Application of CcMYB1R1 protein and gene in regulation and control of capsaicin substance content of pepper fruits
By cloning and expressing the CcMYB1R1 protein and gene, the synthesis of capsaicin-like substances was regulated, which solved the gap in the regulation of capsaicin-like substance synthesis pathways in existing technologies, effectively improved the quality of chili pepper fruits, and provided genetic resources for the creation of new chili pepper germplasm.
Patent Information
- Application Number
- CN202610012594.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-07
- Publication Date
- 2026-03-13
AI Technical Summary
Current research on the transcriptional regulation of capsaicin synthesis mainly focuses on synthase genes, while research on how upstream transcription factors, especially MYB family transcription factors, regulate the capsaicin synthesis pathway is still lacking, which affects the targeted breeding effect of improving the quality of chili fruits.
By cloning and expressing the CcMYB1R1 protein and gene, the synthesis of capsaicinoids was regulated, including increasing or decreasing their content. Overexpression and silencing techniques were used to regulate the expression level of the CcMYB1R1 gene, thereby affecting the expression of key genes in the capsaicinoid synthesis pathway.
Effective regulation of capsaicin content in chili pepper fruits significantly affects fruit quality, provides genetic targets and materials for the creation of new chili pepper germplasm, deepens the understanding of the secondary metabolic regulatory network of chili pepper fruits, and lays a theoretical foundation for the improvement of chili pepper fruit quality.
Smart Images

Figure CN121652250A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically involving the application of CcMYB1R1 protein and gene in regulating the content of capsaicin-like substances in chili pepper fruits. Background Technology
[0002] chili( Capsicum spp. Capsai, an important vegetable and economic crop in China, is rich in capsaicin-like substances in its fruit. These substances are a class of secondary metabolites specifically synthesized in plants of the Capsai genus. As key defense mechanisms within the plant, they effectively inhibit pathogen infection, thereby enhancing the plant's disease resistance. Further research has shown that capsaicin-like substances exhibit broad potential in the medical and health fields, demonstrating inhibitory effects on the growth of various malignant tumors and possessing significant anti-inflammatory and antibacterial activities.
[0003] Capsaicinoids are amide compounds formed by the condensation of C9-C11 branched-chain fatty acids and vanillylamine. Their biosynthesis involves the synergistic action of two main metabolic pathways: the phenylalanine pathway and the branched-chain fatty acid pathway. In the phenylalanine pathway, the precursor phenylalanine is successively converted to vanillylamine via key enzymes such as phenylalanine ammonia-lyase (PAL), cinnamate-4-hydroxylase (C4H), 4-coumaryl-CoA ligase (4CL), hydroxycinnamyltransferase (HCT), and caffeic acid O-methyltransferase (COMT). This process is the main source of capsaicin. In the branched-chain fatty acid pathway, the starting material valine gradually generates 8-methyl-6-decenoyl through a series of reactions including transamination, decarboxylation, and fatty acid chain elongation. Finally, the products of both pathways—vanillylamine and 8-methyl-6-decenoyl—form the capsaicinoid end products under the catalysis of capsaicin synthase.
[0004] Capsaicin content is a key indicator for evaluating the quality and economic value of chili peppers. Understanding the transcriptional regulatory mechanisms of capsaicin biosynthesis is crucial for targeted improvement of chili varieties through molecular breeding. However, current research in this field largely focuses on verifying the function of synthase genes, while studies on how upstream transcription factors, particularly MYB family transcription factors, regulate the capsaicin synthesis pathway remain largely unexplored. Summary of the Invention
[0005] The purpose of this invention is to provide the application of CcMYB1R1 protein and gene in regulating the capsaicin content of chili pepper fruit. The CcMYB1R1 protein can regulate the capsaicin content and is used to create new chili pepper germplasm.
[0006] This invention provides a CcMYB1R1 protein that regulates the content of capsaicin-like substances, the amino acid sequence of which is shown in SEQ ID NO.1.
[0007] The present invention also provides encoding the CcMYB1R1 protein described in the above scheme. CcMYB1R1 Genes, the ones mentioned CcMYB1R1 The nucleotide sequence of the gene is shown in SEQ ID NO.2.
[0008] The present invention also provides the CcMYB1R1 protein described in the above-described scheme or the [other protein described above]. CcMYB1R1 Application of genes in regulating capsaicin content and / or creating new chili germplasm.
[0009] As a preferred embodiment, the regulation includes: increasing the CcMYB1R1 protein content or CcMYB1R1 Increased gene expression levels lead to higher capsaicin content; Reduce CcMYB1R1 protein content or CcMYB1R1 The gene expression level decreases the content of capsaicin-like substances.
[0010] As a preferred embodiment, the capsaicinoids include capsaicin and dihydrocapsaicin.
[0011] This invention also provides a regulation CcMYB1R1 Biological materials with high gene expression levels, the CcMYB1R1 The nucleotide sequence of the gene is shown in SEQ ID NO.2.
[0012] As a preferred option, overexpression is included. CcMYB1R1 Biological materials for gene expression; the overexpression CcMYB1R1 Biological materials for gene amplification include amplification. CcMYB1R1 Primer set of genes, containing CcMYB1R1 Recombinant gene expression vectors and those containing CcMYB1R1 One or more of the recombinant genes of microorganisms.
[0013] As a preferred option, it includes suppression CcMYB1R1 Gene expression or knockout CcMYB1R1 Biological materials containing genes, wherein the method of inhibition includes silencing.
[0014] As a preferred embodiment, the suppression CcMYB1R1 Biological materials for gene expression include silencing expression vectors; the silencing expression vector includes a gene silencing vector backbone and... CcMYB1R1 Silent gene fragments; The CcMYB1R1 The nucleotide sequence of the silenced gene fragment is shown in SEQ ID NO.29.
[0015] The present invention also provides a method for regulating the content of capsaicin-like substances in chili pepper fruits by introducing the biological material described in the above scheme into the recipient chili pepper fruits.
