Drug screening chip and method based on pathogenic essential protein Pcg6 of plant pathogenic fungi and application of drug screening chip

By screening for the essential pathogenic protein Pcg6 of rice blast fungus, and using SPR chip screening, the highly active small molecule compound PN-16 was identified. This solved the problems of drug resistance and low target discovery efficiency of existing rice blast fungicide, and enabled the development of green fungicides and effective control of rice blast.

CN121652246APending Publication Date: 2026-03-13CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-04
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing agents for controlling rice blast fungus have issues with resistance and safety, and lack effective target discovery technologies, making it difficult to efficiently screen for highly active small molecule compounds.

Method used

By identifying the essential pathogenic protein Pcg6 of rice blast fungus and its homologs, and using SPR chip and other technologies, the small molecule compound PN-16, which binds to it, was screened out and its fungicidal activity against rice blast was verified.

Benefits of technology

It has enabled the development of a broad-spectrum fungicide against rice blast fungus, overcomes the problem of cross-resistance, shortens the research and development cycle, and provides technical support for the creation of green pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121652246A_ABST
    Figure CN121652246A_ABST
Patent Text Reader

Abstract

The invention discloses a drug screening chip based on Pcg6 protein, a method and application thereof, and belongs to the field of biotechnology and pesticide screening. The chip comprises a solid-phase carrier and Pcg6 protein, a variant thereof, an ortholog thereof or a functional active fragment thereof which are fixed on the surface of the solid-phase carrier. The invention also discloses a method for screening a plant pathogenic fungus (such as magnaporthe oryzae) small molecule compound by using the protein or the chip. The method relates to technical means such as surface plasma resonance (SPR), DNA coding compound library (DEL) screening, affinity mass spectrometry or virtual docking and the like. According to the invention, a benzothiophene small molecule compound PN-16 having physical interaction with Pcg6 can be screened by detecting the binding condition of a candidate compound and Pcg6 protein; by measuring the formation rate of appressorium and inoculating barley and rice, the PN-16 is determined to have relatively high activity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant protection and biotechnology. Specifically, this invention relates to a novel drug target for screening resistance to plant fungal diseases (especially rice blast), and a method, chip, reagent kit, and system for screening active small molecule compounds based on this target. Background Technology

[0002] Rice blast, caused by *Pseudomonas aeruginosa*, is a major disease in rice production, particularly severe in rice-growing regions of Asia and Africa. The main control methods for rice blast include agricultural, chemical, and biological control, with chemical control through the application of fungicides being the simplest, fastest, and most common. Currently, commonly used fungicides against *Pseudomonas aeruginosa* include methoxyacrylates (QoIs), ergosterol biosynthesis inhibitors (EBIs), and melanin biosynthesis inhibitors. However, current rice blast control in my country mainly relies on chemical fungicides developed by foreign companies, and some fungicides have issues with resistance and safety. Therefore, targeting essential pathogenic proteins of the fungus and screening and designing lead compounds is an urgent problem to be solved in the creation of green fungicides in my country and an important future development direction. However, in terms of original molecular target discovery, there is a problem of low efficiency in discovering effective targets against harmful organisms. Therefore, establishing a potential target database and developing common technologies for the targeting and validation of potential fungicide targets are crucial for the development of original drugs. This invention proposes a protein chip for screening highly active small molecule compounds. Based on the potential target identification technology of pathogenic essential proteins combined with small molecule compounds with bactericidal activity, it first identifies a pathogenic essential protein of rice blast fungus, Pcg6, and then screens a highly active small molecule, PN-16, through a compound library created in our laboratory. Summary of the Invention

[0003] This invention first provides the use of protein Pcg6, its variants, its orthologs, or functionally active fragments thereof in screening small molecule compounds that resist plant pathogenic fungi (preferably rice blast fungus, Fusarium, or Aspergillus nidulans). The amino acid sequence of protein Pcg6 is shown in SEQ ID NO: 1. The variants refer to proteins that have at least 80%, 85%, 90%, or 95% sequence identity with SEQ ID NO: 1 and retain the ability to bind to small molecule ligands. The functionally active fragments refer to polypeptide fragments containing the small molecule ligand-binding domain of protein Pcg6.

[0004] In an optional embodiment, the ortholog is an ortholog from the Discotyledons (such as Fusarium graminearum, Sclerotinia sclerotiorum, Botrytis cinerea, and Aspergillus nidus) containing 7-9 KH domains with RNA-binding ability; preferably, it is selected from Fusarium FgPCG6 (gene ID: FGSG_06181, Fusarium graminearum ) and Aspergillus nidulans AnPCG6 (GenBank No.: XP_050466937, Aspergillus nidulans )).

[0005] The present invention also provides a method for screening candidate compounds against plant pathogenic fungi, the method comprising the following steps: 1) Provide protein Pcg6, its variants, its orthologs, or its functionally active fragments; 2) Under conditions that allow protein-compound interactions, contact the candidate compound with the protein from step 1; The test can detect whether the candidate compound binds to the protein, or detect the regulatory effect of the candidate compound on the activity of the protein. Compounds that can bind to or modulate the activity of the protein are selected as lead compounds for resistance against plant pathogenic fungi.

[0006] In an optional implementation, the detection method is based on physical affinity detection techniques, including but not limited to: surface plasmon resonance (SPR), biomembrane interference (BLI), isothermal titration microcalorimetry (ITC), microscale thermophoresis (MST), fluorescence thermal migration (TSA / DSF), or fluorescence polarization (FP).

[0007] In an optional implementation, the detection method is based on surface plasmon resonance (SPR).

[0008] In an optional implementation, the detection binding method is based on affinity mass spectrometry (AS-MS), which includes incubating the candidate compound with protein Pcg6 and then using mass spectrometry to detect the presence of the protein-ligand complex or the presence of the ligand after dissociation.

[0009] In an optional implementation, the detection binding method is based on DNA-encoded compound library (DEL) screening technology, which includes contacting a candidate compound library linked with DNA tags with immobilized protein Pcg6, eluting unbound compounds, and identifying compounds that bind to protein Pcg6 by amplifying and sequencing the DNA tags.

[0010] The present invention also provides a chip or biosensor for screening small molecule compounds that resist plant pathogenic fungi, the chip or biosensor comprising a solid support and protein Pcg6, its variants, its orthologs or functionally active fragments thereof immobilized on the surface of the solid support.

[0011] In a preferred embodiment, the chip is a surface plasmon resonance (SPR) chip, and the protein Pcg6 is immobilized on the dextran matrix or other modified layer on the chip surface by physical adsorption, covalent coupling (such as amino coupling, thiol coupling) or affinity capture (such as biotin-streptavidin, His tag-nickel ion, Fc tag-Protein G).

