Composite fermentation inoculant capable of increasing relative content of ethyl caprylate and application of composite fermentation inoculant

By using a compound fermentation agent of Saccharomyces cerevisiae S1902 and Galactosomalis M19, combined with specific fermentation conditions and processes, the problems of low yield and monotonous flavor of ethyl caprylate in fruit wine were solved, and the high quality and stability of fruit wine were improved.

CN121652948APending Publication Date: 2026-03-13GUIZHOU BIOTECHNOLOGY RES & DEV BASE CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-05
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

The current fruit wine fermentation process has low ethyl octanoate yield, simple aroma, lack of complex flavor brought by microbial diversity, and a single fermentation environment. It also faces risks of methanol generation, oxidation and flavor loss, temperature sensitivity, clarification and stability issues, lack of standardization and quality control, seasonal limitations of the raw material supply chain, and poor adaptability of industrial equipment and processes.

Method used

A compound fermentation agent composed of Saccharomyces cerevisiae S1902 and Geotrichum galactomycetum M19 in any proportion was used to increase the content of ethyl caprylate by combining specific proportions and fermentation conditions (anaerobic fermentation, temperature control, and enzymatic hydrolysis). Combined with membrane separation technology and pasteurization process, the quality of fruit wine was optimized.

Benefits of technology

It significantly increases the relative content of ethyl octanoate and the richness of ester components in fruit wine, enhances the flavor profile and harmony of the fruit wine, solves a number of technical problems in the fermentation process, and achieves high quality and stability of fruit wine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention belongs to the technical field of microbial engineering, and particularly relates to a composite fermentation inoculant for increasing the relative content of ethyl caprylate and application thereof.The composite fermentation inoculant is composed of saccharomyces cerevisiae and geotrichum galactose yeast, and the composite fermentation inoculant is applied to fruit wine production. Compared with a method only adopting the saccharomyces cerevisiae culture solution and the geotrichum galactose yeast culture solution, the relative content of ethyl caprylate in the fruit wine and the richness of ester components in the fruit wine are greatly improved. Specifically, by adopting the method disclosed by the invention, the ester content and substance composition in the grape, pitaya and passion fruit wine can be improved and are remarkably improved compared with those in a fruit juice natural fermentation group, and the produced fruit wine remarkably shows brandy flavor, similar to pineapple flavor and other flavors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial engineering technology, specifically relating to a compound fermentation agent that increases the relative content of ethyl octanoate and its application. Background Technology

[0002] The flavor quality of fruit wine is one of the key factors determining consumer acceptance, among which volatile flavor compounds (such as esters, alcohols, acids, and terpenes) have a significant impact on the aroma characteristics of fruit wine. Ethyl caprylate, as a medium-chain fatty acid ester, has pleasant aromas such as fruit, sweetness, and floral notes, and is an important flavor contributor to cider, pear wine, grape wine, and tropical fruit wines.

[0003] Ethyl octanoate in fruit wine mainly originates from esterification reactions (the combination of ethanol and octanoic acid) or enzymatic synthesis (such as catalysis by alcohol acetyltransferase AATase) during yeast fermentation. Its content is affected by a variety of factors, such as yeast strain (different yeast strains have significantly different ester synthesis capabilities), fermentation conditions (temperature, pH, oxygen content), substrate supply (fatty acid precursors, nitrogen sources), or microbial interactions (such as the synergistic metabolism between non-sacchariculture yeast and sacchariculture yeast).

[0004] Traditional fruit wine fermentation typically relies on a single brewing yeast ( Saccharomyces cerevisiae However, it has the following problems: First, the yield of ethyl octanoate is low and the aroma is monotonous; second, some commercial yeasts tend to produce high levels of ethanol, but their ester synthesis capabilities are limited; finally, the fermentation environment is monotonous and lacks the complex flavors brought about by microbial diversity.

