Application of Os7TM-1 protein and coding gene thereof in regulation and control of low-temperature tolerance of plants

Abstract

The invention discloses an application of Os7TM-1 protein and a coding gene thereof in regulation and control of low-temperature tolerance of plants. The invention provides application of any one of A1)-A3) in regulation and control of low temperature resistance of plants. A1) a protein Os7TM-1; a2) a nucleic acid molecule for encoding the protein Os7TM-1; a3) a recombinant vector, an expression cassette or a recombinant bacterium containing a nucleic acid molecule encoding the protein Os7TM-1; experiments prove that after the expression of the Os7TM-1 gene in the rice plant is inhibited, the low temperature resistance of the plant is enhanced, and other important agronomic characters are not obviously changed. The invention has important theoretical significance and use value for plant breeding with the purpose of cultivating low-temperature-resistant plants, especially rice breeding with the purpose of cultivating low-temperature-resistant plants.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the application of an Os7TM-1 protein and its encoding gene in regulating plant low-temperature tolerance. Background Technology

[0002] During spring sowing in temperate rice-growing areas, rice is frequently subjected to alternating warm and cold temperatures, reducing its resistance and adaptability to "cold damage," thereby weakening its survival and tillering abilities and leading to large-scale yield reductions. Therefore, improving the cold tolerance of rice is crucial for the development of agriculture in my country.

[0003] Low temperatures inhibit plant growth and photosynthetic efficiency, and reduce cell membrane fluidity, ultimately affecting plant cold tolerance, by increasing reactive oxygen species levels, causing mechanical damage, and leading to metabolic dysfunction due to ice crystal formation. The cell membrane is a key site for plant cold sensing. Low temperatures cause conformational changes in the cell membrane, which in turn affect the state of membrane proteins or temperature receptors, enabling them to sense changes in external temperature and mediate transmembrane signal transduction. This process activates downstream second messengers (such as Ca2+). 2 Transmembrane proteins (TMPs, cAMP, etc.) convert physical signals into biological signals, ultimately triggering a low-temperature response in plants and enhancing their cold resistance. Studies show that approximately 20%-30% of plant genes encode transmembrane proteins. These proteins typically contain 1 to 20 hydrophobic transmembrane regions, as well as extracellular regions responsible for receiving external signals and intracellular regions responsible for transmitting signals. The extracellular regions receive external signals, triggering biochemical or physical changes in the transmembrane proteins, transmitting the external signals into the cell interior, and ultimately triggering a plant cell response to the external signals. Through long-term natural selection and evolution, plants have developed complex adaptation and response mechanisms to cope with environmental stresses. These mechanisms mainly help plants resist and adapt to adverse conditions by sensing environmental changes and regulating the expression of related genes. Therefore, membrane proteins play a crucial role in signal sensing and transmission in plant cells, intracellular and extracellular material transport, and environmental stress defense.

[0004] Cold tolerance in rice is a quantitative trait controlled by multiple genes, with a complex genetic basis and susceptibility to environmental influences, exhibiting both continuity and instability. Different genes control cold tolerance at different growth stages. According to existing literature, numerous cold tolerance genes or QTL loci have been identified at different growth stages, distributed across the 12 chromosomes of rice. While cold tolerance modules and genes in rice have been cloned and analyzed, few genes have been reported that can be applied to rice production. This may be related to the complex environmental factors in the field. Discovering and utilizing new cold tolerance genes and applying them to rice production to improve cold tolerance is one of the urgent problems to be solved in agricultural production. Summary of the Invention

[0005] The technical problem solved by this invention is how to improve the low-temperature tolerance of plants.

[0006] To address the aforementioned technical problems, the first aspect of this invention provides the application of any one of the following substances (A1)-A3) in regulating the low-temperature tolerance of plants;

[0007] A1) Protein Os7TM-1;

[0008] A2) Nucleic acid molecules encoding the protein Os7TM-1;

[0009] A3) Recombinant vectors, expression cassettes, or recombinant bacteria containing nucleic acid molecules encoding the protein Os7TM-1;

[0010] The protein Os7TM-1 is either B1) or B2) as follows:

[0011] B1) A protein consisting of the amino acid sequence shown in Sequence 2 of the sequence listing;

[0012] B2) Proteins derived from B1) with the same function, formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in Sequence 2 of the sequence listing.

[0013] The substitution and / or deletion and / or addition of one or more amino acid residues mentioned above constitutes a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0014] In the above applications, the nucleic acid molecule encoding the protein Os7TM-1 is a DNA molecule of any one of the following C1)-C3):

[0015] The C1 coding region is the DNA molecule shown in sequence 1 of the sequence listing;

[0016] C2) DNA molecules that hybridize with the DNA sequence defined by C1) under strict conditions and encode proteins with the same function;

[0017] DNA molecules encoding proteins of the same function whose DNA sequences defined by C3) and C1) have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology.

[0018] Secondly, the present invention provides the use of a substance for reducing the content and / or activity of protein Os7TM-1 in plants.

[0019] Alternatively, this invention provides the application of substances that reduce the content and / or activity of protein Os7TM-1 in plants in the cultivation of plants with improved low-temperature tolerance.

[0020] Alternatively, this invention provides a substance that reduces the expression of nucleic acid molecules encoding the protein Os7TM-1 in plants, and its application in cultivating plants with improved low-temperature tolerance.

[0021] In the above applications, the substance is a CRISPR / Cas9 system, and the target sequence of the sgRNA in the system is shown in sequence 5 or sequence 6 of the sequence listing.