[0012] This invention also provides a kit for screening small molecule compounds that resist plant pathogenic fungi, the kit comprising: 1) Protein Pcg6, its variants, its orthologs, or its functionally active fragments; 2) Buffer solutions used to maintain protein activity; Optionally; a positive control compound capable of binding to protein Pcg6; Optionally; a detection reagent for labeling proteins or compounds.

[0013] In an optional implementation, the protein is present in solution or lyophilized powder form, or pre-coated on a solid support.

[0014] In an optional implementation, the kit is a kit for fluorescence polarization (FP) screening containing a fluorescently labeled tracer; or a kit for AlphaScreen screening containing donor microbeads and acceptor microbeads.

[0015] The present invention also provides a computer-aided virtual screening method, which includes performing molecular docking (Docking) between the three-dimensional structure of candidate small molecules and the crystal structure or homology modeling structure of protein Pcg6, calculating the binding free energy, thereby predicting compounds with potential activity.

[0016] Beneficial technical effects This invention effectively overcomes the cross-resistance problem of existing fungicides by establishing the novel RNA-binding protein Pcg6 and its conserved homologs as drug targets, and has the potential to develop broad-spectrum fungicides against various pathogenic fungi such as rice blast fungus and Fusarium. Combined with targeted screening technologies such as SPR chips, this invention achieves rapid, accurate and high-throughput detection of compound affinity, significantly shortens the research and development cycle, clarifies the mechanism of action, and provides strong technical support for the creation of new green pesticides. Attached Figure Description

[0017] Figure 1 Cluster analysis of PCG6 with homologous proteins from other species. Illustration: Protein used in protein cluster analysis: PCG6 ( Pyricularia oryzae ), FGSG_06181 ( Fusarium graminearum ), SS1G_01914( Sclerotinia sclerotiorum ), BCIN_07g03500 ( Botrytis cinerea ), XP_050466937( Aspergillus nidulans ), NP_013068 (Saccharomycotina Saccharomyces cerevisiae MEQ_02952 ( Candida albicans ), NP_595755 (Taphrinomycotina Schizosaccharomyces pombe), Khd4 (Basidiomycota Ustilago maydis ), PSTT_15124 ( Puccinia striiformis f. sp. tritici Use the MAFFT program to perform sequence alignment and view the alignment results in the CLC sequence viewer.

[0018] Figure 2 Comparison of the KH domains of PCG6 with homologous proteins from other species. Illustration: Protein used in the comparative analysis of protein KH domains: PCG6 ( Pyricularia oryzae ), FGSG_06181 ( Fusarium graminearum ), SS1G_01914 ( Sclerotinia sclerotiorum ), BCIN_07g03500 ( Botrytis cinerea ), XP_050466937 ( Aspergillus nidulans ), NP_013068 (Saccharomycotina Saccharomyces cerevisiae ), MEQ_02952 ( Candida albicans ), NP_595755 (Taphrinomycotina Schizo saccharomyces pombe), Khd4 (Basidiomycota Ustilago maydis ), PSTT_15124( Puccinia striiformis f. sp. tritici Domain prediction was performed using Alpha Fold 3, the prediction results were viewed in PyMol, and domain diagrams were drawn using IBS for intuitive comparison.

[0019] Figure 3Pcg6 is functionally conserved in the Discoccidea subphylum. A, D: Comparison of colony growth of P131, k3, KHD4 / k3, AnPCG6 / k3, CaPCG6 / k3, FgPCG6 / k3, and k3C. E: Statistical analysis of sporulation yield of P131, k3, KHD4 / k3, AnPCG6 / k3, CaPCG6 / k3, FgPCG6 / k3, and k3C (** indicates significant difference in t-test, p<0.01). B, F: Comparison of appressorium formation rate of P131, k3, KHD4 / k3, AnPCG6 / k3, CaPCG6 / k3, FgPCG6 / k3, and k3C (** indicates significant difference in t-test, p<0.01). C, G: P131, k3, KHD4 / k3, AnPCG6 / k3, CaPCG6 / k3, FgPCG6 / k3 and k3C rice leaf scuffing inoculation.

[0020] Figure 4 Schematic diagram of the PCG6 gene knockout vector construction strategy. Utilizing hygromycin hph gene replacement... PCG6 Genes. The positions of primers P1, P2, P3, P4, P5, P6, hu, and hd are shown in the figure.

[0021] Figure 5 . PCG6 PCR detection of the knockout variant showed that no amplification band was observed in wild-type P131, while specific target bands of 1.4 kb and 0.9 kb were observed in the transformant k3, indicating that the gene in k3... PCG6 It was replaced by the hygromycin gene hph, meaning k3 is the gene. PCG6 The knockout form.

[0022] Figure 6 . PCG6 Southern blot analysis showed a 4.8 kb target band in lane P131 (wild-type) and a 7.8 kb target band in the knockout transformant k3. BI represents BamHI, and EV represents EcoRV. This indicates that k3 is a gene... PCG6 A true knockout.

[0023] Figure 7 Five days after inoculation, the colony size and morphology of wild-type strain P131, knockout strain k3, and complement strain k3C were compared on OTA culture plates.

[0024] Figure 8 Wild-type strain P131, knockout strain k3, and complement strain k3C were inoculated onto hydrophobic glass slides. After being placed under dark and humid conditions for 12 h, the germination of spores and the formation of appressoria of the three strains were compared.

[0025] Figure 9 . Gene PCG6This affects the sporulation rate of rice blast fungus. Sporulation was carried out using 6 cm petri dishes following the method of smearing and sporulation. After washing and sporulation for 48 hours, the sporulation rate was counted.

[0026] Figure 10 Missing PCG6 Genes cause the loss of pathogenicity of rice blast fungus to host plants. A: Inoculation of scratched detached rice leaves with P131, k3, and k3C mycelial blocks. B: Spraying of barley seedlings with a suspension of conidia of P131, k3, and k3C. C: Spraying of rice seedlings with a suspension of conidia of P131, k3, and k3C.

[0027] Figure 11 Affinity chromatography image of the Pcg6 core region protein obtained from eukaryotic expression and purification. The target protein size is 83 kDa.

[0028] Figure 12 There is a physical interaction between Pcg6 and PN-16, and the KD value of their SPR experiment is 90.9 μM.

[0029] Figure 13 The chemical structural formula of PN-16, a small molecule compound of the benzothiophene class.

[0030] Figure 14 PN-16 exhibits fungicidal activity against rice blast fungus. AB: 36 μM PN-16 completely inhibits the germination of conidia and appressorium formation of rice blast fungus. CD: Application of 36 μM PN-16 to detached barley leaves has a preventive effect against rice blast. EF: Application of 36 μM PN-16 to detached rice leaves has a preventive effect against rice blast. Detailed Implementation

[0031] The purpose of this invention is to propose a protein chip for screening highly active small molecule compounds, based on a targeted identification technique that identifies potential targets of small molecule compounds with bactericidal activity by binding to pathogenicity-essential proteins. Novel pathogenicity-essential genes specific to pathogenic fungi were identified through knockout verification and homology analysis. PCG6 The full-length protein was purified using a eukaryotic expression system, and small molecule compounds that physically interact with it were further screened using SPR technology. The activity of the compounds was determined by measuring their phenotypes.