[0016] Beneficial effects: The present invention provides a CcMYB1R1 protein that regulates the content of capsaicin-like substances, the amino acid sequence of which is shown in SEQ ID NO.1. CcMYB1R1 It is a key transcription factor regulating the synthesis of capsaicin-like substances in chili pepper fruits, promoting the biosynthesis of capsaicin-like substances and playing an important regulatory role in the formation of chili pepper fruit quality. This is achieved by regulating the content of the CcMYB1R1 protein or... CcMYB1R1 Gene expression levels can effectively regulate the content of capsaicin-like substances in chili pepper fruits, providing direct genetic targets and important genetic materials for cultivating new chili pepper germplasm. As verified in the embodiments of this invention, in... CcMYB1R1 In transgenic plants with suppressed gene expression, capsaicin synthesis was significantly reduced, and the expression levels of related genes in the capsaicin synthesis pathway were significantly downregulated; while CcMYB1R1 In transgenic plants with gene overexpression, the synthesis of capsaicin-like substances increases, and the expression levels of related genes are significantly upregulated. This invention provides... CcMYB1R1 This study provides new key gene resources for elucidating the regulatory network of secondary metabolism in chili pepper fruits, deepens the understanding of the genetic mechanism of chili pepper fruit quality, especially the synthesis of capsaicin-like substances, and lays a theoretical foundation and provides effective technical means for the targeted genetic improvement of important agronomic traits of chili pepper fruits. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0018] Figure 1 Different tissues at different developmental stages of pepper fruit CcMYB1R1 Difference graph; Figure 2 This is a diagram showing the subcellular localization results of MYB1R1-GFP; different lowercase letters indicate significant differences in the data. Figure 3 for CcMYB1R1 The graph shows the changes in capsaicin content and expression levels of genes related to capsaicin synthesis in chili pepper fruits after gene silencing; where a represents the changes in expression levels of genes related to capsaicin synthesis; and b represents the capsaicin content in chili pepper fruits. Figure 4 for CcMYB1R1 The graph shows the changes in capsaicin content and expression levels of genes related to capsaicin synthesis in chili pepper fruits after gene overexpression; where a is the GUS staining result; b is the change in expression levels of genes related to capsaicin synthesis; and c is the capsaicin content in chili pepper fruits. Figure 5 for CcMYB1R1 Figure 1 shows the validation results of downstream target genes for gene regulation; where a is the yeast one-hybrid result; b-c are the gel migration experiment results; d is a schematic diagram of the construction of the 62SK::CcMYB1R1 and 0800-LUC::CcCOMT vectors; e is the in vivo imaging result of tobacco leaves; and f is the quantitative detection result of dual-luciferase activity. In the picture This indicates a significant difference in the data, p < 0.05; This indicates a significant difference in the data, p < 0.01; This indicates a significant difference in the data, p < 0.001. Detailed Implementation
[0019] This invention provides a CcMYB1R1 protein that regulates the content of capsaicin-like substances. The amino acid sequence of the CcMYB1R1 protein is shown in SEQ ID NO.1: MSSACGDESSATEVTGAGEIMLFGVRVKVDPMRKSVSLNNLSQYEQPNINNSGGDSKNESLKVAADEGYASADDAVQHQSNCGRERKRGVPWTEEEHKLFLLGLQKVGKGDWRGISRNFVKSRTPTQVASHAQKYFLRRSNLNRRRRRSSLFDITTDSVSAMPKVEGENTQEIPVLAPATLPTVETTKTNAFPVAPAVGPIMIPAQIDMSRDSPTLLQRDHGNSSMLVGAVPMFSLPNPSPVIDLNANQNTTIEPSPLSLRLSLSLDQGQASSTRHLGYQVMSSFSNGESIISVA. CcMYB1R1 It is a key transcription factor regulating the synthesis of capsaicin-like substances in chili pepper fruits, as described in the examples. CcMYB1R1 It was obtained from Yunnan chili pepper hot pot using molecular cloning technology.
[0020] The present invention also provides encoding the CcMYB1R1 protein described in the above scheme. CcMYB1R1 Genes, the ones mentioned CcMYB1R1The nucleotide sequence of the gene is shown in SEQ ID NO.2: 5'-ATGTCCAGCGCGTGCGGTGATGAATCATCGGCGACGGAAGTTACCGGCGCCGGTGAAATCATGTTGTTTGGCGTGAGAGTGAAAGTCGATCCTATGAGGAAGAGCGTCAGTCTCAACAATCTCTCACAGTACGAACAGCCGAATATTAACAACTCCGGCGGTGATAGCAAAAATGAATCGTTGAAAGTGGCGGCTGATGAAGGTTATGCCTCTGCAGATGATGCTGTTCAACATCAGTCTAACTGTGGACGTGAGCGTAAGCGAGGAGTTCCTTGGACAGAGGAAGAGCACAAGTTATTCCTTCTAGGATTGCAGAAAGTGGGTAAAGGAGACTGGAGAGGAATCTCTAGAAACTTCGTAAAGTCTCGTACGCCGACGCAGGTTGCAAGTCATGCTCAGAAGTATTTTCTCCGTCGAAGCAACCTCAACCGCCGTCGTCGCCGATCTAGCCTCTTTGATATCACCACTGACTCGGTATCAGCAATGCCAAAAGTAGAAGGGGAAAATACGCAAGAAATCCCAGTTCTAGCACCAGCAACATTGCCTACTGTAGAAACTACCAAAACAAATGCATTTCCGGTGGCACCGGCTGTTGGTCCTATCATGATACCAGCGCAGATTGATATGTCAAGAGATAGTCCAACGCTGTTGCAACGCGATCATGGGAATTCATCAATGCTGGTTGGTGCTGTTCCTATGTTTTCACTGCCCAATCCATCACCAGTGATTGACCTTAATGCGAACCAGAACACAACAATTGAGCCCTCGCCTTTGTCACTGAGATTATCATTGTCACTTGATCAGGGACAAGCATCATCTACTAGACACCTGGGATATCAAGTCATGTCAAGCTTCAGTAATGGAGAAAGCATCATCAGTGTGGCATGA-3'.