[0022] In the above applications, the nucleotide sequence of the sgRNA is shown in Sequence 7 or Sequence 8 of the sequence listing.

[0023] In the above applications, the CRISPR / Cas9 system includes a plasmid containing the sgRNA coding sequence of the Os7TM-1 gene and the Cas9 coding sequence. In the embodiments of the present invention, the plasmid containing the sgRNA coding sequence of the Os7TM-1 gene and the Cas9 coding sequence is specifically the vector pTCRISPR-Os7TM-1-sgRNA1 or pTCRISPR-Os7TM-1-sgRNA2. The nucleotide sequence of pTCRISPR-Os7TM-1-sgRNA1 is sequence 9 in the sequence listing, and this vector expresses sgRNA1 (sequence 7) and Cas9. The nucleotide sequence of pTCRISPR-Os7TM-1-sgRNA2 is sequence A in the sequence listing, and this vector expresses sgRNA1 (sequence 8) and Cas9. Sequence A is formed by replacing the nucleotides at positions 520-539 of sequence 9 with the target sequence of sgRNA2 shown in sequence 6.

[0024] Thirdly, the present invention provides a method for cultivating transgenic plants resistant to low temperatures.

[0025] The method provided by this invention is as follows (D1) or (D2):

[0026] The method described in D1) includes the following steps: reducing the content and / or activity of protein Os7TM-1 in the target plant to obtain a transgenic plant;

[0027] The method described in D2) includes the following steps: reducing the expression of nucleic acid molecules encoding the protein Os7TM-1 in the target plant to obtain a transgenic plant;

[0028] The transgenic plant exhibits higher low-temperature tolerance than the target plant;

[0029] The protein Os7TM-1 is either B1) or B2) as follows:

[0030] B1) A protein consisting of the amino acid sequence shown in Sequence 2 of the sequence listing;

[0031] B2) Proteins derived from B1) with the same function, formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in Sequence 2 of the sequence listing.

[0032] In the above method, the reduction of the content and / or activity of protein Os7TM-1 in the target plant, or the reduction of the expression of nucleic acid molecules encoding protein Os7TM-1 in the target plant, are all achieved by gene editing of the target plant using the CRISPR / Cas9 system.

[0033] In the above method, the gene editing involves introducing a plasmid containing the sgRNA coding sequence of the Os7TM-1 gene and the Cas9 coding sequence into the target plant.

[0034] The target plant mentioned above is a monocotyledonous plant or a dicotyledonous plant.

[0035] Another objective of this invention is to provide a CRISPR / Cas9 system.

[0036] The system provided by this invention contains an sgRNA target sequence as shown in sequence 5 or sequence 6 of the sequence listing.

[0037] In the CRISPR / Cas9 system described above, the nucleotide sequence of the sgRNA is shown in Sequence 7 or Sequence 8 of the sequence listing.

[0038] The aforementioned CRISPR / Cas9 system includes plasmids containing the sgRNA coding sequence and the Cas9 coding sequence.

[0039] In embodiments of the present invention, the plasmids containing the sgRNA coding sequence and Cas9 coding sequence of the Os7TM-1 gene are specifically the vectors pTCRISPR-Os7TM-1-sgRNA1 or pTCRISPR-Os7TM-1-sgRNA2. The nucleotide sequence of pTCRISPR-Os7TM-1-sgRNA1 is sequence 9 in the sequence listing, and this vector expresses sgRNA1 (sequence 7) and Cas9. The nucleotide sequence of pTCRISPR-Os7TM-1-sgRNA2 is sequence A in the sequence listing, and this vector expresses sgRNA1 (sequence 8) and Cas9. Sequence A is formed by replacing the nucleotides at positions 520-539 of sequence 9 with the target sequence of sgRNA2 shown in sequence 6.

[0040] The experiments of this invention demonstrate that inhibiting the expression of the Os7TM-1 gene in rice plants enhances the plant's cold tolerance, while important agronomic traits such as the number of panicles per plant, the number of grains per panicle, and the thousand-grain weight remain largely unchanged. This invention has significant theoretical and practical value for plant breeding aimed at cultivating cold-tolerant plants, particularly for rice breeding. Attached Figure Description

[0041] Figure 1 The results of PCR amplification of the CDS sequence DNA of the Os7TM-1 gene are shown.

[0042] Figure 2 Physical map of the overexpression vector pUN1301-Os7TM-1.

[0043] Figure 3 For the observation of phenotypic characteristics and identification by Real-time PCR of overexpressing transgenic rice; A is the phenotypic observation of Os7TM-1 gene overexpressing lines before and after low-temperature treatment; B is the survival rate statistics of Os7TM-1 gene overexpressing lines after low-temperature treatment; C is the identification of the expression level of Os7TM-1 gene overexpressing lines.

[0044] Figure 4 Physical maps were constructed for the CRISPR mutant of the Os7TM-1 gene.

[0045] Figure 5 The sequence identification results of the os7tm-1 mutant are shown below; A is a schematic diagram of the mutation sites of the os7tm-1 mutant, B is the sequencing peak diagram of GLA4 (wild type) and os7tm-1 mutant at the first mutant site, and C is the sequencing peak diagram of GLA4 (wild type) and os7tm-1 mutant at the second mutant site. The arrows indicate the mutation sites.