[0032] To verify the feasibility and accuracy of this technology, and the value of Pcg6 as a drug target for re-screening, the technical solution adopted in this invention is as follows: 1. Identification of novel pathogenicity-specific genes essential for pathogenic fungi. Knockout and complement strains were obtained through gene knockout and complementation. Using the wild-type strain as a control, the differences among the three strains in growth rate, sporulation, appressorium formation rate, mycelial expansion, and pathogenicity were determined to confirm their respective characteristics. PCG6 It is an essential gene for the pathogenicity of rice blast fungus. Further analysis and comparison of the amino acid sequence and tertiary structure of Pcg6 and its homologs emphasize the conservation of Pcg6 in filamentous fungi.

[0033] 2. Screening of small molecule compounds based on SPR technology Our laboratory previously created a compound library containing various types of small molecules, including benzothiophenes and quinolines (Chinese Patent Publication No. CN118666821A, A benzothiophene bactericide). Using SPR technology, the protein Pcg6 was immobilized on a chip, and small molecules from the compound library were circulated in batches. The resulting benzothiophene small molecule compound PN-16, with a KD of 90.9 μM, was screened and found to bind to the protein.

[0034] 3. Activity verification of PN-16 Using wild-type strain P131 of rice blast fungus as the test object, the MIC for inhibiting the formation of P131 appressorium was determined to be 36 μM. The application of 36 μM PN-16 to isolated barley and rice leaves produced a good preventive effect against rice blast, indicating that the benzothiophene-like small molecule compound PN-16 screened by Pcg6 has high activity in the prevention of rice blast.

[0035] Example 1: Cluster analysis of Pcg6 with homologous proteins in other species The amino acid sequence of the rice blast fungus protein Pcg6 was compared with that of NCBI (http: / / www.ncbi.nlm.nih.gov / ) to identify its homologous analogs in different species: Pcg6 ( Pyricularia oryzae ), FGSG_06181( Fusarium graminearum ), SS1G_01914 ( Sclerotinia sclerotiorum ), BCIN_07g03500( Botrytis cinerea ), XP_050466937 ( Aspergillus nidulans ), NP_013068(Saccharomycotina Saccharomyces cerevisiae ), MEQ_02952 ( Candida albicans ), NP_595755 (Taphrinomycotina Schizosaccharomyces pombe), Khd4 (Basidiomycot a Ustilago maydis ), PSTT_15124 ( Puccinia striiformis f . sp. triticiBLASTp search results indicate that orthologous proteins of Pcg6 are distributed in fungi, but not in plants or animals. Pcg6 shares less than 30% sequence homology with orthologous proteins from *Saccharomyces cerevisiae*, *Candida albicans*, *Schizosaccharomyces*, basidiomycetes, and wheat stripe rust fungi, indicating low conservation. Figure 1 As shown. However, Pcg6 is highly conserved with orthologs from the Discotyledons, including *Fusarium graminearum*, *Sclerotinia sclerotiorum*, *Botrytis cinerea*, and *Aspergillus nidus*. Furthermore, predictions using Alphafold3, such as... Figure 2 As shown, all Pcg6 orthologs contain 7-9 KH domains with RNA-binding capabilities. These analyses indicate that Pcg6 and its orthologs are unique.

[0036] Example 2: Verification of the functional conservation of Pcg6 and its homologous proteins in other species To verify whether Pcg6 and its homologs in different subphyla are functionally similar, an RP27 promoter driver was constructed. CaPcg6 , FgPcg6 , KHD4 and AnPcg6 Expression vector and transformation PCG6 Protoplasts of the knockout strain K3 were obtained through resistance selection. PCG6 Heterologous complementary strains were identified, and their biological phenotypes were analyzed.

[0037] 1. Determination of the growth rate of rice blast fungus (1) Take rice blast fungus that has grown on OTA for 5 days, and punch out 3 circular fungal blocks of the same diameter around the colony using a puncher that has been sterilized by alcohol heating.

[0038] (2) Carefully pick up the mycelium block with a toothpick and place it in the center of the OTA plate with the mycelium facing downward. Invert the OTA plate and place it in a 28℃ light incubator for 5 days.

[0039] (3) Remove the OTA plate from the inoculated culture and take photos according to the colony number. Use a scalpel blade to trace along the edge of the colony. Mark the tangent line. Measure and record the colony diameter; for strains with the same number, take the average of three measurements.

[0040] The results showed that the colony diameters of KHD4 / k3 and CaPcg6 / k3 were significantly smaller than those of the wild-type strain P131 and the complementary strain k3C. PCG6 The growth rate of the knockout k3 is similar.

[0041] 2. Determination of sporulation rate of rice blast fungus (1) Take a colony of rice blast fungus that has grown for about 5 days, add 500 ml of sterile water, break the hyphae with an inoculation loop, extract the broken rice blast fungus hyphae and spread them on a thick OTA sporulation plate, and dry them in a clean bench. Incubate in a 28℃ light incubator for 36 h.

[0042] (2) Take out the sporulation plate covered with mycelium, break the mycelium with a toothpick and rinse it clean. After drying the plate upside down, wrap it with two layers of gauze and place it upright in a 28℃ light incubator for 48 h.

[0043] (3) Remove the conidial plate that has been fully inoculated with conidia. Add 30 ml of sterile water to each plate and use a spreader to wash off the conidia. Filter the spore solution into a 50 ml sterile centrifuge tube. Count the conidia in 400 small squares using a hemocytometer. Take three counts for each sample and take the average value. The number of conidia produced per plate = the obtained value × 10 4 ×30 (samples). The experiment was repeated three times.

[0044] 3. Determination of rice blast fungus appressorium formation rate (1) Take a colony of *Blastomyces oryzae* that has grown for about 5 days, add 1 ml of sterile water, use a spreader to break the hyphae, and filter and elute into a 1.5 ml centrifuge tube. Use a hemocytometer to count the conidia in 400 small squares, and adjust the spore concentration to 5 conidia per 400 small squares. Take 7 μL of spore solution and spot it onto a hydrophobic glass slide, place it in a moist and dark inoculation box, and incubate it in a 28℃ light incubator for 8 h.

[0045] (2) Place a small amount of water on the slide, slowly invert the hydrophobic slide onto the slide, use absorbent paper to dry the water that overflows after the coverslip is placed on, observe the formation of appressorium by conidia on the hydrophobic slide under a microscope, record the data and take pictures of typical parts for preservation.