[0021] The present invention also provides the CcMYB1R1 protein described in the above solution or the CcMYB1R1Application of genes in regulating capsaicin content and / or creating new chili germplasm.
[0022] As one implementation method, the regulation includes: increasing the CcMYB1R1 protein content or CcMYB1R1 Increased gene expression levels lead to higher capsaicin content; decreased CcMYB1R1 protein content or CcMYB1R1 The gene expression level is reduced, resulting in a lower content of capsaicin-like substances. This invention utilizes VIGS technology to silence the gene expression of capsaicin-like substances in chili pepper fruits. CcMYB1R1 After gene sequencing, the content of capsaicin-like substances in the silenced samples was significantly reduced, and key structural genes in the capsaicin-like substance synthesis pathway included Cc4CL , CcACL , CcFatA , CcACS , CcKAS , CcBCAT , CcCOMT and CcHCT Expression levels were significantly downregulated. Conversely, overexpression... CcMYB1R1 In chili pepper fruits, the expression of the aforementioned structural genes for capsaicin biosynthesis was upregulated to varying degrees. These results indicate that CcMYB1R1 regulates the biosynthesis and accumulation of capsaicin by modulating the expression of multiple key genes in the capsaicin biosynthesis pathway, thereby affecting the formation of chili pepper fruit quality. CcMYB1R1 Genes can be used to regulate the synthesis of capsaicin-like substances in chili peppers and to genetically improve fruit quality.
[0023] In one embodiment, the capsaicinoids include capsaicin and dihydrocapsaicin.
[0024] This invention also provides a regulation CcMYB1R1 Biological materials with high gene expression levels, the CcMYB1R1 The nucleotide sequence of the gene is shown in SEQ ID NO.2.
[0025] As one implementation method, it includes overexpression CcMYB1R1 Biological materials for gene expression; the overexpression CcMYB1R1 Biological materials for gene amplification include amplification. CcMYB1R1 Primer set of genes, containing CcMYB1R1 Recombinant gene expression vectors and those containing CcMYB1R1 One or more of the recombinant genes of microorganisms. As one implementation method, the amplification... CcMYB1R1 The primer set for the gene includes the upstream primer shown in SEQ ID NO.3 (5'-ATGTCCAGCGCGTGCGGT-3') and the downstream primer shown in SEQ ID NO.4 (5'-TCATGCCACACTGATGATGC-3'). As one embodiment, the primer containing... CcMYB1R1 The basic vector for recombinant gene expression includes the pCambia1301 vector; in a specific embodiment of the present invention, the... CcMYB1R1 The gene was inserted between the Nco I and Bgl II restriction sites of the pCambia1301 vector to construct the desired gene. CcMYB1R1 Overexpression vector. As one implementation, the vector containing... CcMYB1R1 The basic strains of recombinant microorganisms include Agrobacterium.
[0026] As one implementation method, it includes suppressing CcMYB1R1 Gene expression or knockout CcMYB1R1 Biological materials containing genes, wherein the method of inhibition includes silencing.
[0027] As one implementation method, the suppression CcMYB1R1 Biological materials for gene expression include silencing expression vectors; the silencing expression vector includes a gene silencing vector backbone and... CcMYB1R1 Silent gene fragments; The CcMYB1R1 The nucleotide sequence of the silenced gene fragment is shown in SEQ ID NO.29: 5'-TGAAAGTGGCGGCTGATGAAGGTTATGCCTCTGCAGATGATGCTGTTCAACATCAGTCTAACTGTGGACGTGAGCGTAAGCGAGGAGTTCCTTGGACAGAGGAAGAGCACAAGTTATTCCTTCTAGGATTGCAGAAAGTGGGTAAAGGAGACTGGAGAGGAATCTCTAGAAACTTCGTAAAGTCTCGTACGCCGACGCAGGTTGCAAGTCATGCTCAGAAGTATTTTCTCCGTCGAAGCAACCTCAACCGCCGTCGTCGCCGATCTAGCCTCTTTGATATCACCACTGACTCGGTATCAG-3'.
[0028] This invention also provides a method for regulating the capsaicin content in chili pepper fruits by introducing the biological material described above into recipient chili pepper fruits. This invention does not specifically limit the method of introduction; conventional methods in the art can be used.
[0029] The present invention CcMYB1R1 Gene expression patterns were significantly correlated with the synthesis and accumulation of capsaicin-like substances in chili pepper fruits. Transient overexpression in chili pepper fruits... CcMYB1R1The gene can effectively promote the synthesis and accumulation of capsaicin and significantly upregulate the expression levels of several key genes for capsaicin synthesis. After inhibiting the expression of this gene using VIGS technology, the content of capsaicin in pepper fruits was significantly reduced, and the expression of genes in multiple synthesis pathways was significantly downregulated. CcMYB1R1 The cloning and functional verification of genes not only provide key theoretical basis for elucidating the molecular regulatory mechanism of capsaicin biosynthesis, but also lay an important technical foundation for the targeted improvement of chili fruit quality and the cultivation of new chili varieties with high capsaicin content through molecular breeding, and have broad prospects for industrial application.
[0030] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0031] In this embodiment of the invention, the chili pepper used is Yunnan chili pepper, which is grown in the planting greenhouse of Yunnan Agricultural University Dian-Tai Center in Panlong District, Kunming City, Yunnan Province.
[0032] Example 1 (1) CcMYB1R1 Gene cloning and sequence structure analysis Total RNA was extracted from mature fruits of Yunnan chili peppers (specifically, those from the Sichuan peppercorn variety "Shuanla") using the SteadyPure RNA Extraction Kit (Hunan Aike Rui Biotechnology Co., Ltd.), following the manufacturer's instructions. The extracted RNA samples were analyzed for concentration using a micro spectrophotometer, and their integrity was assessed by agarose gel electrophoresis.
