Recombinant nano antibody of waterfowl H9N2 avian influenza virus, recombinant expression vector, recombinant strain and application thereof

Abstract

The invention discloses a recombinant nano antibody of a waterfowl H9N2 avian influenza virus, a recombinant expression vector, a recombinant strain and application thereof, and relates to the field of biology. The amino acid sequence of the recombinant nano antibody is SEQ ID NO: 2, and the nucleotide sequence of the recombinant nano antibody is SEQ ID NO: 1. The invention provides a recombinant expression vector containing the coding gene of the recombinant nano-antibody and a recombinant strain for expressing the recombinant nano-antibody. The recombinant nano antibody is applied to preparation of a waterfowl H9N2 avian influenza resisting medicine or a waterfowl H9N2 avian influenza diagnostic reagent. The yield of the recombinant nano antibody reaches 1.5 g / L, the hemagglutination inhibition activity titer for resisting the waterfowl H9N2 avian influenza virus is 4 log2, and the recombinant nano antibody has remarkable biological activity and can be used for preparing a novel nano antibody preparation for preventing and / or treating the waterfowl H9N2 avian influenza.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a recombinant nanobody, recombinant expression vector, recombinant strain, and application of a waterfowl H9N2 avian influenza virus. Background Technology

[0002] Avian influenza is an infectious disease in birds caused by influenza A viruses of the Orthomyxoviridae family, characterized by a range of symptoms from respiratory illness to systemic septicemia. It is classified into low-pathogenic avian influenza (H9 subtype) and highly pathogenic avian influenza (H5 and H7 subtypes). Among these, the H9 subtype has a wide spread, severe mixed infections, and causes significant direct and indirect economic losses, posing new challenges to prevention and control. The earliest host of the H9N2 virus is wild waterfowl, and its spread is widespread. Analysis of the carrier rate in wild waterfowl indicates that the H9N2 strain may be a natural host for cross-nest transmission. Currently, outbreak trends in domestic duck flocks show that all poultry-derived strains carry molecular characteristics adapted to land-dwelling poultry, including mutations in key amino acids such as Y226 and L229 at the N-terminal receptor binding site of the HA protein.

[0003] VHH antibodies, also known as single-domain antibodies, are a promising next-generation therapeutic antibody technology suitable for cancer immunotherapy and a variety of other applications. Their unique structure distinguishes them from conventional antibodies, such as their size, solubility, intrinsic stability, and ability to be easily customized into multifunctional structures. VHH antibodies can recognize uncommon or occult epitopes and efficiently bind to the compartments or active sites of enzyme targets. Furthermore, VHH antibodies offer irreplaceable advantages in drug discovery because their development and manufacturing processes are both simple and rapid. VHHs are the smallest antigen-binding fragments derived from heavy-chain antibodies from camelids such as alpacas, llamas, and camels. Their small size and structure allow them to penetrate tissues and reach targets that conventional antibodies may struggle to reach; in addition, their stability and high affinity binding to specific targets make them particularly attractive for therapeutic, diagnostic, and research tools.

[0004] Currently, there are limited reports on nanobodies against H9 subtype avian influenza virus. Zhao Qin et al. disclosed a nanobodies against H9N2 subtype avian influenza virus, their preparation method, and applications. They successfully prepared a fusion protein of the nanobodies and HRP, and applied this fusion protein to detect antibodies against H9N2 subtype avian influenza virus (AIV) in chicken serum. They found that the detection method constructed with this fusion protein had high sensitivity and advantages such as simple operation, no need for secondary antibodies, and short sample detection time (Zhao Qin, Sun Yani, Wang Kun et al. Nanobodies against H9N2 subtype avian influenza virus, preparation method and applications [P]. Shaanxi Province: CN111171146B, 2022-03-04.). However, existing data have not reported any research on nanobodies against waterfowl H9N2 avian influenza virus as novel preventive or therapeutic agents. Summary of the Invention

[0005] The purpose of this invention is to provide a nanobody sequence of H9N2 avian influenza virus in waterfowl and its application, so as to solve the problems existing in the prior art.

[0006] The technical solution adopted by this invention to solve the technical problem is as follows:

[0007] 1. This invention provides a recombinant nanobody of H9N2 avian influenza virus in waterfowl, the amino acid sequence of which is shown in SEQ ID NO:2.

[0008] 2. The present invention provides a gene encoding a recombinant nanobody of a waterfowl H9N2 avian influenza virus, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0009] 3. The present invention provides a recombinant expression vector containing the encoding gene of a recombinant nanobody of a waterfowl H9N2 avian influenza virus, which is based on the pPIC9K vector, and the nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO:3.

[0010] 4. The present invention provides a recombinant strain expressing a recombinant nanobody of the H9N2 avian influenza virus of waterfowl, the genome of which contains the encoding gene of the recombinant nanobody of the H9N2 avian influenza virus of waterfowl or the recombinant expression vector.

[0011] 5. This invention provides the application of a recombinant nanobody of H9N2 avian influenza virus in the preparation of anti-H9N2 avian influenza drugs or diagnostic reagents for H9N2 avian influenza in waterfowl.

