invention first uses qRT-PCR to detect whether the trend of tsRNA in mouse granulosa cells treated with 5 μg / mL Poly(i:c) is consistent with that in the sequencing results. Figure 9AF). Quantitative results showed that the trends of tRF-1:32-Gly-CCC-2, tRF-1:31-Glu-TTC-3, tRF-1:29-Gly-GCC-2, tRF-1:31-Glu-TTC-4, tRF-1:31-Gly-GCC-4, and tRF-1:23-Val-AAC-1-M8 in mouse granulosa cells treated with 5 μg / mL Poly(i:c) were consistent with sequencing results. Functional enrichment analysis of downstream target genes of these tsRNAs was performed. Figure 10 Based on functional enrichment and quantitative expression levels, it was found that downstream target genes of tRF-1:31-Glu-TTC-3 were enriched in immune response and oxidative stress generation. Therefore, tRF-1:31-Glu-TTC-3 was selected as the research object, and tRF-1:31-Glu-TTC-3 was denoted as tRF-GLU-TTC-3.
[0093] (5) Overexpression of tRF-GLU-TTC-3 induces oxidative stress in granulosa cells. Previous experiments showed that treatment of mouse granulosa cells with 5 μg / mL Poly(i:c) induced oxidative stress in mouse granulosa cells. Sequencing data analysis and qRT-PCR results showed that tRF-GLU-TTC-3 showed an upregulation trend in the 5 μg / mL Poly(i:c) treatment group. tRF-GLU-TTC-3 mimics were synthesized. The nucleotide sequence of the tRF-GLU-TTC-3 mimics is TCCCATATGGTCTAGCGGTTAGGATTCCTGG, the same as the sequence shown in SEQ ID NO.1. Mouse granulosa cells were transfected with these mimics. ROS and mitotraker fluorescence staining analysis showed that overexpression of tRF-GLU-TTC-3 induced oxidative stress in mouse granulosa cells. Figure 11 A). qRT-PCR detection of antioxidant maker gene in tRF-GLU-TTC-3 overexpression group and control group CAT , SOD1 Changes in expression levels were observed in the tRF-GLU-TTC-3 overexpression group. CAT and SOD1 The expression levels all showed a significant downward trend. Figure 11 B). Further Western blotting was used to detect the levels of tRF-GLU-TTC-3 in the overexpression group and the control group. CAT and SOD1 Changes in protein expression levels, results showed CAT Protein expression levels showed a significant downregulation trend. SOD1 There was no significant difference in protein expression levels. Figure 11C). Therefore, it is believed that overexpression of tRF-GLU-TTC-3 induces oxidative stress in mouse ovarian granulosa cells.
[0094] (6) tRF-GLU-TTC-3 via targeted SLC25A17 Inducing oxidative stress in ovarian granulosa cells Previous studies screened for genes encoding peroxisome membrane proteins during tRF-GLU-TTC-3 target gene functional enrichment analysis. SLC25A17 Genes have potential target relationships. SLC25A17 Peroxisomes play an important role in maintaining redox homeostasis in various mammalian cell lines.
[0095] First, qRT-PCR was used to verify the detection in the 5 μg / mL Poly(i:c) treatment group, the tRF-GLU-TTC-3 overexpression group, and the tRF-GLU-TTC-3 inhibition group. SLC25A17 Changes in gene expression levels were observed in both groups. SLC25A17 Gene expression levels were significantly upregulated. P <0.05)( Figure 12 A). Online target prediction analysis showed that tRF-GLU-TTC-3 and SLC25A17 bind in the 3'UTR region ( Figure 12 B). To further demonstrate tRF-GLU-TTC-3 and SLC25A17 To determine whether a target relationship exists, wild-type and mutant plasmids of SCL25A17 were constructed, and the target relationship between the two was verified using a dual-luciferase activity assay. Figure 12 C), in the tRF-GLU-TTC-3 minics+SCL25A17 wild-type group, the fluorescence intensity ratio of Renalis luciferase to firefly luciferase showed a significant downward trend compared with other groups (P<0.05). This indicates that tRF-GLU-TTC-3 and SLC25A17 There is a target relationship between them.
[0096] Subsequently, in order to investigate SLC25A17 Can peroxisome membrane proteins regulate oxidative stress in granulosa cells? This study used si-SLC25A17 to knock down intracellular... SLC25A17 The expression level of [something] in the control group was [something]. SLC25A17 ROS staining was performed on the knockdown group and the si-SLC25A17+tRF-GLU-TTC-3 inhibitor group. The nucleotide sequence of the tRF-GLU-TTC-3 inhibitor is CCAGGAATTCCAACCGCCTAGACCATAGGGGA, denoted as SEQ ID NO.2.
[0097] The results show SLC25A17 The ROS fluorescence staining intensity increased significantly in the knockdown group, which was rescued by the addition of tRF-GLU-TTC-3 inhibitor. SLC25A17 The intensity of ROS fluorescence staining was restored after the effect of knockdown was reduced. Figure 13 A). qRT-PCR detection of antioxidant maker genes in the above three groups. CAT , SOD1 The gene expression levels showed that... SLC25A17 The expression levels of these two antioxidant marker genes were significantly downregulated in the knockdown group (P<0.05), and the expression levels of the two antioxidant marker genes were restored after rescue by the addition of tRF-GLU-TTC-3 inhibitor. Therefore, it is believed that... SLC25A17 Decreased gene levels can lead to oxidative stress in granulocytes, which can be rescued by inhibiting tRF-GLU-TTC-3. SLC25A17 Decreased expression levels lead to oxidative stress in granulocytes.
[0098] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0099] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0100] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. The application of tRF-GLU-TTC-3 expression inhibitors in drugs that inhibit oxidative stress in ovarian granulosa cells, characterized in that... The sequence of tRF-GLU-TTC-3 is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The expression inhibitors include formulations used in RNA interference technology.
3. The application according to claim 4, characterized in that, The formulation is an inhibitor of tRF-GLU-TTC-3, and the sequence of the inhibitor is shown in SEQ ID NO.
2.
4. The application according to claim 4, characterized in that, The steps to inhibit tRF-GLU-TTC-3 expression include: introducing the sequence shown in SEQ ID NO.2 into granulocytes.
5. The application according to claim 1, characterized in that, The dosage form of the drug is either oral or injectable.
6. The application according to claim 1, characterized in that, The drug also contains pharmaceutically acceptable excipients or carriers.
7. The application according to claim 1, characterized in that, The expression inhibitor shown is used to prepare drugs that promote follicle development.
8. The application according to claim 1, characterized in that, The oxidative stress includes SLC25A17 Oxidative stress caused by changes in gene expression levels.