Non-saccharomyces cerevisiae with high yield of pectinase and application thereof

By screening and identifying the non-Saccharomyces cerevisiae strain Y4B, which produces high levels of pectinase, a pectinase solution was prepared for use in fruit juice processing. This solved the problem of reliance on imported pectinase preparations in fruit juice processing, improved the flavor of the juice, and reduced costs, demonstrating significant application value.

CN121652944APending Publication Date: 2026-03-13SHANDONG ACAD OF GRAPE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-27
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

In my country's fruit juice processing industry, pectinase preparations rely on imports, resulting in high costs. There is an urgent market demand for efficient, stable, and low-cost pectinase preparations. Furthermore, there is a significant gap in the basic research and application development of pectinase and its production strains in China.

Method used

A high-producing non-Saccharomyces cerevisiae strain Y4B was screened and identified, named Tausonia pullulans. Pectinase solution was prepared by fermentation culture. The solution was acidic, at medium to high temperature and had good pH stability, and was applied to juice processing.

Benefits of technology

It increases the content of specific aroma components in fruit juice, improves the flavor of the juice, and reduces fermentation costs, showing broad application prospects in fruit juice processing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121652944A_ABST
    Figure CN121652944A_ABST
Patent Text Reader

Abstract

The invention discloses a non-saccharomyces cerevisiae strain with high yield of pectinase and application of the non-saccharomyces cerevisiae strain, the strain is named as Tausonia pullulans Y4B and is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: M 20252182. The strain is separated from sunshine rose grapes and can efficiently secrete pectinase. The pectinase liquid of Y4B is prepared through fermentation, and the pectinase liquid has excellent enzymatic properties and adapts to the fruit juice processing environment. The enzyme liquid is applied to preparation of the sunshine rose juice, the content of aroma substances such as terpenes, esters and alcohols in the juice can be remarkably increased under the condition of 20 DEG C or 30 DEG C, and the flavor and quality of the juice are improved. The invention provides an excellent strain resource for developing a high-performance pectinase preparation with proprietary intellectual property rights, and has important application value in the field of fruit processing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a non-Saccharomyces cerevisiae strain that produces high levels of pectinase and its applications, belonging to the field of microbial technology. Background Technology

[0002] Pectin is a natural high-molecular-weight complex anionic polysaccharide. As an indispensable structural polysaccharide for the cell walls of higher plants, it is widely found in nature, especially abundant in fruits and vegetables. Pectin has a relatively complex chemical structure. Its main chain is composed of D-galacturonic acid monomers linked by α-1,4 glycosidic bonds, while its side chains contain other types of monosaccharides such as rhamnose, galactose, and arabinose.

[0003] Pectinases are key enzymes that efficiently and specifically degrade pectin. They break down long-chain pectin into oligosaccharides or monosaccharides by acting on different chemical bonds in the pectin molecule. Based on their mechanisms of action, pectinases are broadly classified into two categories: depolymerases and pectin esterases. Depolymerases break down the glycosidic bonds of pectin, causing the long pectin chains to break. These mainly include polygalacturonases of the glycoside hydrolase (GH) family and pectin lyases of the polysaccharide lyase (PL) family. Pectin esterases belong to the carbohydrate esterase (CE) family and catalyze the hydrolysis of pectin ester groups. Adding pectinases at appropriate stages of juice processing can more thoroughly decompose pectin, thereby increasing juice yield and filtration efficiency, promoting juice clarification, and facilitating the release of flavor compounds and pigments from cell walls, thus improving the overall quality and flavor of the juice.

[0004] However, despite the significant benefits of pectinase preparations, the use of pectinase and its producing strains in fruit juice processing in my country is almost entirely monopolized by enzyme companies from a few countries such as Germany and France. This reliance on imports leads to high costs. Compared to foreign countries, my country lags significantly behind in basic research and applied development of pectinase and its producing strains. With the continuous expansion of my country's fruit juice industry and the upgrading of consumption patterns, the market demand for efficient, stable, and low-cost pectinase preparations is becoming increasingly urgent. Therefore, screening high-yielding pectinase strains with independent intellectual property rights and excellent enzymatic properties, and developing corresponding enzyme preparation products, is of significant strategic importance for breaking the foreign technological monopoly and enhancing the core competitiveness of my country's fruit juice industry. Summary of the Invention

[0005] To overcome the above-mentioned technical difficulties, the present invention provides a non-Saccharomyces yeast that produces high levels of pectinase and its applications.