[0033] Following the instructions of the HiScript III First-Strand cDNA Synthesis Kit (+gDNA wiper), first-strand cDNA was synthesized using extracted total RNA as a template. After optimizing the conditions, an appropriate amount of reverse transcription product was used as a PCR template, and amplification was performed using conventional PCR methods. CcMYB1R1 Gene coding region. The upstream and downstream primer sequences used for amplification are shown in SEQ ID NO.3 (5'-ATGTCCAGCGCGTGCGGT-3') and SEQ ID NO.4 (5'-TCATGCCACACTGATGATGC-3'), respectively.
[0034] The 25 μL PCR reaction mixture consisted of: 12.5 μL PrimeSTAR® Max DNA Polymerase, 1 μL each of forward and reverse primers, 1 μL template, and 9.5 μL ddH2O. The reaction program was: 98℃ for 2 min; 98℃ for 10 sec, 55℃ for 15 sec, 72℃ for 60 sec, for 35 cycles.
[0035] PCR products CcMYB1R1 After purification and recovery, the gene was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. CcMYB1R1 The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.1.
[0036] (2) Different parts of the chili pepper fruit at different developmental stages CcMYB1R1 Gene expression analysis in different tissues of pepper fruit Placental and pulp tissues were collected from Yunnan chili peppers at seven different stages of fruit development: 10, 20, 30, 40, 50, 60, and 70 days after flowering. Tissue samples taken 10 days after flowering (10 DPA) served as controls. Total RNA was extracted from each tissue. Real-time quantitative PCR (qRT-PCR) was used to systematically determine the RNA content. CcMYB1R1 The relative expression levels of genes in different developmental stages and tissues were determined, with ACTIN as the internal reference gene. The qRT-PCR reaction system consisted of 1 μg total RNA, 1 μL Oligo(dT) 23 VN (50 μM), and RNase-free ddH2O added to a final volume of 12 μL. The reaction procedure was as follows: after preparing the mixture, the mixture was placed in a PCR instrument at 65°C for 5 min, then incubated on ice for 2 min. Subsequently, 4 μL of 4×g DNA wiper Mix was added to remove genomic DNA and mixed thoroughly. The mixture was then placed in a PCR instrument at 42°C for 2 min. After the reaction, 2 μL of 10×RT Mix and 2 μL of HiScript II Enzyme Mix were added to the mixture and mixed thoroughly. The mixture was then placed in a PCR instrument again and incubated at 50°C for 45 min and 85°C for 2 min. After the reaction, the mixture was stored at -20°C for later use.
[0037] Primers used for qRT-PCR: CcMYB1R1 -F (SEQ ID NO.23): 5'-ACTGTGGACGTGAGCGTAAG-3'; CcMYB1R1 -R (SEQ ID NO. 24): 5'-TTGCTGGTGCTAGAACTGGG-3'; ACTIN-F (SEQ ID NO. 25): 5'-GCCTAGAAATTTGAGCCTCATT-3'; ACTIN-R (SEQ ID NO. 26): 5'-AAGATGGTATTGTTGCTGATGG-3'.
[0038] Different developmental stages and tissues of pepper fruit CcMYB1R1 Gene expression analysis results as follows Figure 1 As shown in Table 1, this gene is expressed in both the placenta and the pulp tissue, but the expression levels differ significantly. CcMYB1R1 Similar expression dynamics were observed in both the placenta and pulp tissues, showing a trend of first rising, then falling, and then rising again. Specifically, the expression peak in the placenta tissue occurred 30 days after flowering (30 DPA), while the expression peak in the pulp tissue occurred 50 days after flowering (50 DPA).
[0039] Table 1. Different developmental stages and tissues of pepper fruit CcMYB1R1 Gene expression analysis results
[0040] (3) CcMYB1R1 Gene subcellular localization The pC1300s-GFP transient fluorescent expression vector (BioVector NTCC Typical Culture Collection Center, Beijing) was linearized using Sac I and BamHI restriction endonucleases to obtain a linearized pC1300s-GFP vector. Simultaneously, CcMYB1R1 ORF cloning primers (forward primer and reverse primer) containing homologous arms of the pC1300s-GFP vector were designed, and PCR amplification was performed to obtain the vector. CcMYB1R1 The CDS region of the gene is used as the insertion fragment.
[0041] PCR amplification was performed using the purified amplified product of the CcMYB1R1 gene as a template. The reaction mixture consisted of 2 μL each of forward and reverse primers, 2 μL of cDNA, 19 μL of ddH2O, and 25 μL of PrimeSTAR® Max DNA Polymerase. The reaction program was as follows: 98℃ for 120 s; 98℃ for 10 s, 55℃ for 15 s, 72℃ for 60 s, for 35 cycles; 72℃ for 120 s.
[0042] Using the ClonExpress II One Step Cloning Kit, the inserted fragment was recombinated with the linearized pC1300s-GFP vector according to the instructions, and the CcMYB1R1-GFP fusion expression vector was successfully constructed.
[0043] Forward primer (SEQ ID No. 27): 5'-CTCTCGAGCTTTCGCGAGCTCATGTCCAGCGCGTGCGGT-3'; Reverse primer (SEQ ID No. 28): 5'-CCCTTGCTCACCATGGATCCTGCCACACTGATGATGCT-3'.
[0044] The constructed CcMYB1R1-GFP recombinant vector and the empty vector pC1300s-GFP were transformed into competent *E. coli* cells, and screened on plates containing the corresponding antibiotics (Kan, 50 mg / mL). Single-clone positive colonies were picked and cultured overnight at 37°C with shaking, followed by plasmid extraction. The CcMYB1R1-GFP experimental group and the pC1300s-GFP empty vector control group were co-transformed with the nuclear marker protein mcherry (purchased from Shanghai Zaikang Biotechnology Co., Ltd.) into leaves of *Nicotiana benthamiana*. The transformed plants were cultured in the dark for 48 hours, and the subcellular localization of the CcMYB1R1 protein was observed using a two-photon laser scanning microscope.