[0046] Similarly, the sporulation rates of KHD4 / k3 and CaPcg6 / k3 were not complementary compared to P131 and its complementary strain k3C. PCG6 The resulting phenotype is missing, and it is unable to form appressoria on hydrophobic slides.

[0047] 4. Pathogenicity test of rice blast fungus (inoculation by gravid inoculation) (1) Take the middle part of the rice leaf at the four-leaf stage and gently scratch it with a sterilized needle, but do not break it. Use absorbent paper to fix the two ends of the leaf.

[0048] (2) Take colonies that have grown for about 5 days, cut them into small pieces with a sterile blade, with the mycelial side facing the leaf. Inoculate 2-3 mycelial pieces onto one leaf, or use 0.25‰ Tween-20 sterile water to wash away conidia from the conidial plate and adjust the conidia concentration to 1×10⁻⁶. 5 Inoculate with 7 μL of spore solution at a concentration of 1 spore / ml. After inoculation, spray 0.25‰ Tween-20 evenly on the leaf surface. Incubate the inoculated leaves in the dark at 28℃ for 36 h under moist conditions, followed by 4 days of light incubation. Measure the length of lesions and photograph them.

[0049] Inoculation by scrambling rice leaves showed that, similar to k3, KHD4 / k3 and CaPcg6 / k3 also lost their infectivity. Meanwhile, Fusarium FgPCG6 and Aspergillus nidulans AnPCG6 heterologous replacement strains could be reintroduced. PCG6 Knockouts exhibit defective phenotypes in growth, sporulation, appressorium formation, and pathogenicity, such as... Figure 3 As shown in the figure. These results indicate that Pcg6 and its homologs exhibit functional differentiation in different fungal subphyla, with function conserved only in the Discomycetes.

[0050] Example 3 Gene PCG6 Evidence of slowing down the mycelial growth rate of rice blast fungus This invention employs gene knockout and gene complementation experiments to demonstrate the role of Pcg6 in the colony growth of *Magnaporum oryzae*. This part includes the construction of knockout and complementation vectors, transformation of *Magnaporum oryzae* protoplasts, obtaining the corresponding transformants, and observing their colony size and morphology.

[0051] 1. Construction of the knockout vector PCR reactions amplify separately PCG6 The upstream 1.4kb fragment and the downstream 0.9kb fragment of the gene were amplified, and the resulting upstream and downstream fragments were digested with BamHI / EcoRI and HindIII / KpnI, respectively, and then ligated into the knockout vector pKOV21, which was digested with the same enzymes, to obtain... PCG6 The gene knockout vector pKPCG6 and the NotI linearized vector are awaiting transformation. A schematic diagram of the knockout vector construction strategy is shown below. Figure 4 As shown.

[0052] Upstream fragment primer P1: ATAGGATCCAGCAGTAGTCAACCTG (SEQ ID No.: 2) Upstream fragment primer P2: ACCTGATTCGTAAGTCGTGAGTATC (SEQ ID No.: 3) Downstream primer P3: TAACAAGCTTCAAAGTCTTGTCTCC (SEQ ID No.: 4) Downstream primer P4: ACTGGTACCTGAACGTACTGTAGG (SEQ ID No.: 5) 2. Preparation and transformation of protoplasts Mycelia of wild-type rice blast fungus P131 were scraped with a toothpick and shaken to break up the mycelia. They were then cultured in CM medium (0.6% yeast extract, 0.03% enzymatically hydrolyzed casein, 0.03% acid-hydrolyzed casein, 1% sucrose) at 28°C and 180 rpm / min for 36 h. The mycelia were then collected in 50 mL centrifuge tubes. Enzyme permeation buffer (containing 20 mg / ml catabolite, prepared with 0.7 M sodium chloride) was added to the centrifuge tubes, and the mixture was incubated at 28°C and 180 rpm / min for 3-4 h. The mycelia were then filtered off using a funnel. The mixture was centrifuged at 4,000 rpm / min for 15 min, and the supernatant was discarded. The precipitate was washed twice with 25 mL STC (1.2 M sorbitol, 10 mM Tris pH 7.5, 50 mM calcium chloride), and the protoplast concentration was adjusted to 0.5-1 × 10⁻⁶ with STC. 8 Prepare protoplasts by aliquoting 300 μL into sterile 50 mL centrifuge tubes. Add approximately 2 μg of knockout vector plasmid to each tube and incubate on ice for 20 min. Add 2 mL / tube of PTC solution (60% polyethylene glycol 3350, 10 mM Tris pH 7.5, 50 mM calcium chloride) dropwise and incubate on ice for 20 min. Add 25 mL / tube of pre-chilled STC, mix well, and centrifuge at 4000 rpm / min, 4°C for 15 min. Discard the supernatant. Add 3 mL of LR medium (0.1% yeast extract, 0.1% enzymatically hydrolyzed casein, 1 M sucrose) to each tube and incubate at 28°C for 12-18 h. Transfer to a petri dish and add 15 mL of SR (LR + 1.6% agar) cooled to approximately 50°C. Mix well and allow to solidify. Top with 15 mL of 0.7% agar containing 400 μg of protoplasts. Hygromycin (Roche, USA) was cultured at 28°C for 4-6 days at a concentration of μg / mL. The resulting transformants were then transferred to solid CM medium containing 400 μg / mL neomycin (Roche, USA). The neomycin-resistant transformants were then transferred to oat-tomato agar medium.

[0053] 3. PCR verification of transformants Scrape transformant hyphae cultured to 3-4 cm on an OTA plate into a DNA extraction tube, add small magnetic beads and vortex to disrupt the mycelium. Add 650 μL of CTAB extraction buffer and vortex to mix. Incubate at 65°C for 15 min, inverting occasionally. After cooling to room temperature, add 325 μL of Tris-balanced phenol and 325 μL of chloroform, mix well, and centrifuge at 12000 rpm / min for 15 min. Transfer 450 μL of the supernatant to a new centrifuge tube, add 2 volumes of anhydrous ethanol, precipitate at -20°C for 30 min, centrifuge at 12000 rpm / min for 15 min, discard the supernatant, wash the precipitate with 70% ethanol, wash the precipitate with anhydrous ethanol, air dry under sterile conditions, dissolve the DNA in 30 μL of double-distilled water or TE buffer, and store at -20°C for later use. Primers for PCR validation: left arm validation primer pair p5 / hu, right arm validation primer pair p6 / hd.