[0006] The technical solution of this invention is as follows: A non-Saccharomyces cerevisiae strain that produces high levels of pectinase, named Y4B, belongs to... Tausonia pullulans This strain was deposited at the China Center for Type Culture Collection (CCTCC) on September 30, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20252182.

[0007] Furthermore, the nucleotide sequence of the ITS (ITS1F-ITS4R) region of the strain is shown in SEQ ID NO.1.

[0008] This invention also discloses a microbial inoculant containing non-Saccharomyces cerevisiae. This invention discloses the application of the non-Saccharomyces cerevisiae strain Y4B or its microbial inoculant in the preparation of pectinase.

[0009] The application of pectinase produced by the aforementioned non-Saccharomyces cerevisiae strain Y4B in the preparation of Sunshine Rose grape juice at medium and low temperatures.

[0010] This invention screened a non-Saccharomyces cerevisiae strain Y4B from grapes that can efficiently secrete pectinase. Through ITS region sequencing, this strain was identified as… Tausonia pullulans kind 。 Pectinase solution was prepared by culturing strain Y4B in a fermentation medium. Enzymatic properties were determined, revealing an optimal pH of 6.0. The enzyme activity was maintained at 70% and 91% at pH 4.0 and 5.0, respectively, indicating that the pectinase secreted by Y4B is an acidic enzyme. pH stability tests showed strong pH stability, maintaining over 85% activity after incubation at pH 3.0–10.0. The optimal temperature for this enzyme solution was 50℃, indicating that the pectinase secreted by Y4B is a mesophilic enzyme. Temperature stability tests showed that the enzyme solution remained stable at 40℃ and below, exhibiting good thermal stability. During the processing of Shine Muscat grape juice, this enzyme solution significantly increased the content of esters such as ethyl octanoate and ethyl decanoate, as well as terpenoids such as linalool and geraniol, at 20℃, and significantly increased the content of alcohols such as isoamyl alcohol and phenylethyl alcohol, as well as esters such as ethyl octanoate and ethyl decanoate, at 30℃. Therefore, the pectinase secreted by Y4B has important application value in improving the flavor and enhancing the floral and fruity aroma of the juice.

[0011] Beneficial effects: 1. The pectinase secreted by the non-Saccharomyces cerevisiae Y4B described in this invention is an acidic enzyme with excellent pH stability, making it suitable for use in fruit juice processing.

[0012] 2. The enzyme solution prepared by this invention using non-Saccharomyces cerevisiae Y4B has low fermentation cost and simple operation process.

[0013] 3. The pectinase secreted by the non-Saccharomyces cerevisiae Y4B described in this invention can significantly increase the content of esters such as ethyl octanoate and ethyl decanoate, as well as terpenoids such as linalool and geraniol in Sunshine Rose juice at 20°C, and can increase the content of alcohols such as isoamyl alcohol and phenylethanol, as well as esters such as ethyl octanoate and ethyl decanoate in Sunshine Rose juice at 30°C.

[0014] 4. The pectinase secreted by the brewing yeast Y4B described in this invention has broad application prospects in the field of fruit juice processing.

[0015] Preservation Information Preservation period: September 30, 2025; Depository: China Center for Type Culture Collection; Accession number: CCTCC NO: M 20252182; Address of the depositary institution: Wuhan University, Wuhan, China; Postal code: 430072; Category Naming: Tausonia pullulans Y4B. Attached Figure Description

[0016] Figure 1 The transparent ring produced by pectin degradation by strain Y4B; Figure 2 Colony morphology of strain Y4B on YPD solid medium; Figure 3 The effect of pH on the activity of pectinase secreted by strain Y4B; Figure 4 pH stability of pectinase secreted by Y4B; Figure 5 The effect of temperature on the activity of pectinase secreted by strain Y4B; Figure 6 The thermal stability of pectinase secreted by Y4B. Detailed Implementation

[0017] The present invention will be further described below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited thereto.

[0018] In the embodiments Tausonia pullulans Y4B is deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, CCTCC NO: M 20252182.