[0045] Subcellular localization results of CcMYB1R1 in Nicotiana benthamiana are as follows: Figure 2 As shown in the figure, the fluorescence signal of the CcMYB1R1-GFP fusion protein completely overlapped with the nuclear labeling signal, indicating that the protein is specifically located in the cell nucleus. This result is consistent with the typical subcellular distribution characteristics of transcription factors, suggesting that CcMYB1R1 likely regulates the transcriptional expression of downstream target genes by being located in the cell nucleus.
[0046] Example 2 CcMYB1R1 Functional verification of genes in pepper fruits (1) VIGS silent pepper fruit CcMYB1R1 Gene Specific silenced fragments were obtained from the pepper genome database using the SGN VIGS Tool online gene silencing tool (https: / / vigs.solgenomics.net / ). Using the purified amplified product of the CcMYB1R1 gene as a template, PCR amplification was performed using CcMYB1R1-VIGS specific primers (upstream primer, SEQ ID NO.5: 5'-TAAGGTTACCGAATTTGAAAGTGGCGGCTGATG-3', downstream primer, SEQ ID NO.6: 5'-GCTCGGTACCGGATCCTGATACCGAGTCAGTGGTG-3'). The reaction procedure was the same as step (1) in Example 1: 98℃ for 2 min; 98℃ for 10 sec, 55℃ for 15 sec, 72℃ for 18 sec, for 35 cycles. The purified product was then processed using the ClonExpress II One Step Cloning Kit. CcMYB1R1The gene silencing fragment (SEQ ID NO.29) was recombined into the pTRV2 vector, denoted as pTRV2::CcMYB1R1. The obtained recombinant plasmid pTRV2::CcMYB1R1 was transformed into DH5α Escherichia coli competent cells. After resistance selection, positive clone plasmids were extracted, and finally, the recombinant vector was introduced into GV3101 Agrobacterium to obtain a bacterial culture containing pTRV2::CcMYB1R1 by heat shock transformation.
[0047] The empty vector pTRV2 was transformed into DH5α competent Escherichia coli cells. After resistance selection, positive clone plasmids were extracted and finally introduced into GV3101 Agrobacterium through heat shock transformation to obtain a bacterial culture containing pTRV2::00.
[0048] Prepare an inoculum containing 10 mM MES, 10 mM MgCl2, and 150 µM AS, adjust the pH to 5.6, and sterilize. Collect Agrobacterium cells by centrifugation at 4000 rpm for 10 minutes, discard the supernatant, and resuspend the cells in the above inoculum. Using the inoculum as a control, measure the OD of each strain suspension. 600 Adjust the pH to 0.8 and incubate at 28℃ in the dark for 2-3 hours. Prepare inoculum solutions by mixing GV3101 bacterial suspension carrying pTRV1 with bacterial suspensions containing pTRV2::CcMYB1R1 or pTRV2::00 at a 1:1 volume ratio. Using a sterile syringe, inject 1 mL of the inoculum solution into the placental tissue of fruits 20 days after flowering. Inject 150-300 μL per fruit, depending on fruit size; too little inoculum will result in poor infection, while too much will cause fruit rot. Incubate the inoculated fruits in a dark environment with 60% relative humidity at 18℃ for 72 hours, then transfer them to an incubator with a 16-hour photoperiod / 8-hour dark period and a temperature of 18℃ for further culture. Ten days after inoculation, sample the silenced fruits and verify the silencing efficiency of the CcMYB1R1 gene using qRT-PCR. Also, use the primers in Table 2 to detect key structural genes in the capsaicin synthesis pathway. Cc4CL , CcACL , CcFatA , CcACS , CcKAS , CcBCAT , CcCOMT and CcHCTExpression levels were set using the same method as in Example 1, step (2). Simultaneously, the capsaicin and dihydrocapsaicin content in the silenced samples was determined according to GB-T21266-2007, "Determination of Capsaicinoids and Expression of Spiciness in Chili Peppers and Chili Pepper Products" (https: / / openstd.samr.gov.cn / bzgk / gb / newGbInfo?hcno=24B96F0950807805400D94E5AB46B953), and converted to capsaicinoid content. The results are as follows: Figure 3 As shown in Tables 3 and 4.
[0049] Table 2 qRT-PCR Primer List
[0050] Using qRT-PCR technology to CcMYB1R The fruit of gene silencing was screened, and the results showed that in the experimental group CcMYB1R1 Expression levels were significantly downregulated ( Figure 3 (a). The results of the determination of capsaicin content in silent positive fruit tissues showed that ( Figure 3 (b) Compared with the pTRV2::00 empty vector control group, the capsaicin content in the pTRV2::CcMYB1R1 silenced samples was significantly reduced. Further analysis revealed that when CcMYB1R1 After the genes were effectively silenced, the expression levels of several key structural genes in the capsaicin biosynthesis pathway were significantly downregulated. Figure 3 (c)
[0051] Table 3 CcMYB1R1 Relative expression levels of genes in gene silencing samples
[0052] Table 4 CcMYB1R1 Capsaicin content in gene-silenced samples
[0053] (2) Overexpression of pepper fruit CcMYB1R1 Gene Design seamless cloning primers with homologous arms of the pCambia1301 plasmid (upstream primer SEQ ID NO.30: 5'-AGAACACGGGGGACTCTTGACCATGGTAATGTCCAGCGCGTGCGGT-3', downstream primer SEQ ID NO.31: 5'-AAAACTAGAAATTTACCCTCAGATCTACTGCCACACTGATGATGCT-3'), to CcMYB1R1The gene sequence was used as a template for PCR amplification. The PCR amplification reaction system and procedure were the same as in step (1) of the example. The PCR amplification product was purified to obtain the insert fragment for recombinant cloning.
[0054] The purified material was processed using the ClonExpress II One Step Cloning Kit. CcMYB1R1 The gene overexpression fragment was directionally inserted into the Nco I and BgI II linearization sites of the pCambia1301 vector (purchased from Shanghai Zeye Biotechnology Co., Ltd.) via homologous recombination to construct the pCambia1301-CcMYB1R1 overexpression recombinant plasmid. This recombinant plasmid was sequentially transformed into DH5α Escherichia coli competent cells and GV3101 Agrobacterium. After resistance selection, positive recombinant plasmids were extracted for later use, yielding a bacterial culture containing pCambia1301::CcMYB1R1.