[0054] P5: CAAAGCTCGATCCGTGTTGAC (SEQ ID No.: 6) hu: GACAGACGTCGCGGTGAGTT (SEQ ID No.: 7) p6: GCGCTGTGAATGTAACTGGT (SEQ ID No.: 8) hd: TCTGGACCGATGGCTGTGTAG (SEQ ID No.: 9) The PCR reaction system is as follows: a 20 μL system contains the following components: 10 μL of thermostable polymerase, 1 μL each of two 10 mM up primers (or 1 μL each of two 10 mM down primers), 1 μL of genomic DNA, and 17 μL of sterile distilled water. The PCR reaction program is as follows: pre-denaturation phase: 95℃, 3 min; amplification phase: 94℃ for 25 s, 58℃ for 25 s, 72℃ for 30 s, 27 cycles; final extension phase: 72℃ for 10 min.

[0055] PCR products were detected by 1% agarose gel electrophoresis, such as... Figure 5 As shown, no amplification band was observed in wild-type P131, while the transformant k3 exhibited specific target bands of 1.4 kb and 0.9 kb, indicating that the gene in k3... PCG6 Hygromycin gene hph It has been replaced, meaning k3 is the gene. PCG6 To further verify whether k3 is a true knockout, we performed a Southern blot experiment. The genomic DNA of wild-type P131 and the knockout k3 was completely digested with the restriction endonuclease MluI. The left arm was used as a probe, and the probe position is shown in Figure [image missing]. Figure 6 As shown. Using a random primer labeling kit (Takara, Dalian), α-dCT32P isotope labeling was performed. A 4.8 kb target band appeared in lane P131 of the wild-type gene, while a 7.8 kb target band appeared in the knockout transformant k3. This indicates that k3 is a gene... PCG6 A true knockout.

[0056] The hybridization probe primer sequences are as follows: 1781-PF: TAACAAGCTTCAAAGTCTTGTCTCC (SEQ ID No.: 10) 1781-PR: ACTGGTACCTGAACGTACTGTAGG (SEQ ID No.: 11) 4. Missing PCG6 The colony growth of strain K3 is slow. a. Gene PCG6 Knockout colony growth rate determination Wild-type strain P131 was activated on OTA culture plates (each liter of culture medium required 40 g of cooked oats, 150 mL of tomato juice, 0.6 g of calcium carbonate, and tap water to a final volume of 1 L, dispensed into Erlenmeyer flasks containing 7.5 g of agar powder, 400 mL per flask). PCG6 Knockout cells were sampled from the edge of colonies using a punch after 4-5 days of growth. The sampled cells were then inoculated into the center of a new OTA culture plate and incubated at 28°C for 120 h. Colony diameter was measured, and the experiment was repeated in triplicate. Results are as follows: Figure 7 As shown, PCG6 The colony diameter of the gene knockout strain k3 is significantly smaller than that of the wild-type strain P131. The k3 colonies are whitish in color with tighter edges than the wild-type strain, and the colonies are whitish in color.

[0057] b. Import PCG6 The gene was able to restore the slowed growth rate of its knockout variant, k3. Genes PCG6 When introduced into its knockout form k3, it can complement the defects in conidial morphology. The colony growth rate and morphology of the complement k3C are not significantly different from those of the wild-type P131. The complement is obtained by protoplast transformation using a complementation vector.

[0058] 1) Construction of complementary carriers Complementary carriers refer to carriers that contain PCG6 A DNA fragment containing the full-length functional sequence of the gene is ligated into a vector carrying a neomycin resistance gene. The neomycin resistance gene is not a limitation of this invention; other genes that cause antibiotic resistance, i.e., genes that cause fungal resistance other than the neomycin resistance gene, can achieve the same effect.

[0059] First, primers are designed to amplify complete... PCG6 The fragment containing the coding sequence was amplified from the genomic DNA of wild-type P131 using the forward primer 5'-CATACTAGTCAGCGAGAACTTCGTTTCAT-3' (SEQ ID No.: 12), which has a SpeI restriction site at 5'; and the reverse primer 5'-CATCTGCAGTGATTGATTGCCATTCATGG-3' (SEQ ID No.: 13), which has a PstI restriction site at 5'. PCG6 The nucleotide sequence fragment is 5442 bp, containing a 1500 bp self-promoter. The target fragment will be digested with the restriction endonuclease SpeI and ligated with the SpeI-digested KNTG vector to obtain a final product containing the fusion gene. PCG6-GFP And the plasmid vector pKNTG-PCG6, which is selected to label the neomycin phosphotransferase gene. This vector can be used for gene complementation. PCG6 The knockout body k3.

[0060] The restriction endonucleases, ligases, and Taq enzymes used in the construction process were manufactured by Takara (Dalian) Co., Ltd., and used in accordance with the product instructions.

[0061] 2) Obtaining complementary materials and observing their growth rate The constructed complementary vector pKNTG-PCG6 was linearized with the restriction endonuclease DraI and then added to protoplasts of the knockout variant k3. A CaCl2 / PEG-mediated transformation experiment was performed following the protoplast transformation method used in knockout experiments. The upper antibiotic medium was 400 μg / mL neomycin. The complementary variant k3C was activated on OTA culture plates. After 4-5 days of growth, colony edges were sampled using a punch, and the sampled bacterial blocks were inoculated into the center of a new OTA culture plate. The plates were incubated at 28°C for 120 h, and the colony diameter was measured. The experiment was conducted in triplicate. The results are as follows: Figure 7 As shown, the colony morphology and diameter of the complement k3C were not significantly different from those of the wild fungus P131. The mycelial growth at the colony edge was sparse, and the colony was dark gray.

[0062] Example 4 PCG6 Influences on the formation of rice blast fungus appressorium Following the spore-forming method, conidia were produced in both wild-type P131 and knockout K3. Conidia were washed with sterile distilled water, filtered through lens paper, and the conidial concentration was adjusted to 50,000 spores / mL. 20 μL of the conidial solution was pipetted onto a coverslip and incubated at 25°C in the dark for 24 h. Appressorium formation was observed using a Nikon Eclipse 800 microscope at 10×40x magnification and photographed. Figure 8 As shown. According to the formula: appressorium formation rate = number of conidia that germinate to form appressorium / number of germinating spores, the appressorium formation rates of wild-type P131 and knockout k3 were statistically analyzed and calculated. The results showed that the appressorium formation rate of wild-type P131 was approximately 95.06%, and the appressorium formation rate of knockout k3 was approximately 6.42%.