[0019] Solid screening medium: 0.5% (w / v) pectin, 0.3% (w / v) KH2PO4, 0.25% (w / v) (NH4)2SO4, 0.02% MgSO4·7H2O, 0.0025% (w / v) FeSO4·7H2O, 1.5% (w / v) agar, prepared with distilled water, pH 5.8-6.0.

[0020] YPD solid medium: 1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) glucose, 1.5% (w / v) agar, prepared with distilled water.

[0021] Liquid fermentation medium: 0.02% (w / v) KH2PO4, 0.1% (w / v) (NH4)2SO4, 0.08% (w / v) MgSO4, 0.05% (w / v) yeast extract, 0.25% (w / v) pectin, prepared with distilled water, pH 6.0.

[0022] Example 1: High-yielding pectinase strain Tausonia pullulans Y4B Screening and Identification 1. Initial screening of strains Weigh 20 g of fresh Shine Muscat grapes into a 500 mL Erlenmeyer flask, add 200 mL of sterile saline, and place in a shaker at 25°C and 180 rpm for 30 min. Dilute the supernatant after shaking with sterile saline in a gradient of 10:10. 2 -10 6 Dilute 200 μL of the solution and spread it evenly on a solid selection medium plate. Incubate at 25°C for 5-7 days until colonies appear. Pick all colonies with different morphologies from the plate and streak them repeatedly on YPD solid medium to isolate and purify the strains until the colonies growing on the plate are pure single colonies.

[0023] The purified strain was re-inoculated onto solid selection medium and cultured at 25°C for 7 days. The plates were then stained with Lugol's iodine solution (2 g potassium iodide, 1 g iodine, diluted to 300 mL with distilled water) for 15 min, and the diameter D of the clear zone of a single colony was observed. p With colony diameter D c Select D p / D c Strains with higher values ​​were selected for initial screening, including Y4B, P2, and GP7. Among them, Y4B produced a clear zone due to pectin degradation, such as... Figure 1 As shown. The selected strains were stored in 20% glycerol cryovials at -80°C.

[0024] 2. Secondary screening of strains The strains obtained from the initial screening were inoculated into liquid fermentation medium and cultured at 25°C and 180 rpm for 3 days with shaking. The fermentation broth was centrifuged at 8000 rpm and 4°C for 15 min, and the supernatant was used as crude enzyme solution for pectinase activity detection. By detecting the pectinase activity of the crude enzyme solutions of each strain, strain Y4B with the highest enzyme activity was finally obtained, with an enzyme activity of 562.36 U / mL.

[0025] 3. Method for determining pectinase activity Since pectinase is a complex enzyme, the pectinase activity tested in this invention is the activity of the complex enzyme.

[0026] The reaction system was as follows: 100 μL of 10 mg / mL pectin substrate, 20 μL of PB buffer (200 mM Na2HPO4 / NaH2PO4, pH 6.0), 60 μL of ddH2O, and 20 μL of appropriately diluted crude enzyme solution. After preheating the buffer and substrate mixture at 30°C for 3 min, 20 μL of crude enzyme solution was added and the reaction was incubated at 30°C for 30 min. The reaction was then terminated by adding 100 μL of DNS reagent. After boiling in a water bath for 10 min, the OD was measured using a microplate reader. 540 The value was set at a specific value, with the reaction of the pre-inactivated enzyme serving as a blank control. One unit of enzyme activity (U) is defined as the amount of enzyme required to produce 1 mg of reducing sugar per minute at a given temperature. Standard curves were plotted using D-galacturonic acid solutions of 50, 100, 150, 200, 250, 300, and 350 μg / ml as standard solutions, and enzyme activity was calculated based on the standard curves.

[0027] 4. Identification of strains Strain Y4B was cultured on YPD solid medium. The colonies were pale yellow, smooth and moist, with round and relatively regular edges. The colony morphology is shown in the figure. Figure 2 .

[0028] Basal DNA was extracted from the strain using a kit. The ITS region of the strain was amplified using primers ITS1F (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4R (5'-TCCTCCGCTTATTGATATGC-3'). The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 45 sec, 29 cycles; 72℃ extension for 10 min. The PCR amplification system (50 μL) was as follows: 10 μL 5×FastPfu Buffer, 2 μL dNTP mixture, 1 μL primer F, 1 μL primer R, 1 μL genomic DNA, 1 μL FastPfu DNA polymerase, and 34 μL sterile distilled water.