[0005] In recent years, multi-strain co-fermentation has become a new strategy for enhancing the flavor of fruit wines. Its advantages include: non-brewing yeasts can enhance the accumulation of precursor substances (such as caprylic acid); lactic acid bacteria can regulate acidity and optimize the esterification reaction environment; specific molds can provide exogenous esterifying enzymes to promote ester synthesis; and sequential or co-fermentation can regulate metabolic pathways and increase the yield of ethyl caprylate. By regulating the synthesis of ethyl caprylate through co-fermentation with compound microbial agents, the aroma quality of fruit wine can be improved, enhancing market competitiveness. Secondly, it can reduce the use of exogenous additives, aligning with the trend of natural brewing. Thirdly, it can expand the application of non-brewing yeasts and tap into wild microbial resources. Finally, it can optimize fermentation processes and provide customized solutions for different fruit substrates (such as grapes, dragon fruit, passion fruit, etc.). Furthermore, the current fermented fruit wine industry faces several specific and complex technical problems that directly affect product quality, production efficiency, and market competitiveness. These specifically involve the following technical issues: Firstly, there is a lack of specialized fermentation strains and supporting technologies. Currently, most fruit wine production relies on wine yeast, rather than specialized strains optimized for the characteristics of specific fruits. For example, the fermentation characteristics of tropical fruits such as pineapple and lychee differ significantly from those of grapes, and general-purpose yeasts cannot fully unleash their flavor potential. The selection and breeding of specialized strains needs to address their metabolic adaptability to different fruit sugars, acids, and aromatic substances, while simultaneously balancing fermentation efficiency and flavor preservation.

[0006] Secondly, there are challenges in controlling the fermentation process. Firstly, there is a risk of methanol formation: fruits with high pectin content (such as mangoes) are prone to producing methanol during fermentation, and the risk is even higher if fruit peels or rotten raw materials are used in homemade fruit wine. Experiments show that the methanol content in mango wine is significantly higher than in samples treated with peel. Secondly, there is oxidation and flavor loss: pineapple wine is prone to browning and flavor degradation during fermentation, requiring solutions such as adding antioxidants or using inert gas protection. Finally, there is temperature sensitivity: yeast's optimal temperature is 18-28℃, while acetic acid bacteria require 30-35℃; improper temperature control during process switching can easily lead to fermentation failure or contamination.

[0007] Thirdly, there are technical bottlenecks in clarification and stabilization. Firstly, there's the issue of sedimentation: pectin and proteins in fruit wines easily form turbidity or sediment. Studies show that compound clarifying agents (such as chitosan + diatomaceous earth) are more effective than single agents, but they are more expensive. Secondly, there are difficulties in aging and preserving aroma: for example, ester aromas in pineapple wines are easily volatilized during storage, requiring micro-oxygen aging or the addition of flavor stabilizers to maintain quality.

[0008] Fourth, standardization and quality vary widely. Firstly, there is a lack of industry standards for fruit wines: except for wines and a few fruit wines (such as blueberry wine), most fruit wines lack national standards, leading to significant differences in market products due to companies setting their own standards. Secondly, there are limitations in testing technology: rapid testing methods for safety indicators such as methanol and heavy metals are not yet widely available, making it difficult for small manufacturers to achieve full-process monitoring.

[0009] Fifth, raw material supply chain and seasonal limitations; firstly, there is a shortage of fresh fruit varieties specifically for winemaking: currently, most fruit wines use fresh-eating varieties, whose sugar-acid ratio and tannin content are unsuitable for winemaking. For example, pineapple winemaking requires high-sugar, low-acid varieties, but these are rarely commercially grown. Secondly, there is the issue of seasonal supply: the concentrated ripening period of fruits leads to low factory capacity utilization, necessitating the development of freezing preservation or juice concentration technologies to extend the production cycle.

[0010] Sixth, there is poor compatibility between industrial-scale equipment and processes; among them, small enterprises are technologically backward: most fruit wine companies lack automated temperature and pressure control equipment and rely on traditional fermentation tanks, which easily leads to fermentation runaway (such as bottle explosion) or contamination by miscellaneous bacteria. Furthermore, there are bottlenecks in large-scale production: processes that are successful in the laboratory face problems such as uneven mass transfer and batch differences when scaled up to pilot-scale.

[0011] In conclusion, research on the industrial production of fermented fruit wines is still in the exploratory stage. Optimization and selection of microbial strains, metabolic regulation mechanisms, and industrial scale-up are key future focuses. The maturation of these technologies will drive the development of high-quality, distinctive fruit wines, meeting consumers' diverse flavor demands for fermented fruit wines. Summary of the Invention

[0012] This invention addresses the shortcomings of existing technologies by proposing a compound fermentation agent that increases the relative content of ethyl octanoate and its application.