[0063] Example 5 PCG6 Affecting the sporulation rate of rice blast fungus Wild-type strain P131 and PCG6 Knockout cells were inoculated onto OTA medium and incubated at 28°C for 5-7 days. 1-2 mL of sterile water was added to the colony surface, and the hyphae were broken up using a sterile smear loop. The suspension containing broken hyphae was then evenly spread onto fresh OTA plates. After drying the surface moisture in a laminar flow hood, the plates were incubated at 25°C for 36 hours under light. New hyphae were broken up using a sterile cotton swab with a small amount of sterile water and rinsed thoroughly with sterile water. The plates were then dried in a laminar flow hood, covered with two layers of sterile gauze, and incubated at 28°C for another 48 hours. 30 mL of sterile water was added in batches to the sporulated plates, and the spores were washed off using a smear loop. The spores were then collected, mixed thoroughly, and counted under a microscope using a hemocytometer to calculate the total sporulation per plate. This experiment was repeated three times. PCG6 The sporulation of the knockout form k3 was significantly reduced compared to the wild-type P131 and its complement k3C. For example... Figure 9 As shown, K3 conidiophores rarely produce more than three conidia, and the conidiophores are also narrower than those of the wild type and complement. After 48 hours of light-induced conidiogenesis on OTA plates, the wild-type P131 achieved a conidiophore yield of 3.16 × 10⁻⁶ per plate. 7 The sporulation rate was 1.85 × 10⁶ cells / plate, while the sporulation rate of the knockout K3 strain could reach up to 1.85 × 10⁶ cells / plate. 6 The number of conidia produced per dish was close to 1 / 20 of that produced by the wild type, indicating a significant decrease in conidia production.

[0064] Example 6 missing PCG6 The strain K3 completely lost its pathogenicity against the host. 1. Inoculation with mycelial blocks resulted in scratching detached rice leaves. Wild-type P131 mycelial blocks, approximately 2 mm × 2 mm in size, were excised with the mycelial surface facing down from the knockout k3 and complementary k3C mycelial blocks. These blocks were then inoculated onto bruised rice leaves. After 24 hours of dark and moist incubation, followed by 5 days of alternating light and dark incubation, photographs were taken. Figure 10 As shown in Figure A, the pathogenicity of the knockout form k3 is significantly reduced compared to the wild-type P131, and k3C can restore pathogenicity to scratched rice leaves.

[0065] 2. Spraying barley seedlings Wild-type P131, knockout k3, and complement k3C were conidially produced using the smear method. Conidia were washed off with 0.25‰ Tween-20 solution, and the conidial-mycelial mixture was filtered through lens paper and collected. The conidial concentration was adjusted to 5 × 10⁻⁶ using a hemocytometer. 5 1 spore / mL was sprayed onto the leaves of seedlings of the barley cultivar E9, a single-leaf, single-heart disease. After 24 h of dark, humidified culture at 28℃, followed by alternating light and dark humidified culture for 2-4 days, wild-type P131 and its complement both showed numerous typical blast fungus lesions, while the knockout strain K3 showed no lesions. Figure 10 As shown in B 3. Spraying rice seedlings Wild-type P131, knockout k3, and complement k3C were conidially produced using the smear method. Conidia were washed off with 0.25‰ Tween-20 solution, and the conidial-mycelial mixture was filtered through lens paper and collected. The conidial concentration was adjusted to 5 × 10⁻⁶ using a hemocytometer. 5 1 spore / mL was sprayed onto the leaves of 28-day-old Lijiang Xintuan black rice. After 24 hours of dark and humidified culture at 28℃, followed by 5 days of alternating light and dark humidified culture, wild-type P131 and its complement both showed numerous typical rice blast fungus lesions, while the knockout strain K3 showed no lesions. Figure 10 As shown in C.

[0066] Example 7: Eukaryotic Expression and Purification of Pcg6 1. Construction of HEK293 cell protein expression vector: The vector was digested in a 50 μL system for later use. The system included: 2 μg of vector, 1.5 μL each of restriction endonucleases I and II, 10 μL of 5× buffer, and the remaining volume was made up with dd H2O. After digestion at 37℃ for 30 min, gel electrophoresis was performed to ensure that the vector was properly digested, and the vector was recovered using an agarose gel extraction kit.

[0067] Primer amplification sequences were designed based on the vector and the PCG6 sequence, including: 293-PCG6-F: GTTGATGCAGGTACCGCCACCATGAACAAGCTTGCC (SEQ ID No.: 14) 293-PCG6-R: GCTAGCAAGCTTCTCGAGTCATCGCTGGAAAGGCCC (SEQ ID No.: 15) The 50 μL amplification system consisted of: 2 μL template, 1 μL each of 10 μM forward and reverse primers, 25 μL 2× high-fidelity enzyme, and the remaining volume made up with dd H2O. Amplification was performed according to the following PCR program: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 2 min, and 72℃ final extension for 5 min, with 32 cycles of denaturation, annealing, and extension. After gel electrophoresis, the gel was dissected and fragments were recovered using an agarose gel extraction kit, ensuring a fragment concentration higher than 100 ng / μL.

[0068] After obtaining the recovered fragment and the double-digested vector, ligation can be performed using Lamborghini recombinase. A 10 μL recombinant system includes: 300 ng of the recovered fragment, 200 ng of the digested vector, 5 μL of the recombinase mixture, and the remaining volume made up with dd H2O. Ligation is performed at 50°C for 20 min. Trelief™ 5α Chemically Competent Cell competent cells are placed on ice beforehand. After thawing, 10 μL of the ligation product is added to 50 μL of competent cells and mixed well. The mixture is then incubated on ice for 25 min, followed by a 42°C water bath for 45 s, and then on ice for 2 min. 300 μL of antibiotic-free LB liquid medium is added, and the mixture is incubated at 37°C with a shaker at 180 rpm / min for 10 min. After incubation, the mixture is transferred to LB solid medium with the corresponding antibiotic, dried in a clean bench, and incubated overnight at 37°C. Subsequently, single colonies were picked and cultured, and PCR verification was performed using primers 293-PCG6-F and 293-PCG6-R. The bacterial culture that amplified the correct size bands was sent for sequencing.

[0069] 2. Cell transfection (1) Cell counting: Use a pipette tip to draw 1 mL of cells, place them on a hemocytometer, cover with a coverslip, and count them under an electron microscope. Calculate the number of cells per milliliter of cell suspension. The cell density should reach (greater than) 2 × 10⁻⁶ cells / mL. 6 Transfection can be achieved with a concentration of cells / mL.

[0070] (2) Calculation: 1.5 mg plasmid DNA was transfected into 1 L HEK293 cells.

[0071] (3) Prepare premixed solution: 4 mL PEI + plasmid DNA + SMM293-TII medium (add 5 mL PS (Penicillin-Streptomycin) to each liter of preheated fresh medium), total 50 mL, mix well, and let stand for 15 min.

[0072] (4) Add 50 mL of fresh culture medium (containing PS) per liter of cells and shake well. Add the "PEI-plasmid DNA-culture medium" premix and shake well, then let stand for 15 min.

[0073] (5) Place it in a carbon dioxide shaking incubator at 37°C and 5% CO2, and shake at 130 rpm / min for more than 60 h to express the target protein.

[0074] 3. Affinity Chromatography (1) Cell collection: Transfer HEK293 cells into a clean and dry 1 L centrifuge bottle and centrifuge at 3800×g for 10 min.