[0046] Figure 6 A) Phenotypic observation and survival statistics of os7tm-1 mutant; B) Phenotypic observation of os7tm-1 mutant before and after low temperature treatment; C) Survival statistics of os7tm-1 mutant after low temperature treatment; D) Sequence alignment of mutation sites. Detailed Implementation

[0047] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0048] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0049] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0050] The Zhefu 802 rice (Oryza sativa L.cv Zhefu802) described in the following examples is documented in the following literature: Xia Yingwu et al., Breeding and Promotion of Early Indica Variety Zhefu 802, Science and Technology Bulletin, 1985, No. 1, p. 45; it is available to the public from the Institute of Botany, Chinese Academy of Sciences, and is hereinafter referred to as wild-type rice.

[0051] pTCRISPR vector (pYLCRISPR / Cas9P) ubi -H) is described in the following literature: Xingliang Ma et al., A robust CRISPR / Cas9 system for convenient, High-efficiency multiplexgenome editing in monocot and dicot plant. Molecular Plant, 2015, 8(8): 1274-1284.

[0052] EHA105 is described in the following literature: Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6:271–282, and is available to the public from the Institute of Botany, Chinese Academy of Sciences.

[0053] Zhonghua 11 (Oryza sativa L.cv Zhonghua11) is recorded in the following literature: Ni Pichong, Rice Variety—Zhonghua 11, Crop Variety Resources, No. 04, 1989, p. 42; it is available to the public from the Institute of Botany, Chinese Academy of Sciences.

[0054] Guangluai 4 (GLA4, Oryza sativa L.cv Guangluai4) is documented in the following literature: Lin Shicheng and Min Shaokai, Chinese Rice Varieties and Their Pedigrees, Shanghai Science and Technology Press, 1991, p. 310; it is available to the public from the Rice Research Institute of Guangdong Academy of Agricultural Sciences.

[0055] Example 1: Obtaining the gene encoding Os7TM-1 protein.

[0056] I. Obtaining the gene encoding the Os7TM-1 protein

[0057] Primers were designed based on the database analysis results. The 5′ primer is: 5′- GTCGACTCTAGAGGATCC -3′ (underlined sequence is the recombinant sequence of the BamH1 restriction site), 3′ primer: 5′- AAATTCGAGCTCGGTACC -3′ (underlined sequence is the Kpn1 restriction site recombination sequence) Total RNA was extracted from the three-leaf stage seedlings of indica rice Zhefu 802 (ZF802) and amplified to a full-length CDS of 1365bp using RT-PCR.

[0058] The specific operation process is as follows:

[0059] 1) Extraction of total plant RNA and synthesis of Os7TM-1 cDNA: 0.5g of seedlings of Zhefu 802 rice at the three-leaf stage were selected as material and ground in liquid nitrogen. The lyophilized powder ground in liquid nitrogen was transferred into a buffer containing 729μL of genomic extraction buffer (0.1M Tris-HCl (pH 8.0), 50mM EDTA (pH 8.0), 0.5M NaCl), followed by the addition of 18.4μL of β-mercaptoethanol and vigorous shaking to suspend the entire buffer. Then, 52.8μL of 20% thiocyanate preheated at 65℃ was added. SDS; incubate at 65℃ for 30 min, inverting and mixing every 5 min; then add 250 μL of 5M potassium acetate pre-chilled on ice, immediately invert and mix, and place on ice for 20 min; centrifuge at 12,000 g for 10 min at 4℃, and collect the supernatant; add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) to the supernatant, extract once, centrifuge at 12,000 g for 10 min at 4℃, and extract again with an equal volume of chloroform / isoamyl alcohol (24:1); collect the supernatant and add 0.6 volumes of isopropanol to precipitate the DNA, and place at -20℃ for 30 min; centrifuge at 12,000 g for 10 min at 4℃, and discard the supernatant; wash the precipitate twice with 1 mL of 70% ethanol; after drying, dissolve in 20 μL of ddH2O to obtain RNA. Take 2 μg of total plant RNA and reverse transcribe it into cDNA using the Applied Biosystems High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (catalog number: 4374966). The specific steps are as follows: Mix 2 μg RNA, 2.0 μL 10×RT buffer, 0.8 μL 25×dNTP Mix, 2.0 μL 10×RT Random Primers, 1.0 μL MultiScribe Reverse Transcriptase, 1.0 μL RNase Inhibitor, and 11.2 μL Nuclease-free H2O. Then, reverse transcribe the mixture in a PCR instrument to obtain cDNA. The reaction conditions are 25℃ for 10 min, 37℃ for 120 min, and 85℃ for 5 min.

[0060] 2) PCR amplification: Using the above cDNA as a template, perform PCR reaction according to the following system: 0.2 μL PrimerSTAR HSDNA Polymerase (5 U / μL), 10 μL 2×GC buffer, 2.0 μL dNTPs, 0.5 μL 5′ primer (10 μM), 0.5 μL 3′ primer (10 μM), and add ddH2O to a final volume of 20 μL.

[0061] Primer sequence 5′ end primer: 5′- GTCGACTCTAGAGGATCC ATGGCCGCCGCCTCGCCGCTC-3′ (underlined sequence is the recombinant sequence of the BamH1 restriction site), 3′ primer: 5′- AAATTCGAGCTCGGTACC TCATAGCTCAAATTCATCATC-3′ (the underlined sequence is the Kpn1 restriction site recombination sequence).

[0062] The PCR program was as follows: after pre-denaturation at 98℃ for 30 seconds, the PCR cycle was started. The cycle parameters were: denaturation at 98℃ for 15 seconds → annealing at 58℃ for 15 seconds → extension at 72℃ for 1 minute and 30 seconds. After 35 cycles, the synthesis was continued at 72℃ for 10 minutes.