[0012] The beneficial effects of this invention are:

[0013] I. Excellent antibody performance;

[0014] 1. High activity titer: The hemagglutination inhibition titer of the recombinant nanobody was 4 log2, which is the first report of its kind, indicating that it has significant antiviral activity.

[0015] 2. Good specificity and affinity: The recombinant nanobody is derived from the VHH phage library of immunized alpacas, and the immunoantigen is the currently prevalent H9N2 avian influenza virus strain (NJ01 strain) of waterfowl. Therefore, it has a higher binding compatibility with the prevalent strain.

[0016] Second, it has high production feasibility;

[0017] 1. Highly efficient expression system: Using the Pichia pastoris expression system, the yield of recombinant nanobodies reaches 1.5 g / L, which has the potential for large-scale production.

[0018] 2. Simple process and low cost: The preparation method of the present invention is simple to operate and low in cost, and can ensure the yield, activity, safety and production applicability of recombinant nanobodies, making it suitable for large-scale production.

[0019] Third, its application prospects are clear;

[0020] 1. Therapeutic and preventive potential: It can be used to prepare novel nanobody formulations for the prevention and / or treatment of H9N2 avian influenza in waterfowl.

[0021] 2. Diagnostic reagent development potential: It can also be used to develop diagnostic reagents for H9N2 avian influenza in waterfowl.

[0022] IV. Key technological innovations;

[0023] 1. First report of H9N2 nanobodies from waterfowl: There is no existing research on the use of nanobodies against H9N2 avian influenza virus in waterfowl for prevention or treatment. This invention fills this gap.

[0024] 2. The structure is well-defined and highly reproducible; this invention provides complete amino acid sequences (SEQ ID NO:2), nucleotide sequences (SEQ ID NO:1), and recombinant expression vector sequences (SEQ ID NO:3), which facilitates subsequent research and industrialization. Attached Figure Description

[0025] Figure 1 The spectrum of the recombinant expression vector pPIC9K-H9N2-VHH.

[0026] Figure 2 The SDS-PAGE identification results of the recombinant nanobody H9N2-VHH. Detailed Implementation

[0027] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0028] 1. Obtaining the variable region (VHH) sequence of the heavy chain antibody;

[0029] Two-year-old male alpacas (purchased from Jiangsu Dengyuanhe Biotechnology Co., Ltd.) were injected subcutaneously into the neck with an inactivated avian influenza (H9 subtype) vaccine (NJ01 strain) (the first domestically produced waterfowl-derived avian influenza vaccine, purchased from Zhaofenghua Biotechnology Co., Ltd.). The injection volume was 3 mL per alpaca. Booster immunizations were administered on days 14, 28, 42, and 56 post-immunization, and serum antibody titers were measured. When the ELISA titer of serum antibodies reached 1:25600, peripheral blood was collected from the alpacas. Lymphocytes were separated using camel peripheral blood lymphocyte separation fluid (purchased from Beijing Solarbio Science & Technology Co., Ltd.), and RNA was extracted and reverse transcribed into cDNA using an RNA extraction kit and a reverse transcription kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.). The variable region (VHH) sequence of the heavy chain antibody was amplified by two rounds of nested PCR. The first round primer sequences were CALL-1 and CALL-2, and the second round primer sequences were Sac1-VHH-F and Spe1-VHH-R. All of the above primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0030] The primer sequence information for the above two rounds of nested PCR amplification is as follows:

[0031] CALL-1:GTCCTGGCTGCTCTTCTACAAGG;

[0032] CALL-2:GGTACGTGCTGTTGAACTGTTCC;

[0033] Sac1-VHH-F: GAGCTCATGGATGTGCAGCTGGT;

[0034] Spe1-VHH-R:ACTAGTTGAGGAGACGGTGACCT.

[0035] 2. Establishment of a VHH phage library for immunized alpacas;

[0036] The amplified variable region (VHH) sequence of the heavy chain antibody was digested with pComb3Xss plasmid (purchased from Nanjing Yifeixue Biotechnology Co., Ltd.) using restriction endonucleases Sac I and Spe I (purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.), then ligated with T4 ligase (purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.) and transformed into E. coli TG1 competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.). The next day, 48 single colonies were picked for colony PCR. All 48 single colonies were positive, and sequencing confirmed that the sequences were all distinct, indicating a positivity rate of 93.75% (45 / 48) and high diversity (45 / 45) for the VHH phage library immunized in alpacas. The VHH phage library for alpacas was successfully constructed. The calculated library size (based on plate counts and dilution ratios) was 3.5 × 10⁻⁶. 5 per mL.

[0037] 3. Further screening of heavy chain antibody variable region (VHH) sequences;

[0038] The inactivated H9N2 avian influenza virus strain NJ01 (provided by Zhaofenghua Biotechnology (Nanjing) Co., Ltd.) was coated onto an ELISA plate. Antibody library solid-phase screening technology was used to screen for VHH sequences that could bind to the H9 subtype avian influenza virus. The ELISA detection results of the antibody library solid-phase screening showed that a total of 18 VHH sequences that could bind to the H9 subtype avian influenza virus were screened. The sequence with the highest OD value, H9N2-VHH, was selected for further research. Its nucleotide sequence is SEQ ID NO:1, and the encoded amino acid sequence is SEQ ID NO:2.