[0075] (2) Resuspending cells: Discard the supernatant, add 3 mL Tris lysis (20 mM Tris-HCl, 150 mM NaCl Buffer), vortex the cells, and wash each cell transfected with the same plasmid with 3 mL Tris lysis. Place the cells in a 50 mL centrifuge tube.

[0076] (3) Inhibit protease activity: Add 100×(100 mM) PMSF, 1000× protease inhibitors Leupeptin (5 mg / mL), Aprotinin (1.3 mg / mL) and Pepstatin (0.7 mg / mL).

[0077] (4) Cell disruption: Cell disruption is performed using an ultrasonic disruptor in an ice-water bath. To avoid local temperature rise leading to protein degradation, disrupt for 3 seconds and pause for 3 seconds. Usually, 1 L of cells is disrupted for about 1 minute, and so on.

[0078] (5) Ultracentrifugation: Transfer the cell disruption fluid into an ultracentrifuge tube, fill it completely, and balance it precisely. Centrifuge at 45,000 rpm / min for 1 h at 4℃.

[0079] (6) Column binding: In a cold room (4°C), continuously pour the supernatant into the Anti-Flag affinity column, resuspend the supernatant and the Anti-Flag column material, and transfer them into a 50 mL centrifuge tube and shake to bind for 1 h.

[0080] (7) Washing: Wash the affinity chromatography column with 30 mL (10 mL each time, three times) of the appropriate washing buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% DDM + 0.01% CHS).

[0081] (8) Elution: Elute the affinity column with 15 mL (5 mL each time, wash three times) of the appropriate elution buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% DDM + 0.01% CHS, 100 × Flag peptide).

[0082] (9) SDS-PAGE was performed on the collected solutions and precipitates from each tube to detect protein expression, such as... Figure 11 As shown.

[0083] 4. Gel filtration chromatography Using a concentration tube, the affinity-purified protein eluent is concentrated to approximately 8-10 mg / mL. This is then used in an ÄKTA protein purification system to separate proteins with significantly different molecular weights for further purification. The protein state is determined based on the elution time, and SDS-PAGE gel chromatography is used for analysis. Suitable gel chromatography samples are then pooled and concentrated, flash-frozen in liquid nitrogen, and stored at -80°C.

[0084] Example 8: Batch screening of compounds based on surface plasmon resonance (SPR) technology The specific operation using the Biacore8K high-throughput molecular interaction analyzer is as follows: (1) Power on. Rinse the tubing with Buffer A (1×PBS + 0.005% Tween 20), and select the appropriate pH and concentration to immobilize protein Pcg6 on the chip. (2) Install the chip. Use Buffer B (1×PBS + 0.005% Tween-20 + 5% DMSO) to gradient dilute the small molecules in the compound library. Set the kinetic program, place the small molecule sample holder, and start the program.

[0085] (3) After the program is completed, replace the maintenance chip and remove the small molecule sample holder. Clean the pipeline with ultrapure water. Perform data analysis.

[0086] The KD of Pcg6 and PN-16 is 90.9 μM, and the data results are as follows: Figure 12 As shown. The chemical structure of PN-16 is as follows. Figure 13 As shown.

[0087] Example 9 Activity determination of PN-16, a small molecule compound of the benzothiophene class. 1. Assay for rice blast fungus appressorium formation (1) Activate wild-type strains on OTA plates and culture them under light for 4-5 days in an incubator at 28℃. Use sterile toothpicks to scrape off the hyphae, shake them thoroughly to break them, add sterile water, spread them evenly on thick OTA plates, dry them in a clean bench, and then culture them in an incubator at 28℃.

[0088] (2) After 2 days, new mycelia can be seen on the surface of the plate. The mycelia are broken with cotton swabs. The surface of the plate is rinsed with sterile water and dried. A single layer of gauze is placed on the plate and placed in a 28℃ light incubator for further cultivation. After 2 days, a large number of conidia grow on the surface of the plate.

[0089] (3) Wash the conidia off with sterile water, filter them with microscope paper, and dilute the spore suspension to a concentration of 2×10⁻⁶ using a hemocytometer. 5 Quantity / mL, dispensed into multiple portions.

[0090] (4) Add different volumes of 40 mM PN-16 mother liquor to the spore suspension to prepare working solutions with final small molecule concentrations of 9 μM, 18 μM, 36 μM, 72 μM and 144 μM.

[0091] (5) The control group was supplemented with 0 μM PN-16, 1% DMSO and 72 μM Azo.

[0092] (6) Moisturize the culture dish with a square petri dish, place hydrophobic slides and mark them. Inoculate two hydrophobic slides for each concentration, and inoculate four points on each hydrophobic slide. Moisturize in the dark at 28°C.

[0093] (7) After 12 h, observe under a microscope. Take three inoculation points on each hydrophobic slide and record the number of appressoriums formed by 100 conidia at the center of each inoculation point. Take the average of 6 data points for each concentration and calculate the appressorium formation rate of wild-type rice blast fungus under each concentration of PN-16.

[0094] Data results as follows Figure 14 As shown in AB.

[0095] 2. Inoculation of barley with rice blast fungus (1) The preparation method of the spore suspension is the same as steps (1)-(3) in the determination of rice blast fungus appressorium formation, except that Tween-20 is added to make the final concentration 0.25‰. The spore concentration is adjusted to 5×10 using a hemocytometer. 4 Quantity / mL, dispensed into multiple portions.

[0096] (2) Add PN-16 stock solution to the spore suspension to make final concentrations of 36 μM and 72 μM. Dilute the PN-16 stock solution to 36 μM and 72 μM with 0.25‰ Tween-20 solution.

[0097] (3) Cut barley leaves that have grown to one leaf and one heart, fix the leaves in a petri dish after moisturizing, and spray with 0.25‰ Tween-20 solution to facilitate the inoculation of spore suspension.

[0098] (4) Three groups were set up for the inoculation experiment. The first group verified the preventive effect of PN-16: 36 μM and 72 μM PN-16 were inoculated for 12 h, followed by inoculation with blast fungus spore suspension, followed by 24 h in the dark at 28℃ and then light treatment for 72 h. The second group verified the antibacterial effect when blast fungus and PN-16 were present simultaneously: blast fungus spore suspensions with final concentrations of 36 μM and 72 μM were directly inoculated, followed by 24 h in the dark at 28℃ and then light treatment for 72 h. The third group verified the therapeutic effect of PN-16: spore suspension was inoculated, treated in the dark at 28℃ for 12 h, followed by inoculation with 36 μM and 72 μM PN-16, followed by light treatment at 28℃ for 72 h. Inoculation water, 1% DMSO and 36 μM Azo were used as controls to evaluate the effect of PN-16.

[0099] Data results as follows Figure 14 CD shown.