[0063] PCR products were obtained.

[0064] The PCR products were separated by 0.8% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown in the figure, a band with a molecular weight of approximately 1.365 kb was obtained. This fragment was recovered using the AxyPrep DNA gel extraction kit, yielding 20 μL of the recovered product. Sequencing analysis revealed that the PCR product contained the nucleotide sequence of the Os7TM-1 gene CDS. The CDS sequence of the Os7TM-1 gene is Sequence 1. The nucleotide sequence of this PCR product was obtained by adding GTCGACTCTAGAGGATCC and GGTACCGAGCTCGAATTT to the 5' and 3' ends of Sequence 1, respectively.

[0065] The protein encoded by the Os7TM-1 gene is the Os7TM-1 protein, whose amino acid sequence is sequence 2 in the sequence listing.

[0066] II. Construction of the overexpression vector pUN1301-Os7TM-1

[0067] 1. Obtaining the pUN1301 vector

[0068] 1) Cut approximately 0.2g of maize seedlings (variety: Zhongzuo-Zhongdan 8, Beijing Zhongnongzuo Technology Development Co., Ltd.) and grind them in liquid nitrogen; then add 800μL of freshly prepared extraction buffer (containing 0.1M Tris-HCl pH 8.0, 50mM EDTA, 0.5M NaCl, 1% SDS and 1% β-mercaptoethanol), and shake vigorously to suspend them completely; incubate at 65℃ for 30 minutes, inverting and mixing every 5 minutes; then add 250μL of pre-cooled 5M potassium acetate aqueous solution, immediately invert and mix, and incubate on ice for 5 minutes; add an equal volume of phenol / chloroform, extract once, and centrifuge at 12000rpm for 5 minutes; collect the supernatant, add 0.6 times the volume of isopropanol to precipitate the DNA, and incubate at room temperature for 40 minutes; centrifuge at 12000rpm for 15 minutes at 4℃, and discard the supernatant; wash the precipitate once with 70% and once with 100% ethanol; after drying, dissolve in 20μL of solution containing 100μg / mL Maize genomic DNA was obtained by reacting RNase with ddH2O.

[0069] 2) Take 2 μL of the above maize genomic DNA solution as a template, and use the 5′ primer (5′-GG) with the Hind III recognition site. AAGCTT CTGCAGTGCAGCGTGACCCGG-3′) and a 3′ primer (5′-CG) with a BamHI recognition site. GGATCC Using primers (AAGTAACACCAAACAACAGGG-3′), PCR amplification was performed. The PCR reaction conditions were: 94℃ for 3 minutes; then 94℃ for 45 seconds, 62℃ for 45 seconds, 72℃ for 2 minutes, for a total of 35 cycles, and finally 72℃ for 10 minutes. After the reaction, the PCR product was detected by 0.8% agarose gel electrophoresis, which showed that an amplified fragment of approximately 2kb in length was obtained, consistent with the expected result. The target fragment was recovered and sequenced to confirm that it was the maize ubiquitin promoter (UbiPro).

[0070] The aforementioned maize ubiquitin promoter (UbiPro) can also be synthesized artificially.

[0071] 3) The Noster poly A termination sequence (277 bp) was excised from the plasmid vector pBI121 (Beijing Bairdy Biotechnology Co., Ltd. catalog number: MP-091) using restriction endonucleases Sac I and EcoRI, and ligated between the Sac I and EcoRI sites of the vector pUC19 (Beijing Baitek Biotechnology Co., Ltd. catalog number: DP7801) to obtain the recombinant vector, named pUC19-Noster. pUC19-Noster was then double-digested with restriction endonucleases HindIII and BamHI. After agarose gel electrophoresis, the linearized large fragment of the vector was recovered and ligated to the maize ubiquitin promoter (UbiPro) with sticky ends obtained in 2) by double digestion with HindIII and BamHI to obtain the recombinant vector, named pUN19.

[0072] 4) The recombinant vector pUN19 constructed in step 3) was partially digested with restriction endonuclease EcoRI and completely digested with HindIII. (At 37°C, EcoRI was added first for partial digestion for half an hour, followed by EcoRI inactivation at 65°C for 20 minutes, and then HindIII was added for complete digestion for 3 hours.) A fragment of approximately 2.3 kb containing UbiPro and Noster was excised from the recombinant vector pUN19 constructed in step 3. (The nucleotide sequence of this fragment is sequence 3, where positions 356-2342 of sequence 3 are the UbiPro sequence and positions 52-316 of sequence 3 are the Noster sequence.) This fragment was cloned into the EcoRI and HindIII sites of the plasmid vector pCAMBIA1301 (Biovector Co., LTD, catalog number Biovec-11) to obtain the recombinant vector, named pUN1301.

[0073] 2. Construction of pUN1301-Os7TM-1

[0074] The plasmid pUN1301 obtained in step 1 was double-digested with restriction endonucleases BamHI and KpnI. The digestion system consisted of 2 μL plasmid, 2 μL 10× digestion buffer, 0.5 μL BamHI (10 U / μL), and 0.5 μL KpnI (10 U / μL). ddH2O was added to bring the reaction volume to 20 μL, and the digestion was carried out at 37°C for 1 hour. The digestion products were separated by agarose gel electrophoresis, and the 4392 bp linearized pUN1301 fragment was recovered and dissolved in 20 μL ddH2O.