[0013] Specifically, this is achieved through the following technical solutions: One of the objectives of this invention is to provide: a compound fermentation agent for increasing the relative content of ethyl octanoate, made from Saccharomyces cerevisiae (Saccharomyces cerevisiae). Saccharomyces cerevisiae S1902 and Galactobacillus cereus ( Geotrichum galactomycetum M19 is composed of any proportions. The brewing yeast S1902 was deposited at the China General Microbiological Culture Collection Center on August 1, 2025, with the accession number CCTCC NO: M20251751; the galactosomalidomyces cerevisiae M19 was deposited at the China General Microbiological Culture Collection Center on August 1, 2025, with the accession number CCTCC NO: M20251750.

[0014] Furthermore, the compound fermentation agent for increasing the relative content of ethyl octanoate is composed of Saccharomyces cerevisiae S1902 and Galactosomalis galactosidase M19 in a live cell ratio of 1:1.

[0015] The sequence of the Saccharomyces cerevisiae S1902 strain is as follows:

[0016] The sequence of the Galactobacillus galactosomalidase M19 strain is as follows: TTAGAGGAATTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTATTAATATTTGTGAATTTACCACAGCAAACAAAAATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCA GAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGGGAAGGAAAAG.

[0017] The second objective of this invention is to provide the application of the aforementioned compound fermentation agent that increases the relative content of ethyl octanoate in winemaking, especially in the fermentation of fruit wine.

[0018] A third objective of this invention is to provide a method for fermenting fruit wine, comprising the following steps: 1) Activation of strains and preparation of koji: The above-mentioned compound fermentation strains were inoculated into YPD solid medium and streaked. After activation twice, the activated strains were inoculated into YPD liquid medium and cultured in a shaker at 28℃ and 160r / min for 48 h to obtain koji for fruit wine. 2) Fermentation to produce wine: The fruit wine obtained in step 1) is used to carry out anaerobic fermentation of the diluted fruit juice with yeast. The initial sugar content of fermentation is controlled at 22°BX~26°BX, the initial pH is 3.2~4.0, the fermentation temperature is 15℃~22℃, and the fermentation time is 7 days~10 days.

[0019] The method for preparing the fruit juice dilution is as follows: First, select fruits free from mold and pests, wash and remove the seeds, then blend the fruits with purified water, add pectinase for enzymatic hydrolysis and cell wall breaking treatment, filter with 4 layers of sterile gauze after treatment, take the filtrate and add white sugar and citric acid to adjust the sugar content and pH, thus obtaining the fruit juice dilution.

[0020] Furthermore, a method for making fruit wine includes the following steps: S1 Fruit Processing: Select fruits free from mold and pests, wash and remove seeds, then blend the fruits with purified water, add pectinase for enzymatic hydrolysis and cell wall breaking, filter with 4 layers of sterile gauze after processing, and keep the filtrate for later use. S2 Adjusting sugar content and pH: Add white sugar and citric acid to the filtrate to adjust the sugar content to 26°BX and the pH to 3.2-4.0 to obtain the diluted fruit juice solution; S3 strain activation and yeast inoculation for koji making: The yeast was inoculated onto YPD slant medium and cultured in an incubator at 28℃ for 48 h. Then it was inoculated onto YPD slant medium again and cultured in an incubator at 28℃ for 48 h to fully activate the strain. Then the yeast was inoculated into YPD liquid medium and cultured in a shaker at 28℃ and 160 r / min for 48 h to make koji for fruit wine. S4 Primary Fermentation: Take 500 mL of diluted fruit juice in one bottle, add fruit wine yeast at an inoculation rate of 8% (v / v), seal with plastic wrap, and ferment at 21℃ for 3 days. Then adjust the temperature to 18℃ and continue fermentation for 7 days. Track the changes in sugar and alcohol content every day until the alcohol content reaches 5~8% vol, at which point the fermentation is complete. S5 Filtration and Aging: The fermented wine is filtered using membrane separation technology, and then aged at 4℃ for 10 days to obtain a clear wine. S6 Bottling and Sterilization: After bottling, pasteurize at 65℃ for 30 minutes to obtain the finished fruit wine.