[0100] 3. Non-scratch inoculation of rice with *Magnapordia oryzae* (1) The method for preparing the spore suspension is the same as steps (1)-(3) in the determination of rice blast fungus appressorium formation. The spore concentration is adjusted to 5×10 using a hemocytometer. 4 Quantity / mL, dispensed into multiple portions.

[0101] (2) Dilute the PN-16 mother liquor to the corresponding concentration with 0.25‰ Tween-20 solution.

[0102] (3) Select the rice variety Xiangwanxian 11, cut rice leaves that have grown to the four-leaf stage, fix the leaves in a petri dish after moisturizing treatment, and spray with 0.25‰ Tween-20 solution to facilitate the inoculation of spore suspension.

[0103] (4) H2O, 1% DMSO, and 36 μM Azo were used as controls. Two groups were set up for the inoculation experiment. The first group verified the preventive effect of PN-16: PN-16 was spot-inoculated on the surface of rice leaves, cultured in an incubator at 28℃ for 24 h, and then spot-inoculated with spore suspension. After 24 h in the dark at 28℃, the plants were treated with light for 72 h. The second group verified the therapeutic effect of PN-16: After inoculation with spore suspension, the plants were treated in the dark at 28℃ for 24 h, and then spot-inoculated with PN-16. After 72 h of light treatment at 28℃, the plants were treated with light.

[0104] Data results as follows Figure 14 As shown in EF.

[0105] Pcg6 protein amino acid sequence (SEQ ID No.: 1): MNKLANMRHWSERMTPASFGMSSRPNGPMPAVGPGPHQKMASTSAPQQGPSHVLDSPLHYSFNVPLSSDLAGPDTEDILHATTDAVLRWTHPEDAPDDVPVHELPVHAQNLSNLRKLCKDFTTSPLDIEAHVISTTPKHIKGQVTTVCLSGAAELVYHARDTILNETPLTLRCTIIDIDGDMFLDPQTGGLKAPVTNTLDYTSSFCGVDIFLLGPKLTPLADGLNGDSEVRRDQRWRLAIYGDHLSSEHAKTRLLIHIDQMLGRVIDGLHAELTLHQPLCGRNRKTIKLIESTTRTAIYMPPSFSSVFRYCPVNAQARDPNQIFITGEDPAHIELAKKKMHEVLNRLRLFVKEVEIPSEKIDNILLSRMDKVQKITETFGTYISFPPLGSRKTIVRIQGQENLHIERTARELMALVGQFYSGFWSITQTDARQHPTAHDIHTMLGDICANSDADISFQRLAFRITGSDDAVKAALMVLSQIKFASQSTYQIKVKIELANEHKEFVSGKKNGKINKIMGQSSVQIMFEGFGEYNFNIDVNAQSYESMKQGLSLVEQEMPASISFHVPDQYHKRIIGIGGQHIQRIMKKHSVFVKFSNAMDRGGLREEDDIRVDNVICRTPARNAQNLELVKSEILEMVDRVDSEFTSQIVNVDRLYHRQLLTRLGEIEGLEKKWNCKIVFPSTEQASDEVTVTGPQWQVPQCVDEFLGMVSDNHELVLARTPTLIKYLESPEFAHDIVTKLKTQHEVEVTVHHNKDELTEEGEPTVTLLWTFTRNNAGGLRDAIEFLQNQFVTNGAEANVIKGSIPRPKSDTFEESLPFFNSRLLQHAPTPVATDSPTKLAFSDEVARERSTLFDRLRKPGSMSSISSFLDRRKNSSHAGANQFFKGSSNVSKSSLISIESTRSFNADRNPWNDSGVNLADDEPWPARPFGNGMDHKLTVPQPGDMTPRHHTRPSGDSGRPSTSHSTNSGYPGPVGPFQR。

Claims

1. The use of protein Pcg6, its variants, its orthologs, or functionally active fragments thereof in screening small molecule compounds against plant pathogenic fungi, wherein, The amino acid sequence of the protein Pcg6 is shown in SEQ ID NO: 1; the functionally active fragment refers to a polypeptide fragment containing a small molecule ligand-binding domain of the protein Pcg6. The orthologs are orthologs derived from the Discocephala subphylum that contain 7-9 KH domains with RNA-binding capabilities.

2. The use according to claim 1, characterized in that, The phylum Discomycota is selected from Fusarium graminearum, Sclerotinia sclerotiorum, Botrytis cinerea, and Aspergillus nidus.

3. The use according to claim 1, characterized in that, The plant pathogenic fungi are rice blast fungus, Fusarium, or Aspergillus nidus.

4. A method for screening candidate compounds against plant pathogenic fungi, the method comprising the following steps: 1) Provide protein Pcg6, its variants, its orthologs, or its functionally active fragments; 2) Under conditions that allow protein-compound interactions, contact the candidate compound with the protein from step 1; The test can detect whether the candidate compound binds to the protein, or detect the regulatory effect of the candidate compound on the activity of the protein. Compounds that can bind to or modulate the activity of the protein are selected as lead compounds for resistance against plant pathogenic fungi.

5. The method for screening candidate compounds against plant pathogenic fungi according to claim 4, characterized in that, The detection method is based on physical affinity detection techniques, including but not limited to: surface plasmon resonance, biomembrane interference, isothermal titration microcalorimetry, microscale thermophoresis, fluorescence thermal migration, or fluorescence polarization.

6. The method for screening candidate compounds against plant pathogenic fungi according to claim 4, characterized in that, The detection method is based on DNA-encoded compound library screening technology, which includes contacting a candidate compound library linked with DNA tags with an immobilized protein Pcg6, eluting unbound compounds, and identifying compounds that bind to protein Pcg6 by amplifying and sequencing the DNA tags.

7. A chip or biosensor for screening small molecule compounds against plant pathogenic fungi, characterized in that, The chip or biosensor comprises a solid support and protein Pcg6, its variants, its orthologs or functionally active fragments thereof immobilized on the surface of the solid support.

8. A chip or biosensor for screening small molecule compounds against plant pathogenic fungi according to claim 7, characterized in that, The chip is a surface plasmon resonance chip, and the protein Pcg6 is fixed on the dextran matrix or other modified layers on the chip surface by physical adsorption, covalent coupling or affinity capture.

9. A kit for screening small molecule compounds against plant pathogenic fungi, the kit comprising: 1) Protein Pcg6, its variants, its orthologs, or its functionally active fragments; 2) Buffer solution used to maintain protein activity.

10. A computer-aided virtual screening method, characterized in that, This includes performing molecular docking between the three-dimensional structure of candidate small molecules and the crystal structure or homology modeling structure of protein Pcg6, calculating the binding free energy, and thus predicting compounds with potential activity.

Citation Information

Patent Citations

  • Benzothiophene bactericide

    CN118666821A

  • Application of RNA (Ribonucleic Acid) binding protein CsdA in regulation and control of fungus secondary metabolites

    CN119504962A