[0075] The 3 μL Os7TM-1 gene amplification fragment solution (PCR product) obtained in step one, 1 μL of the recovered pUN1301 large fragment solution, and 5 μL recombinase 2×SoSoo Mix Plus (Tsingke Biological Technology, catalog number TSV-S2) were mixed and incubated at 50 °C for 15 min. The resulting ligation product was transformed into E. coli DH5α competent cells, and positive clones were obtained by screening with kanamycin-containing antibiotic plates. The recombinant plasmid was extracted from the positive clones and sequenced for verification.

[0076] The recombinant plasmid was obtained by replacing the CDS nucleotides of the Os7TM-1 gene shown in Sequence 1 between the BamHI and KpnI restriction sites of pUN1301, and was named pUN1301-Os7TM-1. The sequences and structures of the promoter UbiPro, the gene Os7TM-1, and the terminator Noster in pUN1301-Os7TM-1 were correct (see...). Figure 2 The vector expresses the fusion protein Os7TM-1 (which consists of protein Os7TM-1 and GUS on the vector; the amino acid sequence of the fusion protein is Sequence 4, where positions 1-1231 of Sequence 4 are Os7TM-1 protein and positions 1232-1685 are GUS protein). The target fragment Os7TM-1 is overexpressed in plants using the maize ubiquitin promoter (UbiPro) in this expression vector.

[0077] III. Construction of Os7TM-1 gene CRISPR / Cas9 vector

[0078] 1) SgRNA target sequence design

[0079] The full-length CDS sequence of the Os7TM-1 gene was input into...

[0080] Visit http: / / www.e-crisp.org / E-CRISP / designcrispr.html and set the parameters as follows: select "Orzya sativa IRGSP-1.0.31" as the species, "Input is FASTA sequence" as the input format, "Start application" as "medium" as "Start SgRNA search" to perform an SgRNA sequence search. Select a conserved SgRNA sequence as the SgRNA sequence for the Os7TM-1 gene and design and synthesize two sgRNAs.

[0081] The target sequence of sgRNA1 is: 5′-GGGTGATCCGGAGCGACCCG-3′ (sequence 5);

[0082] The target sequence of sgRNA2 is: 5′-GACGCCGAAGAAGCCGAAGA-3′ (sequence 6).

[0083] 2) Construction of the recombinant vector pCRISPR-Os7TM-1

[0084] TGTG was added to the 5' end of the target sequence as a forward primer, and AAAAC was added to the reverse complementary 5' end of the target sequence as a reverse primer, resulting in the following primers:

[0085] Primers for sgRNA1 synthesis:

[0086] Forward: TGTGGGGTGATCCGGAGCGACCCG

[0087] Reverse: AAACCGGGTCGCTCCGGATCACCC

[0088] Primers for sgRNA2 synthesis:

[0089] Forward: TGTGGACGCCGAAGAAGCCGAAGA

[0090] Reverse: AAACTCTTCGGCTTCTTTCGGCGTC

[0091] The two synthetic primers for sgRNA1 (10 μM) were mixed in equal volumes and used in a PCR instrument to prepare Oligo dimers under the following conditions: 95℃ for 3 minutes, and then cooled to 20℃ at a rate of 0.2℃ / s to obtain the sgRNA1-encoded nucleic acid (Oligo dimer).

[0092] The two synthetic primers for sgRNA2 (10 μM) were mixed in equal volumes and used in a PCR instrument to prepare Oligo dimers under the following conditions: 95℃ for 3 minutes, and then cooled to 20℃ at a rate of 0.2℃ / s to obtain sgRNA2-encoded nucleic acid (Oligo dimers).

[0093] Take 2 μl of pTCRISPR vector and digest it with BasI enzyme. The digestion system is as follows:

[0094]

[0095] The enzyme was digested at 37℃ for 2 hours. The digestion products were separated by agarose gel electrophoresis. The 15900bp linearized pTCRISPR fragment was recovered and dissolved in 20μL ddH2O to obtain the linearized pTCRISPR vector.

[0096] Then, 1 μL of the linearized pTCRISPR vector was ligated to 3 μL of sgRNA1-encoded nucleic acid and sgRNA2-encoded nucleic acid, respectively, using T4 ligase. The ligation system is as follows:

[0097]

[0098] The resulting ligation product was transformed into *E. coli* DH5α competent cells, and positive clones were obtained through screening on kanamycin-containing resistant plates. Recombinant plasmids were extracted from the positive clones and sequenced for verification, yielding CRISPR vectors containing different sgRNA coding sequences and Cas9 coding sequences of the Os7TM-1 gene. Figure 4 ).

[0099] The nucleotide sequence of the CRISPR vector pTCRISPR-Os7TM-1-sgRNA1, which contains the sgRNA1 coding sequence of the Os7TM-1 gene and the Cas9 coding sequence (sequence 9, positions 2735-9338), is sequence 9 in the sequence listing. This vector expresses sgRNA1 (sequence 7) and Cas9.

[0100] The nucleotide sequence of the CRISPR vector pTCRISPR-Os7TM-1-sgRNA2, which contains the sgRNA2 coding sequence of the Os7TM-1 gene and the Cas9 coding sequence, is sequence A in the sequence listing. This vector expresses sgRNA2 (sequence 8) and Cas9.

[0101] Sequence A replaces the nucleotides shown in positions 520-539 of Sequence 9 with the target sequence of sgRNA2 shown in Sequence 6, while the other nucleotides remain unchanged.