[0055] The empty vector pCambia1301 was sequentially transformed into DH5α competent Escherichia coli cells and GV3101 Agrobacterium. After resistance screening, positive plasmids were extracted for later use, resulting in bacterial suspension containing pCambia1301::00.
[0056] Following the preparation method and inoculation procedure of the VIGS silencing experiment in step (1) above, the inoculum for the overexpression strain was prepared and injected into the placenta of pepper fruits. Samples were taken 10 days after inoculation and subjected to in vitro testing on detached pepper fruits. CcMYB1R1 In the gene overexpression experiment, the placentas of fruits were collected 10 days after inoculation and GUS staining was performed. The method was as described in the kit instructions (GUS staining kit, purchased from Beijing Huayueyang Biotechnology Co., Ltd.). The results are as follows: Figure 4 As shown in Figure a.
[0057] The overexpression efficiency of the CcMYB1R1 gene was verified using qRT-PCR, and positive overexpression fruit samples were obtained through screening. Simultaneously, key structural genes in the capsaicin synthesis pathway in the overexpression samples were detected. Cc4CL , CcACL , CcFatA , CcACS , CcKAS , CcBCAT , CcCOMT and CcHCT Expression levels were determined; and the contents of capsaicin and dihydrocapsaicin in the overexpressed samples were measured and converted into capsaicin-like substances, using the same method as step (1). The results are as follows: Figure 4 As shown in Tables b-c, 5, and 6.
[0058] The results showed that the placental tissues of both the empty vector control group (pCambia1301::00) and the pCambia1301::CcMYB1R1 treatment group exhibited a distinct blue color, indicating that the overexpression technology was correct. Verification analysis of the overexpressed fruit tissues using qRT-PCR revealed that the pCambia1301::CcMYB1R1 treatment group... CcMYB1R1 The gene expression level was significantly higher than that of the control group. Figure 4 (b) indicates that the gene was successfully overexpressed in the placental tissue.
[0059] Instantaneous overexpression CcMYB1R1 In the samples, the content of capsaicin in chili pepper fruits was significantly higher than that in the control group. Figure 4 (c) Compared with the empty vector control, several key structural genes in the capsaicin biosynthesis pathway were observed. CcCOMT , CcHCT , Cc4CL , CcACL , CcACS , CcBCAT , CcKAS and CcFatA Expression levels were all significantly upregulated, and the differences were statistically significant. Figure 4 (b)
[0060] Table 5 CcMYB1R1 Relative expression levels of genes in gene overexpression samples
[0061] Table 6 CcMYB1R1 Capsaicin content in gene overexpression samples
[0062] Example 3: Transcription factor CcMYB1R1 on downstream target genes COMT , HCT Regulation COMT and HCT are known key enzymes in capsaicin synthesis, and their expression levels are related to capsaicin synthesis. Both genes are downstream target genes identified through yeast single-locus-to-spot experiments. Therefore, this example investigates the effect of transcription factor CcMYB1R1 on downstream target genes. COMT , HCT Regulation.
[0063] Seamless cloning primers containing homologous arms of pB42AD and pLacZi plasmids were used to... CcMYB1R1 Using the gene sequence and the DNA from the hot pot as templates, PCR amplification was performed separately, and the amplification products were purified to obtain the insert fragment for recombinant cloning. CcMYB1R1 Gene fragments, CcHCT promoter fragments and CcCOMT Promoter fragment. Primer sequences are shown in Table 7.
[0064] Table 7 Primer sequence information
[0065] The purified [product / process] was cloned using the ClonExpress II one-step cloning kit. CcMYB1R1 The gene fragment was directionally cloned into the pB42AD vector, which had been linearized by double digestion with EcoRI and XhoI, via homologous recombination to construct the recombinant plasmid pB42AD-CcMYB1R1. Similarly, the gene fragment was... CcHCT and CcCOMT The promoter fragments were cloned into the linearized pLacZi vector to construct the recombinant reporter plasmids pLacZi-CcHCT and pLacZi-CcCOMT. Each recombinant plasmid was transformed into DH5α Escherichia coli competent cells. After selection for ampicillin resistance, positive clone plasmids were extracted, and sequence correctness was verified by sequencing.
[0066] The validated recombinant plasmid and control plasmid were combined as follows and co-transformed into EGY48 yeast competent cells: Control group 1: pB42AD empty vector + pLacZi empty vector, denoted as JG+PAR; Control group 2: pB42AD empty vector + pLacZi-CcHCT; Control group 3: pB42AD empty vector + pLacZi-CcCOMT; Experimental group 1: pB42AD-CcMYB1R1+pLacZi-CcHCT; Experimental group 2: pB42AD-CcMYB1R1+pLacZi-CcCOMT.
[0067] The specific transformation steps are as follows: Mix 5 μL of each plasmid combination with 50 μL of EGY48 competent cells, then add 5 μL of Carrier DNA and 250 μL of PEG / LiAc solution (purchased from Shanghai Weidi Biotechnology Co., Ltd.), and mix thoroughly by aspirating. Incubate at 30℃ for 30 minutes, followed by heat shock at 42℃ for 15 minutes. After centrifugation at 5000 r / min for 30 seconds, discard the supernatant, resuspend the cells in 300 μL of sterile water, and plate them on SD / -Ura / -Trp medium plates (purchased from Beijing Pangeno Technology Co., Ltd.). Incubate upside down at 30℃ for 2-4 days, and screen for successfully co-transformed yeast colonies.
[0068] Select positive clones from the above plates and inoculate them onto SD / -Ura / -Trp+Gal+Raf+X-gal selection plates (purchased from Beijing Pan-Gino Technology Co., Ltd.). Observe the changes in plaque color after incubating at 30℃ for 2-3 days.