[0021] Beneficial effects: The co-culture of *Saccharomyces cerevisiae* and *Gastrodia galactosum* in fruit wine production significantly increased the relative content of ethyl caprylate and the richness of ester components in the fruit wine compared to using only *Saccharomyces cerevisiae* and *Gastrodia galactosum* cultures. Specifically, the method of this invention can significantly increase the ester content and composition of grape, dragon fruit, and passion fruit wines compared to the natural fermentation group, resulting in fruit wines that exhibit distinct brandy flavors and pineapple-like aromas. Detailed Implementation

[0022] The specific embodiments of the present invention will be described in further detail below, but the present invention is not limited to these embodiments. Any improvements or substitutions based on the basic spirit of these embodiments shall still fall within the scope of protection claimed by the claims of the present invention.

[0023] Example 1 A compound fermentation agent for increasing the relative content of ethyl octanoate, made from Saccharomyces cerevisiae (Saccharomyces cerevisiae). Saccharomyces cerevisiae S1902+Geotrichum galactosomalidase ( Geotrichum galactomycetumM19, based on viable cell count, is a blend of *Saccharomyces cerevisiae* S1902 and *Gastromyces galactosomalidopsis* M19 with a ratio of 1:1 and a cell count ≥ 1 × 10⁻⁶. 8 CFU / mL; its preparation method is as follows: 1) Culture medium preparation: Yeast extract peptone glucose medium (g / L): 10g peptone, 5g yeast extract, 20g glucose; adjust pH to 6.0-6.6. Add 1000mL distilled water, heat to dissolve, dispense into containers, and sterilize at 115℃ for 30min before use.

[0024] 2) Preparation of Saccharomyces cerevisiae S1902 culture medium: The fully activated S1902 yeast cells were inoculated into yeast extract peptone glucose medium in a clean bench and cultured in a shaker at 28℃ and 160 r / min for 48 h for later use.

[0025] 3) Preparation of Galactobacillus galactosidase M19 culture medium: The fully activated M19 yeast was inoculated into yeast extract peptone glucose medium in a clean bench and cultured in a shaker at 28℃ and 160 r / min for 48 h for later use.

[0026] 4) Mixing: Mix the two culture media according to the volume ratio of Saccharomyces cerevisiae S1902 culture media to Galactobacillus galactosidase M19 culture media = 3:1. Use immediately after mixing. Introduce the mixture directly into the diluted juice to start fermentation.

[0027] The sequence of the Saccharomyces cerevisiae S1902 strain is as follows:

[0028] The sequence of the Galactobacillus galactosomalidase M19 strain is as follows: TTAGAGGAATTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATGAATTATTAATATTTGTGAATTTACCACAGCAAACAAAAATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCA GAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGGGAAGGAAAAG. This strain was isolated from a rice wine sample. The isolation and purification method was as follows: the rice wine sample was diluted to 10⁻⁵ and spread on a YPD plate using the plate isolation method. After incubation at 30℃ for 48 h, a single colony was picked with an inoculation loop for streak purification.

[0029] Example 2: Screening Experiment of Microbial Agents for Fermentation of Passion Fruit Wine by Single Strain and Compound Yeast Wash fresh, mold-free, and pest-free passion fruit, extract the juice, and mix it with water at a ratio of 1:10. Add an appropriate amount of white sugar to adjust the sugar content to 26°BX, and then adjust the pH to between 3.2 and 4.0 using citric acid. Pasteurize the prepared fresh fruit juice (65℃, 30 min). After cooling, inoculate with fermentation yeast (8% of the total volume of the fruit wine fermentation liquid) to start the main fermentation (first place the sample at 21℃ for 3 days, then adjust the temperature to 18℃ and continue fermentation for 7 days). Filter and age the wine until it is clear, then bottle and pasteurize to obtain 5-8% vol fruit wine. The following experimental microbial combinations were designed: ① Negative control: natural fermentation; ② Positive control: Commercial koji (wine and fruit wine yeast: Angel Yeast Co., Ltd.); ③ Single yeast: Saccharomyces cerevisiae S1902; ④ Single yeast: Galactosomalidom M19; ⑤ Combination of the present invention: Compound fermentation agent of Example 1: Two bacterial cultures that were independently cultured in yeast extract peptone glucose medium at 28°C and 160 r / min on a shaker for 48 h were mixed and used according to the volume ratio of Saccharomyces cerevisiae S1902 culture medium to Galactobacillus cereus M19 culture medium = 3:1.