[0102] IV. Obtaining Genetically Modified Rice

[0103] The above-mentioned pUN1301-Os7TM-1, pTCRISPR-Os7TM-1-sgRNA1, and pTCRISPR-Os7TM-1-sgRNA2 were transformed into Agrobacterium tumefaciens EHA105 by electroporation. The engineered bacteria with positive clones overexpressing CRISPR mutants were obtained by screening on plates containing kanamycin and rifampin and named EHA105 / pUN1301-Os7TM-1, EHA105 / pTCRISPR-Os7TM-1-sgRNA1, and EHA105 / pTCRISPR-Os7TM-1-sgRNA2.

[0104] The callus tissue of Zhonghua 11 was infected with EHA105 / pUN1301-Os7TM-1. The callus tissue introduced with EHA105 / pUN1301-Os7TM-1 was then washed 5 times with sterile water containing 300 mg / L cephalosporin. After being dried with sterile filter paper, it was transferred to N6D2S1 medium for screening of the first generation. Two weeks later, it was transferred to N6D2S2 medium for screening of the second generation (2 weeks / generation). The resistant callus tissue that had grown vigorously after 3 generations of screening was taken out and transferred to differentiation medium (1). It was cultured in a differentiation incubator (12-hour photoperiod, 28°C during the day and 25°C at night) for 7 days. Then it was transferred to differentiation medium (2) and cultured in a differentiation incubator until regenerated seedlings were produced. The regenerated plants were rooted and strengthened on the rooting and seedling culture medium. When the seedlings grew to about 10 cm, the sealing film of the container was opened and the seedlings were hardened off for 2-3 days. Then the seedlings were transferred to an artificial climate chamber for cultivation to obtain 10 T0 generation transgenic Os7TM-1 rice.

[0105] Then, EHA105 / pTCRISPR-Os7TM-1-sgRNA1 and EHA105 / pTCRISPR-Os7TM-1-sgRNA2 were used to infect Guanglu Dwarf 4 rice, respectively, to obtain 23 Os7TM-1-sgRNA1 gene CRISPR / Cas9 mutant rice and 20 Os7TM-1-sgRNA2 gene CRISPR / Cas9 mutant rice.

[0106] The culture media used are shown in Table 1 below:

[0107] Table 1 shows the culture medium formulations used.

[0108]

[0109]

[0110] V. Identification of transgenic rice overexpressing Os7TM-1

[0111] 1. GUS histochemical staining

[0112] Root segments of 2-3 mm length from 24 individual plants of the 10 T0 generation Os7TM-1 gene-transgenic rice lines obtained above were placed in GUS staining solution and then incubated at 37℃ for 1 hour. Lines with roots turning blue after staining were considered positive transgenic materials. The GUS staining solution (pH 7.0) consisted of: 100 mM Na3PO4 (pH 7.0), 0.1% Triton X-100, 10 mM EDTA, 0.5 mM potassium ferrocyanide, 0.5 mM potassium ferricyanide, and 1 mg / mL X-Gluc.

[0113] A total of 16 positive T0 generation transgenic Os7TM-1 rice plants were identified as a result of 10 strains.

[0114] Positive T0 generation transgenic Os7TM-1 rice was transplanted to a greenhouse for cultivation. Seeds were harvested according to different lineages to obtain T1 generation transgenic seeds. Based on this, homozygous T2 generation seeds were obtained through propagation. In subsequent experiments, seeds numbered 5 (OX5) were selected. ind / ZH11), 6(OX6) ind / ZH11), 8(OX8) ind The T2 generation of rice ( / ZH11) transformed into Os7TM-1 was used as the material.

[0115] 2. Quantitative PCR identification

[0116] From number 5 (OX5) ind / ZH11), 6(OX6) ind / ZH11), 8(OX8) ind Total RNA was extracted from T2 generation Os7TM-1 rice seedlings ( / ZH11). After treatment with RNase-free DNase I, 2 μg of total RNA was reverse transcribed into the first strand of cDNA using M-MLV reverse transcriptase. Gene-specific primers were designed using Primer Express 2.0 (Applied Biosystems), with Ubiqutin primers as an internal standard. Primer length was 20 bp, Tm value was 55-60℃, GC content was 40-60%, and the amplified target fragment length was 100-150 bp. Primers used for quantitative PCR detection are as follows:

[0117] 5′ primer: TTGGATTTGCCTTGGTCTAA

[0118] The 3′ primer is: ATGAAACCAAATGATGCTACAA

[0119] Ubiqutin primers

[0120] 5′ primer: CTTGGTCGTGTCCCGTTTC

[0121] 3′ primer: TTCTTCCATGCTGCTCTACCAC

[0122] Dilute the reverse transcription product 30 times, take 3 μl as a template, and use the SYBR Green PCR kit ( The reaction solution was prepared using GreenRealtime PCR Master Mix (Toyobo, Japan), and the system is as follows:

[0123]

[0124]

[0125] The PCR program was run on a real-time quantitative PCR instrument MX3000P (Stratagene, USA): 95℃ for 2 min; 95℃ for 15 s, 58℃ for 10 s, 72℃ for 15 s; for a total of 45 cycles; 95℃ for 30 s, 58℃ for 30 s, 95℃ for 30 s. The relative expression level of the gene was calculated based on the CT value.

[0126] The results are as follows Figure 3 As shown in C, when Ubiqutin was used as an internal control, compared with wild-type rice (ZH11), OX5 ind / ZH11、OX6 ind / ZH11 and OX8 ind The expression abundance of the Os7TM-1 gene in the T2 generation transgenic Os7TM-1 rice seedlings of / ZH11 was upregulated to varying degrees, indicating that the target gene (Os7TM-1) has been successfully expressed at the transcriptional level.