[0029] PCR amplification products were subjected to 1% (w / v) agarose gel electrophoresis and analyzed using a gel imaging system. PCR products containing the target fragment were sent to Qingke Biotechnology Co., Ltd. for sequencing, and the results were compared using BLAST homology sequences in the NCBI database. The comparison showed that Y4B was related to strain [specific strain name missing]. Tausonia pullulans CBS: 9213 has an ITS similarity of 99.84%, and Y4B was identified as... Tausonia pullulans kind.

[0030] The nucleotide sequence (615 bp) of the ITS (ITS1F-ITS4R) region of strain Y4B is as follows: TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGCGTGTCTTCATTGACCGCTCACCCTTCTCACCATCCACACATCACCTGTGCACTGTTTAGCCTGAGCCGGTTTTCCGGCCCAGGTTATCATTTCATACAA ACTCTAGTCTTATGAATGTAAACGTTTTTAATAACATAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTG CGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCACCCTCTAGCTTTCTTAATCGTGGCTAGCGGCGTGGACGTGAGCGCTGCTGCTTTGTTGCGGCTCGCTCGAAATGCATTAGCAGACCCTTTTCGTAATCGGTT CCACTCAACGTGATAAGTATTTCGTTGAGGACAGTTGCAGCAATGCGGCTGGCCGGGATAAGAAAGGCATAGTTGTCAGCTTCTAATCGCCCTTGGGCAATTTTTTATGATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA Example 2: Preparation of pectinase solution from strain Y4B 1. Activation of the strain The cryopreserved strain Y4B was inoculated into YPD liquid medium at a 1% (v / v) inoculum for activation and cultured with shaking at 25°C and 180 rpm until the bacterial culture reached OD. 600 When the concentration reaches 0.8-1.0, the activated seed solution is obtained.

[0031] 2. Fermentation by bacterial strain The activated seed culture was inoculated into the fermentation medium at an inoculation rate of 1% (v / v) and fermented at 25°C and 180 rpm for 60 h.

[0032] 3. Enzyme solution preparation The fermentation broth was transferred to centrifuge tubes and centrifuged at 4°C and 8,000 rpm for 20 min. The bacterial cells were discarded, and the supernatant was collected. The supernatant contained pectinase secreted by Y4B. The obtained extracellular supernatant was concentrated and impurities were removed using an ultrafiltration tube with a molecular weight cutoff of 10,000 Da. The concentration was increased to an enzyme activity of 5,000 U / mL, thus obtaining the Y4B pectinase solution. The enzyme solution was aliquoted and stored at 4°C.

[0033] Example 3: Enzymatic characteristics of enzyme solution from strain Y4B 1. Optimal pH Britton-Robinson (BR) buffers with pH values ​​of 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0 were prepared to determine the enzyme activity of Y4B enzyme solution against pectin under different pH conditions. The reaction system consisted of 20 μL of appropriately diluted enzyme solution, 80 μL of 10 mg / mL pectin substrate, and 100 μL of BR buffers at different pH values. The reaction temperature was 30℃, and the reaction time was 10 min. The enzyme activity assay method was the same as in 1.3. The pH corresponding to the highest enzyme activity was the optimum pH of the enzyme solution. The enzyme activity at this point was taken as 100%, and the relative activity at other pH values ​​was calculated by comparing it to this optimum. The results are as follows: Figure 3 As shown, the optimal pH for pectin degradation by the enzyme solution of strain Y4B is 6.0. Under pH conditions of 4.0 and 5.0, 70% and 91% of the enzyme activity are retained, respectively, indicating that the pectinase produced by strain Y4B is an acidic enzyme.