[0069] Experimental results are as follows Figure 5 As shown in Figure a: Compared with the bacterial plaques of control groups 2 and 3, the yeast plaques of experimental groups 1 and 2 both showed a distinct blue color. This result indicates that the transcription factor CcMYB1R1 can specifically bind to... CcHCT Genes and CcCOMT The promoter region of the gene was detected, and the expression of the reporter gene was activated, thus confirming that the CcMYB1R1 protein directly interacts with the promoters of CcHCT and CcCOMT.
[0070] (2) Electrophoretic Mobility Shift Assay (EMSA) Design and synthesize for use CcMYB1R1 Seamless cloning primer pairs (upstream primer SEQ ID No. 38: 5'-CCGCGTGGATCCCCGGAATTCATGTCCAGCGCGTGCGGT-3', downstream primer SEQ ID No. 39: 5'-GATGCGGCCGCTCGAGTCGACTCATGCCACACTGATGATGC-3') were cloned into the pGEX-4T-1 vector (purchased from Shanghai Zeye Biotechnology Co., Ltd.). PCR amplification was performed using the CcMYB1R1 gene sequence as a template, and the target fragment was obtained using the above primers. The amplification system and procedure were the same as in Example 1. The PCR product was purified to obtain the insert fragment.
[0071] The purified [material] was cloned using the ClonExpress II one-step cloning kit. CcMYB1R1 Gene fragments were directionally inserted into the pGEX-4T-1 vector, which had been linearized by double digestion with EcoRI and SalI, via homologous recombination to construct the GST-tagged fusion protein expression vector pGEX-4T-1-CcMYB1R1. This recombinant plasmid was first transformed into DH5α *E. coli* competent cells for amplification. After extraction and verification of the correct plasmid, it was further transformed into the BL21(DE3) expression strain for subsequent induction and purification of the recombinant protein. CcCOMT and CcHCT Probes for EMSA experiments were designed and synthesized based on predicted cis-acting elements in gene promoters. The probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The probe sequences are shown below: SEQ ID NO.40: 5'-ATATTGAGTAGATGGGTGTCAAAATTAGGG-3'; SEQ ID NO.41: 5'-ATATTGAGTAGATTTTTTTCAAAATTAGGG-3'; SEQ ID NO.42: 5'-CACTCCTTATTGGGTGGGTGAATCGTATAA-3'; SEQ ID NO.43: 5'-CACTCCTTATTTTTTTTTTTAATCGTATAA-3'. Here, SEQ ID No.40 represents a double-stranded oligonucleotide used to detect the binding of CcMYB1R1 to a specific DNA sequence of HCT, and SEQ ID No.41 represents the mutant probe corresponding to SEQ ID No.40, used to verify specificity; SEQ ID No.42 represents a double-stranded oligonucleotide used to detect the binding of CcMYB1R1 to a specific DNA sequence of COMT, and SEQ ID No.43 represents the mutant probe corresponding to SEQ ID No.42, used to verify specificity.
[0072] The expression and purification of the GST-CcMYB1R1 fusion protein were performed according to the instructions of the GST-tagged protein purification kit from Beyotime Biotechnology Co., Ltd. The purified GST-CcMYB1R1 fusion protein was used for electrophoresis (EMSA), and the experimental procedures were strictly performed according to the instructions of the chemiluminescence EMSA kit from Beyotime Biotechnology Co., Ltd.
[0073] EMSA results as follows Figure 5 b and Figure 5As shown in Figure c, lane 1 is the negative control; lane 2 is the biotin-labeled probe; lane 3 is the competitive type, which contains a cold probe with an unmodified DNA fragment, interfering with probe-protein binding and thus eliminating false positives and increasing accuracy; lane 4 is the mutant type, used to verify specificity. No migration band was observed in the negative control group, indicating that the experimental system itself had no background signal interference. In the protein-probe binding group, when purified GST-CcMYB1R1 protein was incubated with biotin-labeled wild-type CcCOMT or CcHCT promoter probes, clear, delayed-migrating protein-nucleic acid complex bands appeared, with the highest signal intensity. In the competitive inhibition group, when both the biotin-labeled probe and an excess of the same unlabeled wild-type probe were added to the reaction system, the signal of the resulting complex band was significantly weakened. These results demonstrate that unlabeled DNA fragments competitively bind to the GST-CcMYB1R1 protein, leading to a reduction in the labeling complex, thus confirming that the CcMYB1R1 protein can specifically bind to cis-acting elements contained in the promoters of the CcCOMT and CcHCT genes in vitro.
[0074] (3) Dual-luciferase reporter gene assay (LUC) The molecular mechanism of MYB1R1 in capsaicin synthesis pathway was elucidated using COMT. Seamless cloning primers with homologous arms of pGreenII62-SK and pGreenII0800-LUC plasmids were designed (upstream primer SEQ ID NO.44: 5'-GCTCTAGAACTAGTGGATCCATGTCCAGCGCGTGCGGT-3', downstream primer SEQ ID NO.45: 5'-ATCGATAAGCTTGATATCGAATTCTCATGCCACACTGATGATGC-3'), to amplify the CcMYB1R1 fragment containing the pGreenII62-SK endonuclease site; upstream primer SEQ ID NO.46: 5'-TCACTATAGGGCGAATTGGGTACCGTAAAAGAAGATATTTGTTGAAGGA-3', downstream primer SEQ ID NO. NO.47: 5'-CCGCTCTAGAACTAGTGGATCCTTTTTGATATTCCTTTTTGGCTCTG-3', used to amplify the CcCOMT fragment containing the pGreenII0800-LUC restriction enzyme site. PCR amplification was performed using the CcMYB1R1 gene sequence and saturated DNA as templates to obtain the corresponding target fragment. The PCR product was purified to obtain the insert fragment for homologous recombination.