[0127] VI. Identification of CRISPR / Cas9 mutants of the Os7TM-1 gene

[0128] Leaves from the 23 Os7TM-1-sgRNA1 gene CRISPR / Cas9 mutant rice plants and the 20 Os7TM-1-sgRNA2 gene CRISPR / Cas9 mutant rice seedlings obtained in step four were collected. Genomic DNA was extracted from these lines. 2 μL of the genomic DNA solution was used as a template for amplification using Os7TM-1 gene CRISPR / Cas9 sequencing primers, as follows:

[0129] sgRNA1 primers

[0130] pCRISPR-1F:AATGAGCGTGAACAGCGAGA

[0131] pCRISPR-1R: TCATCATCCTTCTCCACCGC

[0132] sgRNA2 primers

[0133] pCRISPR-2F: GCGTGGAGAGGAAGAATCCC

[0134] pCRISPR-2R:CCGCAAAATCCCCAAATCCC

[0135] The PCR reaction conditions were as follows: 94℃ for 3 minutes; then 94℃ for 45 seconds, 62℃ for 45 seconds, 72℃ for 2 minutes, for a total of 35 cycles, and finally 72℃ for 10 minutes. After the reaction, the PCR products were detected by 0.8% agarose gel electrophoresis, which showed that an amplified fragment of approximately 1 kb in length was obtained, consistent with the expected result. The target fragment was recovered, and after sequencing, the lines with bimodal sequencing results were selected for propagation to obtain the T1 generation transgenic lines.

[0136] Based on this, T2 generation seeds were obtained through propagation, and after another round of identification and sequencing, homozygous T2 generation single plants were obtained.

[0137] Partial sequencing results as follows Figure 5 As shown, two homozygous mutant lines were identified in the T2 generation of the CRISPR / Cas9 mutant in the Os7TM-1-sgRNA1 gene, named os7tm-1-1 and os7tm-1-2; two homozygous mutant lines were identified in the T2 generation of the CRISPR / Cas9 mutant in the Os7TM-1-sgRNA2 gene, named os7tm-1-3 and os7tm-1-4.

[0138] Figure 6 C is the sequence alignment diagram of the mutation site.

[0139] The above four strains will be used as materials in subsequent experiments.

[0140] VII. Phenotypic Observation of Genetically Modified Rice

[0141] 1. Phenotypic observation of Os7TM-1 overexpression lines

[0142] Number OX5 ind / ZH11、OX6 ind / ZH11 and OX8 ind / ZH11 T2 generation transgenic Os7TM-1 rice seeds and Zhonghua 11 (WT) seeds were soaked in water at 30℃ for 3 days. After germination, they were placed in 96-well plates in Kimura B culture medium and kept in an artificial climate chamber (light intensity 10000 μmol / m²). 2 Seedlings were cultured at 30℃ for 14 hours per day (14 hours of light per day) until they reached the 3-leaf stage. The 3-leaf seedlings were then placed in a low-temperature water bath at 4℃ for 81 hours, and then transferred back to an artificial climate chamber to recover for 7 days. Photographs were taken and the survival rate was recorded. Each line consisted of 32 seedlings, and the experiment was repeated three times. The average result was taken.

[0143] The photographic results are as follows Figure 3As shown in Figure A, before the low-temperature treatment, there was no significant phenotypic difference between wild-type rice (ZH11) and the overexpression line; after 81 hours of treatment at 4℃ and 7 days of recovery, the tolerance of Os7TM-1 overexpression rice to low-temperature stress was significantly different from that of wild-type rice (ZH11).

[0144] Survival statistics for this result are as follows: Figure 3 As shown in Figure B, it can be seen that after treatment at 4℃ and subsequent recovery for 7 days, OX5 ind / ZH11、OX6 ind / ZH11 and OX8 ind The survival rates of T2 generation transgenic Os7TM-1 rice of / ZH11 were 23.44%, 5.28%, and 20.83%, respectively, while the survival rate of Zhonghua 11 was 50%.

[0145] It can be seen that the survival rate of Os7TM-1 rice after low-temperature treatment is lower than that of wild type, indicating that Os7TM-1 rice is more sensitive to low temperature.

[0146] 2. Phenotypic observation of os7tms-1 mutant

[0147] T2 generation seeds of os7tm-1-1, os7tm-1-2, os7tm-1-3, and os7tm-1-4, along with seeds of Guanglu Dwarf 4 (WT), were soaked in water at 30℃ for 3 days. After germination, they were placed in 96-well plates in Kimura B culture medium and kept in an artificial climate chamber (light intensity 10000 μmol / m²). 2 Seedlings were cultured at 30℃ for 14 hours per day (14 hours of light per day) until they reached the 3-leaf stage. The 3-leaf seedlings were then placed in a low-temperature water bath at 4℃ for 86 hours, followed by 7 days of recovery in an artificial climate chamber. Photographs were taken and the survival rate was recorded. Each line consisted of 32 seedlings, and the experiment was repeated three times. The average value of the results was taken.

[0148] The photographic results are as follows Figure 6 As shown in Figure A, before the low-temperature treatment, there was no obvious phenotypic difference between wild-type rice (GLA4) and the mutant line; after 24 hours of treatment at 4℃ and 7 days of recovery, the tolerance of the os7tm-1 mutant to low-temperature stress was significantly different from that of wild-type rice (GLA4).