[0034] 2. pH stability The enzyme solution was incubated in BR buffer at pH 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 at 4°C for 15 h, and the residual enzyme activity was measured under different pH incubation conditions. The reaction system consisted of 20 μL of incubated enzyme solution, 80 μL of 10 mg / mL pectin substrate, 20 μL of PB buffer, and 80 μL of ddH2O. After reacting at 30°C for 10 min, enzyme activity was measured according to the enzyme activity detection method described in section 1.3. The activity measured in the unincubated enzyme solution was taken as 100%, and the residual enzyme activity under that condition was expressed as the percentage of the enzyme activity measured after incubation relative to the initial enzyme activity. The results are as follows: Figure 4 As shown, the residual enzyme activity of the enzyme solution of strain Y4B is as high as 89% or more in the pH range of 3.0-10.0, indicating that the pectinase produced by strain Y4B has excellent pH stability.

[0035] 3. Optimal enzyme activity temperature Using pectin as a substrate, the pectinase activity of the enzyme solution was measured at 10, 20, 30, 40, 50, 60, 70, and 80 °C in a 20 mM PB (pH 6.0) buffer system to determine the optimal reaction temperature for pectin degradation. The reaction system consisted of 20 μL of appropriately diluted enzyme solution, 80 μL of 10 mg / mL pectin substrate, 20 μL of PB buffer, and 80 μL of ddH2O. After reacting for 10 min at different temperatures, 100 μL of DNS reagent was added to terminate the reaction. The enzyme activity detection method was the same as in 1.3. The temperature corresponding to the highest enzyme activity is the optimal enzyme activity temperature. The enzyme activity at this temperature was taken as 100%, and the relative activity of the enzyme at other temperatures was calculated by comparing it with this temperature. The results are shown in Figure 1. Figure 5 As shown, the optimal temperature for the enzyme solution of strain Y4B to degrade pectin is 50℃, indicating that the enzyme solution is a medium-to-high temperature enzyme.

[0036] 4. Temperature stability Following the reaction system described in 3.3 and the enzyme activity detection method in 1.3, the residual enzyme activity of pectinase was measured after incubation at 30℃, 40℃, and 50℃ for 0, 30, 60, 90, and 120 min, respectively. The activity measured in the enzyme solution without incubation was taken as 100%, and the residual enzyme activity under these conditions was expressed as the percentage of the enzyme activity measured after incubation relative to the initial enzyme activity. The results are as follows: Figure 6 As shown, the enzyme solution produced by Y4B showed no significant changes after being incubated at 30℃ and 40℃ for 120 min, indicating that the enzyme solution has good stability at medium and low temperatures (≤40℃) and is suitable for use in the juice processing process.

[0037] Example 4: Application of Y4B enzyme solution in Sunshine Rose juice 1. Enzymatic hydrolysis of Sunshine Rose juice by strain Y4B enzyme solution at 20℃ Select Shine Muscat grapes with intact bunches, plump and uniform berries, and free from pests, diseases, and mechanical damage as raw materials. Wash the selected grape bunches with clean water and drain. Remove the berries from the washed bunches, removing the stems and berries that are less than 60% ripe.

[0038] Experiment 1: The grape berries were crushed without adding enzyme solution, kept at 20℃ for 12 h, and then filtered and squeezed to extract the juice using 100-mesh gauze.

[0039] Experiment 2: The grape berries were crushed, 5000 U of enzyme solution was added, and the mixture was kept at 20℃ for 12 h. The juice was then extracted by filtering and squeezing through 100-mesh gauze.

[0040] The volatile aroma in Shine Muscat juice was detected using headspace solid-phase microextraction gas chromatography-mass spectrometry (HS-SPME-GC-MS). The detection method was as follows: 6 mL of Shine Muscat juice was added to a 20 mL headspace vial, along with 1.5 g NaCl and 5 µL of 2-octanol (0.155 g / L) as internal standards. The vial was sealed with a screw cap and placed in the autosampler tray. The shaker was operated at 250 r / min, and the sample was equilibrated at 50℃ for 10 min. The extraction head was inserted through the septum and extracted for 30 min. The sample was then desorbed for 3 min through the GC-MS inlet before GC-MS analysis. Each sample was analyzed in triplicate. GC conditions: high-purity helium, split injection (5:1), inlet temperature 250℃, and a programmed column temperature: initial column temperature 45℃, held for 5 min, increased to 240℃ at 5℃ / min, and finally increased to 260℃ at 20℃ / min, held for 5 min, constant flow mode, and a flow rate of 1 mL / min. MS conditions: Chromatography-mass spectrometry interface temperature 250℃, ion source temperature 230℃, ionization mode: electron ionization (EI), bombardment energy 70 eV, full scan mode, mass number range m / z 30-450. Similarity searches were performed using the NIST 17 and NIST17S mass spectrometry databases. Semi-quantitative analysis was conducted using the internal standard 2-octanol. The calculation method is as follows: Analyte concentration = (internal standard concentration × analyte peak area) / internal standard peak area; The results of volatile aroma are shown in Table 1. Treatment with Y4B enzyme solution at 20℃ significantly increased the concentration of esters such as ethyl caprylate and ethyl decanoate, as well as terpenes such as linalool and geraniol in Sunshine Rose juice, thereby increasing the floral and fruity aroma of the juice.