[0030] The fruit wine samples from the above experimental groups were subjected to physicochemical tests including pH, total acid, total sugar, alcohol content, sensory evaluation, and flavor compound analysis. The specific procedures are as follows: pH determination: A potentiometric method (pH meter method) is used. The pH value is calculated based on the Nernst equation using the potential difference between the glass electrode (indicating electrode) and the calomel electrode (reference electrode). The specific procedure is as follows: First, preheat and calibrate the instrument (using a standard buffer solution with a pH close to that of the test solution). Second, rinse the electrode with purified water and immerse it in the test solution. Record the measured value after the reading stabilizes.

[0031] Determination of total acidity: Potentiometric titration was performed, referring to the national standard GB 12456-2021, "Determination of Total Acidity in Food". The endpoint was determined by monitoring the change in solution potential using an electrochemical cell. The specific procedure was as follows: 10 mL of the sample was added to a 100 mL beaker, followed by 50 mL of carbon dioxide-free water. The beaker was placed on a magnetic stirrer with a magnetic rotor. Calibration was performed using 0.1 mol / L sodium hydroxide. The electrode was inserted into the sample solution, and titration was performed using an automatic potentiometric titrator. The instrument identified the endpoint pH=8.20 according to the preset program, recorded the volume of sodium hydroxide consumed, and calculated the total acid content according to the formula, recording the value.

[0032] Determination of total sugar: The potassium ferrocyanide method was used. Reagents were prepared according to the analytical method in GB / T 13662-2018 "Huangjiu" standard. Fehling's solutions A and B were azeotropically applied to the reducing sugars under alkaline conditions, reducing copper ions to cuprous ions, which then complex with potassium ferrocyanide in the solution, resulting in a yellow color. Methylene blue was used as an indicator; at the endpoint, a slight excess of reducing sugar reduced the methylene blue to a colorless state. The total sugar content was calculated and recorded based on the volume of sample hydrolysate consumed.

[0033] Alcohol content determination: Refer to Method II, alcohol meter method, of GB 5009.225-2023 "National Food Safety Standard - Determination of Ethanol Concentration in Wines and Edible Alcohol". Take 100 mL of sample, add 50 mL of purified water, condense and distill, keep the temperature of the distillate constant at 20℃, and measure the alcohol content with an alcohol meter and record the value.

[0034] Sensory evaluation criteria: The sensory scoring criteria for wines are shown in Table 1 below.

[0035] Table 1 Sensory Evaluation Criteria for Fruit Wine

[0036] Based on the above-mentioned physicochemical index testing methods and sensory scoring standards, the experimental results and analysis are as follows: Table 1. Statistical table of low-alcohol beverage data for various microbial agent combinations.

[0037] The results in Table 1, obtained by measuring physicochemical indicators, show that the combination of the present invention exhibits a moderate fermentation rate when fermenting low-alcohol fruit wine, with the sample alcohol content maintained between 5% and 8% vol. Furthermore, under the fermentation of the compound microbial agent of the present invention, the fruit wine achieved a sensory evaluation score of 96 points, exhibiting a bright yellow color, clarity, luster, harmonious flavor, balanced sweetness and acidity, and optimal palatability. Compared with the single-strain fermentation group, the total ester percentage of the wine samples was significantly higher than that of single fermentation with *Saccharomyces cerevisiae* and *Gastrodia galactosidase*, by 2.5 times and 1.6 times, respectively; and extremely significantly higher than the natural fermentation group and the fruit wine yeast fermentation group. Simultaneously, the percentage of ethyl octanoate in the combination of the microbial agents of the present invention was significantly higher than that of the single-strain group, the natural fermentation group, and the fruit wine yeast fermentation group, showing an extremely significant difference.