[0149] Survival statistics for this result are as follows: Figure 6 As shown in B, after treatment at 4℃ and subsequent recovery for 7 days, the survival rates of os7tm-1-1, os7tm-1-2, os7tm-1-3, and os7tm-1-4 were 62.50%, 37.93%, 70.45%, and 59.90%, respectively, while the survival rate of Guanglu Dwarf 4 was 30.86%.

[0150] After low-temperature treatment at 4℃, the important agronomic traits such as number of spikes per plant, number of grains per spike, and thousand-grain weight of T2 generation seeds of os7tm-1-1, os7tm-1-2, os7tm-1-3 and os7tm-1-4 and Guanglu Dwarf 4 (WT) did not change significantly.

[0151] The above results indicate that the survival rate of os7tm-1 mutant rice after low-temperature treatment is significantly higher than that of wild type, suggesting that os7tm-1 mutant is more tolerant to low temperatures.

[0152] The composition of the above Kimura B culture medium is as follows:

[0153] Mother liquor A: 1L (200μL)

[0154]

[0155] Mother liquor for solution B: 1L (200μL)

[0156] Ca(NO3)2·4H2O 17.235g

[0157] EDTA-Fe mother liquor: 1L (1000μL)

[0158] Dissolve 5.57g FeSO4·7H2O in 200mL of distilled water, dissolve 7.45g Na2EDTA in 200mL of distilled water, heat the Na2EDTA solution, add the FeSO4·7H2O solution, stir constantly, cool, and then bring the volume to 1L.

[0159] Trace element stock solution: 1L (1000 μL)

[0160]

[0161] Sodium silicate: 100-300 mg per liter of Kimura B culture medium

[0162] 1 mol / L HCl: 8.17 mL 37% HCl was diluted with distilled water to 1000 mL.

[0163] Adjust the pH of Kimura B culture medium to 5.8 using 1 mol / L HCl.

[0164] In practical applications, take 5 mL of stock solution A, 5 mL of stock solution B, 1 mL of stock solution EDTA-Fe, 1 mL of stock solution of trace elements, and 100-300 mg of sodium silicate, mix them, dilute with distilled water to 1 L, and adjust the pH of Kimura B culture medium to 5.8 with 1 mol / L HCl to obtain 1 IL of Kimura B culture medium.

[0165] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of any one of the substances (A1)-A3) below in regulating the low-temperature tolerance of plants; A1) Protein Os7TM-1; A2) Nucleic acid molecules encoding the protein Os7TM-1; A3) Recombinant vectors, expression cassettes, or recombinant bacteria containing nucleic acid molecules encoding the protein Os7TM-1; The protein Os7TM-1 is either B1) or B2) as follows: B1) A protein consisting of the amino acid sequence shown in Sequence 2 of the sequence listing; B2) Proteins derived from B1) with the same function, formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in Sequence 2 of the sequence listing.

2. The application according to claim 1, characterized in that: The nucleic acid molecule encoding the protein Os7TM-1 is a DNA molecule of any one of the following C1)-C3): The C1 coding region is the DNA molecule shown in sequence 1 of the sequence listing; C2) DNA molecules that hybridize with the DNA sequence defined by C1) under strict conditions and encode proteins with the same function; DNA molecules encoding proteins of the same function whose DNA sequences defined by C3) and C1) have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology.

3. Application of substances that reduce the content and / or activity of protein Os7TM-1 in plants in the cultivation of cold-resistant plants; Alternatively, substances that reduce the expression of nucleic acid molecules encoding the protein Os7TM-1 in plants may be used in the cultivation of cold-resistant plants.

4. The application according to claim 3, characterized in that: The substance is a CRISPR / Cas9 system, and the target sequence of the sgRNA in the system is shown in sequence 5 or sequence 6 of the sequence listing.

5. The application according to claim 4, characterized in that: The nucleotide sequence of the sgRNA is shown in Sequence 7 or Sequence 8 of the sequence listing.

6. The application according to claim 4 or 5, characterized in that: The CRISPR / Cas9 system includes a plasmid containing the sgRNA coding sequence and the Cas9 coding sequence.

7. A method for cultivating low-temperature resistant transgenic plants, comprising the following D1) or D2): The method described in D1) includes the following steps: reducing the content and / or activity of protein Os7TM-1 in the target plant to obtain a transgenic plant; The method described in D2) includes the following steps: reducing the expression of nucleic acid molecules encoding the protein Os7TM-1 in the target plant to obtain a transgenic plant; The transgenic plant exhibits higher low-temperature tolerance than the target plant; The protein Os7TM-1 is either B1) or B2) as follows: B1) A protein consisting of the amino acid sequence shown in Sequence 2 of the sequence listing; B2) Proteins derived from B1) with the same function, formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in Sequence 2 of the sequence listing.

8. The method according to claim 7, characterized in that: The reduction of the content and / or activity of protein Os7TM-1 in the target plant, or the reduction of the expression of nucleic acid molecules encoding protein Os7TM-1 in the target plant, are both achieved by gene editing of the target plant using the CRISPR / Cas9 system described in any one of claims 4-6.

9. The method according to claim 8, characterized in that: The gene editing involves introducing a plasmid containing the sgRNA coding sequence and the Cas9 coding sequence into the target plant.

10. A CRISPR / Cas9 system wherein the sgRNA target sequence is shown in Sequence 5 or Sequence 6 of the sequence listing.

Images