[0039] 4. Construction and identification of recombinant expression vectors;

[0040] The selected VHH sequence and pPIC9K vector (purchased from Thermo Fisher Scientific (China) Co., Ltd.) were digested with restriction endonucleases EcoRI and NotI (both EcoRI and NotI were purchased from Bio-Rad Laboratories (Beijing) Co., Ltd.), respectively. The digested fragments were recovered by 1% agarose gel electrophoresis. The target fragment was ligated with T4 ligase (purchased from Bio-Rad Laboratories (Beijing) Co., Ltd.) and transformed into *E. coli* DH5α competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.). The cells were plated and cultured overnight. Single colonies were picked the next day, and the correctly identified recombinant expression vector was named pPIC9K-H9N2-VHH after sequencing. Its chromatogram is shown below. Figure 1 As shown, the full-length plasmid sequence is 9660 bp, and its nucleotide sequence is shown in SEQ ID NO:3.

[0041] 5. Construction and identification of recombinant strains;

[0042] The recombinant expression vector pPIC9K-H9N2-VHH was linearized using restriction endonuclease Sal I (purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.), added to Pichia pastoris X-33 competent cells (purchased from Changsha Aikebo Biotechnology Co., Ltd.), gently mixed, and then transferred to a pre-chilled electroporation cuvette. After incubation on ice for 5 minutes, the cells were transferred to an electroporator, and the electroporation parameters were set as follows: voltage 1.5 kV. Immediately after electroporation, 2 mL of pre-chilled 1M sorbitol was added, and the cells were incubated statically at 30°C for 1 h. Subsequently, the cells were centrifuged at 4000 r / min for 4 minutes at room temperature, and the cells were collected and resuspended in 100 µL of YPG medium (purchased from Beijing Solarbio Technology Co., Ltd.). The cells were then spread onto YPG solid medium containing 100 µg / mL bleomycin (Zeocin, purchased from Shanghai Beyotime Biotechnology Co., Ltd.) and incubated at 37°C for 3 days. Single colonies were picked for PCR identification, and the recombinant strain was obtained after successful identification.

[0043] 6. Preparation of recombinant nanobody H9N2-VHH;

[0044] The recombinant strain obtained above was first inoculated into 20 mL of YPG medium for rejuvenation. The next day, 5 mL was inoculated into a 1 L shake flask and cultured overnight at 28°C and 200 r / min. The cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium (purchased from Beijing Solarbio Science & Technology Co., Ltd.). Induction was performed at 28°C and 200 r / min for 96 hours (with 1% methanol added every 24 hours). The supernatant was collected and purified according to the affinity chromatography column (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) instructions to obtain the recombinant protein. The molecular weight and purity of the recombinant protein were analyzed by SDS-PAGE. The results are as follows: Figure 2 As shown, the relative molecular mass of the obtained recombinant protein is 12 kDa, which is consistent with the expected value, indicating that the recombinant protein is the recombinant nanobody H9N2-VHH, with a concentration of 1.5 g / L and a purity of 70%.

[0045] 7. Detection of hemagglutination inhibition activity of recombinant nanobody H9N2-VHH;

[0046] The hemagglutination inhibition titer of recombinant nanobody H9N2-VHH was determined according to GB / T 18936-2025 "Diagnostic Techniques for Avian Influenza". The results showed that the hemagglutination inhibition titer of recombinant nanobody H9N2-VHH was 4log2, which is a first-time report. The recombinant nanobody H9N2-VHH prepared in this invention has good biological activity and can be used to prepare novel nanobody formulations for the prevention and / or treatment of H9N2 avian influenza in waterfowl.

[0047] This invention discloses a recombinant nanobody, recombinant expression vector, recombinant strain, and their applications for the H9N2 avian influenza virus in waterfowl. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The product of this invention has been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the product described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

Claims

1. A recombinant nanobody of H9N2 avian influenza virus in waterfowl, characterized in that, The amino acid sequence of the recombinant nanobody is shown in SEQ ID NO:

2.

2. A gene encoding a recombinant nanobody of a waterfowl H9N2 avian influenza virus as described in claim 1, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

3. A recombinant expression vector comprising the encoding gene of a recombinant nanobody of a waterfowl H9N2 avian influenza virus as described in claim 1, characterized in that, The recombinant expression vector is based on the pPIC9K vector.

4. The recombinant expression vector according to claim 3, characterized in that, The nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO:

3.

5. A recombinant strain expressing a recombinant nanobody of a waterfowl H9N2 avian influenza virus as described in claim 1, characterized in that, The genome of the recombinant strain contains the encoding gene of a recombinant nanobody of a waterfowl H9N2 avian influenza virus as described in claim 1 or the recombinant expression vector as described in claim 3.

6. The application of the recombinant nanobody of H9N2 avian influenza virus as described in claim 1 in the preparation of anti-H9N2 avian influenza drugs or H9N2 avian influenza diagnostic reagents for waterfowl.

Images