[0038] Example 3: Application of compound yeast agent in pilot production of passion fruit wine Peel fresh, mold-free, and pest-free passion fruits and extract the juice. Mix the passion fruit juice with water at a ratio of 1:10. Add an appropriate amount of white sugar to adjust the sugar content to 26°BX, and then adjust the pH to 3.2-4.0 using citric acid. Pasteurize the prepared fresh fruit juice (65℃, 30 min). After cooling, inoculate with yeast and start the primary fermentation (first ferment the sample at 21℃ for 3 days, then adjust the temperature to 18℃ and continue fermentation for 7 days). Filter and age the wine until it is clear, then bottle and pasteurize to obtain 5-8% vol fruit wine. Design the following implementation scheme combination: ① Passion fruit natural fermentation group ② Commercial yeast (for wine and fruit wine: Angel Yeast Co., Ltd.); ③ Compound yeast agent fermentation group: Example 1 The fruit wine samples from the above experimental groups were subjected to physicochemical analysis (pH, total acid, total sugar, alcohol content, sensory evaluation) and flavor compound analysis (GC-MS). The experimental results and analysis are as follows: Table 2. Statistical Table of Physicochemical Indicators of Passion Fruit Wine for Each Combination

[0039] Table 3. GC-MS analysis of passion fruit wine obtained from natural fermentation

[0040] Table 4. GC-MS analysis of passion fruit wine obtained from commercial koji fermentation.

[0041] Table 5. GC-MS analysis of passion fruit wine obtained from fermentation with microbial agent in Example 1.

[0042] The physicochemical analysis of the pilot-scale production samples of passion fruit wine, as shown in Table 2, indicates that compared with the natural fermentation group and the fruit wine yeast starter group, the microbial agent of this invention (brewing yeast: galactosomalidomyces cerevisiae = 3:1) applied to fermented fruit wine has the same effect trend as the small-scale experiment (Table 1), and the body coordination and flavor of the wine show significant differences.

[0043] GC-MS analysis of the samples in each group revealed the following results, as shown in Tables 3-5: Table 3: Passion fruit juice naturally fermented group contained 20 flavor compounds, including 6 esters (6.36%), with ethyl caprylate accounting for 0.88%. Table 4: Fruit wine yeast fermented group contained 17 flavor compounds, including 6 esters (9.51%), with ethyl caprylate accounting for 2.76%. Table 5: Saccharomyces cerevisiae + Galactobacillus thuringiensis co-fermentation group contained 43 flavor compounds, including 14 esters (48.05%), with ethyl caprylate accounting for 13.08%. Further comparison of the compound microbial agent group with the other two groups revealed that the *Saccharomyces cerevisiae* + *Geotrichum candida* co-fermentation group showed an increase of nine esters compared to the natural fermentation group: ethyl acetate, amyl acetate, ethyl caprylate, ethyl dodecanoate, 2,2,4-trimethyl-1,3-pentanediol diisobutyrate, ethyl cinnamate, ethyl hexadecanoate, ethyl oleate, and ethyl linoleate; among which, the percentage of ethyl octanoate increased by 13.8 times. Simultaneously, the *Saccharomyces cerevisiae* + *Geotrichum candida* co-fermentation group showed an increase of nine esters compared to the fruit wine yeast fermentation group, with the percentage of ethyl octanoate increasing by 3.7 times. Furthermore, the *Saccharomyces cerevisiae* + *Geotrichum candida* co-fermentation of passion fruit wine enriched the wine with alkenes, ketones, phenols, and furans. Therefore, the compound microbial agent of this invention is beneficial for fermenting fruit wine, which enriches the esters in the wine and significantly increases the content of ethyl octanoate, thereby giving the fruit wine a distinct sense of layering, enhancing the fruit aroma, and strengthening the harmony and palatability of the wine.

[0044] Example 4: Expanded application of the compound fermentation agent of Example 1 in other fruit wines. Fresh, mold-free, and pest-free grapes were washed, and dragon fruit was peeled and pulp extracted. Grapes and water were juiced separately in a 1:3 ratio, and dragon fruit and water were juiced separately in a 1:5 ratio. Appropriate amounts of white sugar were added to both to adjust the sugar content to 26°BX, and the pH was adjusted to 3.2–4.0 using citric acid. The prepared fruit juices were pasteurized (65℃, 30 min). After cooling, 8% of the compound fermentation agent from Example 1 (used to increase the relative content of ethyl octanoate) was added, and primary fermentation was initiated (the sample was first fermented at 21℃ for 3 days, then the temperature was adjusted to 18℃ for another 7 days). The wine was filtered, aged until clear, bottled, and pasteurized to obtain 5–8% vol fruit wine. Samples were taken for testing of physicochemical indicators (pH, total acid, total sugar, alcohol content, sensory evaluation) and flavor compounds (GC-MS). The experimental results and analysis are as follows: Table 6. Physicochemical data of grape wine and dragon fruit wine fermented with compound fermentation agent in Example 1.