[0075] Using the ClonExpress II one-step cloning kit, the purified CcMYB1R1 gene fragment was directionally cloned into the pGreenII62-SK vector, which was linearized by double digestion with BamHI and EcoRI, to construct the effector vector pGreenII62-SK-CcMYB1R1, denoted as pGreenII62-SK::CcMYB1R1. Simultaneously, the purified CcCOMT gene promoter fragment was directionally cloned into the pGreenII0800-LUC vector, which was linearized by double digestion with KpnI and BamHI, to construct the reporter vector pGreenII0800-LUC-CcCOMT, denoted as pGreenII0800-LUC::CcCOMT. Each recombinant plasmid was transformed into DH5α *E. coli* competent cells for amplification. After extracting and verifying the correct plasmids, they were transformed into GV3101 (pSoup) *Agrobacterium* competent cells for later use.
[0076] Following the infection solution preparation method and inoculation procedure of the aforementioned VIGS silencing experiment, pGreenII62-SK::CcMYB1R1 and pGreenII62-SK::00 (empty vector) after dark treatment were mixed with pGreenII0800-LUC::CcCOMT and pGreenII0800-LUC::00 (empty vector) at a volume ratio of 9:1, respectively. The mixture was then applied to the underside of tobacco leaves. After infection, the tobacco was placed in a suitable environment for 3 days of cultivation. The specific groups are shown in Table 8. After 3 days of cultivation, in vivo imaging was performed on the infected tobacco leaves. Subsequently, leaf tissue samples were taken from the infected areas, and the activities of firefly luciferase (LUC) and kidney luciferase (REN) were measured using the Dual Luciferase® reporter gene assay kit from Promega (Beijing) Biotechnology Co., Ltd., according to the instructions.
[0077] In vivo imaging results of tobacco leaves as follows Figure 5 As shown in Figure e, basal levels of fluorescence signal were detected in the experimental group containing only the pGreenII0800-LUC-CcCOMT reporter vector (pGreenII62-SK::00+pGreenII0800-LUC::CcCOMT). However, in the experimental group co-transformed with both the pGreenII62-SK-CcMYB1R1 effector vector and the pGreenII0800-LUC-CcCOMT reporter vector, the fluorescence signal intensity on the leaves was significantly enhanced. The quantitative detection results of dual-luciferase activity are shown below. Figure 5As shown in f, compared with the empty effect vector control group (pGreenII62-SK::00+pGreenII0800-LUC::CcCOMT), the experimental group co-transformed with CcMYB1R1 and CcCOMT showed a significantly increased LUC / REN relative activity ratio. These results indicate that the transcription factor CcMYB1R1 can activate the expression of the luciferase reporter gene driven by the CcCOMT gene promoter.
[0078] Table 8. Expression results of luciferase reporter genes
[0079] Vanillylamine is a direct precursor to capsaicin synthesis, and HCT and COMT are both key enzymes catalyzing the vanillylamine synthesis pathway. HCT catalyzes the conversion of coumaroyl-CoA to caffeoyl-CoA, a crucial step in vanillylamine synthesis, while COMT catalyzes the conversion of caffeoyl-CoA to ferulic acid-CoA, which is further converted into vanillylamine. CcMYB1R1 can bind to the promoters of the HCT and COMT genes, thereby significantly upregulating their expression. Increased expression levels of HCT and COMT directly lead to increased accumulation of their catalytic product, ferulic acid-CoA. Since ferulic acid-CoA is a key intermediate in vanillylamine synthesis, its increased content ultimately drives the enhancement of the capsaicin synthesis pathway, resulting in a significant increase in capsaicin accumulation.
[0080] In summary, the CcMYB1R1 protein and its encoding gene regulate the synthesis and accumulation of capsaicin in chili peppers by modulating the biosynthetic pathway of capsaicin. This gene provides an effective functional gene resource for the genetic improvement of chili pepper fruit quality traits and can be used to breed new chili pepper varieties with high capsaicin content.
[0081] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A CcMYB1R1 protein that regulates the content of capsaicin-like substances, characterized in that, The amino acid sequence of the CcMYB1R1 protein is shown in SEQ ID NO.
1.
2. Encoding the CcMYB1R1 protein of claim 1 CcMYB1R1 Genes, characterized by, The CcMYB1R1 The nucleotide sequence of the gene is shown in SEQ ID NO.
2.
3. The CcMYB1R1 protein of claim 1 or the protein of claim 2 CcMYB1R1 Application of genes in regulating capsaicin content and / or creating new chili germplasm.
4. The application according to claim 3, characterized in that, The regulation includes: increasing CcMYB1R1 protein levels or CcMYB1R1 Increased gene expression levels lead to higher capsaicin content; Reduce CcMYB1R1 protein content or CcMYB1R1 The gene expression level decreases the content of capsaicin-like substances.
5. The application according to claim 3 or 4, characterized in that, The capsaicin-like substances include capsaicin and dihydrocapsaicin.
6. A type of regulation CcMYB1R1 Biomaterials with high gene expression levels are characterized by, The CcMYB1R1 The nucleotide sequence of the gene is shown in SEQ ID NO.
2.
7. The biomaterial according to claim 6, characterized in that, Including overexpression CcMYB1R1 Biological materials for gene expression; the overexpression CcMYB1R1 Biological materials for gene amplification include amplification. CcMYB1R1 Primer set of genes, containing CcMYB1R1 Recombinant gene expression vectors and those containing CcMYB1R1 One or more of the recombinant genes of microorganisms.
8. The biomaterial according to claim 6, characterized in that, Including inhibition CcMYB1R1 Gene expression or knockout CcMYB1R1 Biological materials containing genes, wherein the method of inhibition includes silencing.
9. The biomaterial according to claim 8, characterized in that, The inhibition CcMYB1R1 Biological materials for gene expression include silencing expression vectors; the silencing expression vector includes a gene silencing vector backbone and... CcMYB1R1 Silent gene fragments; The CcMYB1R1 The nucleotide sequence of the silenced gene fragment is shown in SEQ ID NO.
29.
10. A method for regulating the content of capsaicin-like substances in chili pepper fruits, characterized in that, The biomaterial described in any one of claims 6 to 9 is introduced into the recipient pepper fruit.