[0041] Table 1. Volatile aromas in Sunshine Rose juice after enzymatic hydrolysis at 20℃ 2. Enzymatic hydrolysis of Sunshine Rose juice by strain Y4B enzyme solution at 30℃ The selection and cleaning of Sunshine Rose grape berries are the same as in 4.1.

[0042] Experiment 3: The grape berries were crushed without adding enzyme solution, kept at 30℃ for 12 h, and then filtered and squeezed to extract the juice using 100-mesh gauze.

[0043] Experiment 4: The grape berries were crushed, 5000 U of enzyme solution was added, and the mixture was kept at 30℃ for 12 h. The juice was then extracted by filtering and squeezing through 100-mesh gauze.

[0044] Volatile aromas were detected using HS-SPME-GC-MS, following the same method as described in 4.1. The results are shown in Table 2. Treatment with Y4B enzyme solution at 30℃ increased the concentrations of alcohols such as isoamyl alcohol and phenylethanol, as well as esters such as ethyl octanoate and ethyl decanoate in Sunshine Rose juice, thus enhancing the floral and fruity aromas of the juice.

[0045] Table 2. Volatile aromas in Shine Muscat juice after enzymatic hydrolysis at 30℃ Although the present invention has been described in detail with reference to preferred embodiments, it is not limited thereto. Various equivalent modifications or substitutions can be made to the embodiments of the present invention by those skilled in the art without departing from the spirit and essence of the invention, and such modifications or substitutions should all be within the scope of the present invention. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should also be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention should be determined by the scope of the claims.

Claims

1. A non-Saccharomyces cerevisiae strain that produces high levels of pectinase Tausonia pullulans Its characteristics are, The non-Saccharomyces cerevisiae, designated Y4B, was deposited at the China Center for Type Culture Collection on September 30, 2025, with accession number CCTCC NO: M20252182.

2. A microbial inoculant containing the non-Saccharomyces cerevisiae as described in claim 1.

3. A method for preparing pectinase solution, characterized in that, Fermentation culture was carried out using the non-Saccharomyces cerevisiae of claim 1 or the microbial agent of claim 2, and pectinase was obtained by concentration from the fermentation broth.

4. The fermentation method as described in claim 3, characterized in that, The fermentation temperature was 25℃, the fermentation pH was 6.0, and the fermentation time was 60 h.

5. A pectinase solution, characterized in that, Obtained by the fermentation method described in claim 3 or 4.

6. A pectinase solution, characterized in that, The optimal reaction pH is 6.0, and it retains more than 85% of the residual enzyme activity in the pH range of 3.0 to 10.0; the optimal reaction temperature is 50℃, and it has good thermal stability at 40℃ and below.

7. The application of the pectinase solution according to claim 5 or 6 in the processing of Sunshine Rose juice.

8. The application according to claim 7, characterized in that, Application of enzyme solutions in the processing of Sunshine Rose juice to improve the flavor and enhance its floral and fruity aroma.

9. The application according to claim 7 or 8, characterized in that, Treatment at 20℃ increases the content of esters and terpenes in fruit juice, while treatment at 30℃ increases the content of alcohols and esters.

10. The application according to claim 9, characterized in that, The ester compounds are ethyl octanoate and ethyl decanoate; the terpenoid compounds are β-myrcene, β-ocimene, linalool, geraniol, α-terpinene, and nerol; and the alcohol compounds are isoamyl alcohol, phenethyl alcohol, and n-hexanol.