[0045] Table 7. GC-MS Material Analysis of Grape Wine Fermented with Compound Fermentation Agent in Example 1

[0046] Table 8. GC-MS Material Analysis of Dragon Fruit Wine Fermented with Compound Fermentation Agent in Example 1

[0047] The compound microbial agent of this invention (Saccharomyces cerevisiae S1902:Gastromyces galactosidase M19=3:1) expands the application range of fruit wine. Taking fermented grape wine and dragon fruit wine as examples, through the analysis of the physicochemical indicators of the two types of fruit wine, this compound microbial agent is suitable for the fermentation of grape wine and dragon fruit wine. The resulting wine is slightly red, clear, transparent and glossy, with distinct grape and dragon fruit flavors, full-bodied overall, highly palatable, and has distinct typical characteristics of fruit wine.

[0048] Meanwhile, flavor compounds were tested in the fermented fruit wines, and the results are shown in Tables 7 and 8. When the compound microbial agent of this invention (Saccharomyces cerevisiae S1902:Gastromyces galactosidase M19 = 3:1) was used to ferment grape wine, the percentage of ethyl caprylate (EOC) in the wine was 11.21%. Secondly, when fermenting dragon fruit wine, the percentage of EOC was 9.76%. Both types of fruit wine fermentation enrich the variety of esters in the wine; simultaneously, they promote the formation of alkenes and high-quality alcohols. This further proves that the compound microbial agent of this invention (Saccharomyces cerevisiae S1902:Gastromyces galactosidase M19 = 3:1) can increase the content of EOC and its precursor caprylic acid in fruit wine, enrich the variety of esters in the fruit wine, and enhance the flavor complexity, harmony, and typicality of the fruit wine.

Claims

1. A compound fermentation agent for increasing the relative content of ethyl octanoate, characterized in that, From brewing yeast ( Saccharomyces cerevisiae ) and Galactosomalis galactosomal ( Geotrichum galactomycetum The ingredients are composed in any proportion. The brewing yeast S1902 was deposited at the China General Microbiological Culture Collection Center on August 1, 2025, with accession number CCTCC NO: M20251751; the galactosomalidomyces cerevisiae M19 was deposited at the China General Microbiological Culture Collection Center on August 1, 2025, with accession number CCTCC NO: M20251750.

2. The compound fermentation agent for increasing the relative content of ethyl octanoate as described in claim 1, characterized in that, It is composed of Saccharomyces cerevisiae S1902 and Galactosomalis M19 in a live cell ratio of 1:

1.

3. The application of a compound fermentation agent for increasing the relative content of ethyl octanoate as described in claim 1 or 2 in brewing.

4. The application of the compound fermentation agent for increasing the relative content of ethyl octanoate as described in claim 3 in brewing, characterized in that, The winemaking mentioned refers to fermented fruit wine.

5. A method for fermenting fruit wine, characterized in that, Includes the following steps: 1) Activation and inoculation of the strain for making koji: The above-mentioned compound fermentation strain was inoculated into YPD solid medium and streaked. After activation twice, the activated strain was inoculated into YPD liquid medium and cultured in a shaker at 28℃ and 160r / min for 48 h to obtain koji for fruit wine. 2) Fermentation to produce wine: The fruit wine obtained in step 1) is used to carry out anaerobic fermentation of the diluted fruit juice with yeast. The initial sugar content of fermentation is controlled at 22°BX~26°BX, the initial pH is 3.2~4.0, the fermentation temperature is 15℃~22℃, and the fermentation time is 7 days~10 days.

6. The method for fermenting fruit wine as described in claim 5, characterized in that, The method for preparing the fruit juice dilution is as follows: First, select fruits free from mold and pests, wash and remove the seeds, then blend the fruits with purified water, add pectinase for enzymatic hydrolysis and cell wall breaking treatment, filter with 4 layers of sterile gauze after treatment, take the filtrate and add white sugar and citric acid to adjust the sugar content and pH, thus obtaining the fruit juice dilution.