Mango flowering regulation gene MiABI5-like7 and application thereof

Abstract

The invention provides a mango flowering regulation gene MiABI5-like7 and application thereof, and belongs to the technical field of gene engineering. The invention discovers a new application of the MiABI5-like7 gene in regulating and controlling the flowering of plants, and discovers that the bolting and the flowering period of arabidopsis thaliana are obviously advanced and the quantity of rosette leaves is obviously reduced by heterologous overexpression of the MiABI5-like7 gene in arabidopsis thaliana, which indicates that the gene has the function of promoting the flowering of arabidopsis thaliana. Through silent expression of the MiABI5-like7 gene in mango buds, it is found that the conversion time of the mango flower buds is obviously delayed, the green tip rate (initial flower bud rate) is obviously reduced, it is indicated that silencing of the gene has the function of delaying formation of the mango flower buds, and therefore the MiABI5-like7 gene can also be used for regulating and controlling the flowering time of mangoes.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a mango flowering regulation gene. MiABI5-like7 And its applications. Background Technology

[0002] Mango is a widely cultivated fruit crop globally, primarily growing in tropical and subtropical regions. The flowering time of mangoes is a crucial factor affecting yield and quality. In my country's main mango-producing areas, the flowering period is susceptible to adverse weather conditions such as late spring frosts or low temperatures and rainy weather, leading to poor pollination and fertilization, low fruit set, and thus unstable yields. Delaying or advancing the flower bud transition time to avoid unfavorable environmental conditions is an important measure to address this problem. Therefore, understanding the regulatory mechanisms of flower transition is essential for developing technical solutions to control flowering time.

[0003] Flower bud transition represents the shift of buds from vegetative to reproductive growth, accompanied by structural and cytological changes in the bud, which are strictly controlled by environmental stimuli and internal signals. In Arabidopsis, flowering pathways including vernalization, photoperiodism, autonomy, and Fusarium wilt have been proposed. These pathways integrate environmental and developmental signals and jointly regulate flowering. FLOWERING LOCUS T (FT) and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) Various flower integrators, including those involved in flower development, determine flower transformation. To date, several flowering-related genes have been isolated and identified in mangoes, such as... MiFTs , MiRZFP34 and MiCOL2s Five flowering time regulators have been identified in the genome of the "Four Seasons Honey" mango. MiFT1a , MiFT1b , MiFT2 , MiFT3 and MiFT4 These proteins have all been shown to significantly promote early flowering in Arabidopsis thaliana. Furthermore, some proteins affecting plant flowering have been found to interact directly with factors regulating flowering time. For example, MiRZFP34 It has been proven to be able to MiFT2 The interactions revealed a complex regulatory network for mango flowering. However, MiABI5 The biological functions of homologous genes in mangoes are largely unknown.

[0004] Based on this, the present invention is proposed. Summary of the Invention

[0005] The purpose of this invention is to reveal the regulatory genes of mango flowering and provide regulated genes for promoting or delaying plant flowering.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a mango flowering regulatory gene MiABI5-like7 The nucleotide sequence of the gene MiABI5-like7 is shown in SEQ ID NO: 1.

[0007] The present invention also provides a method comprising the said gene. MiABI5-like7 The carrier of expression.

[0008] Preferably, the expression vector includes an overexpression vector and a silent expression vector.

[0009] Preferably, the overexpression vector is pCAMBIA1300-35S-MiABI5-like7, and the silencing expression vector is pTRV2-MiABI5-like7-VIGS.

[0010] The present invention also provides the aforementioned gene. MiABI5-like7 Or the application of the expression vector in regulating plant flowering.

[0011] Preferably, the gene is overexpressed in the plant. MiABI5-like7 Promotes early flowering in plants by silencing the expression of the gene in the plant. MiABI5-like7 Delaying plant flowering.

[0012] Preferably, the plant that flowers early is Arabidopsis thaliana, and the plant that flowers late is mango.

[0013] The present invention also provides the use of the aforementioned gene MiABI5-like7 Or the method of regulating plant flowering using the expression vector, to construct a gene MiABI5-like7 The overexpression vector or silenced expression vector is used to infect plants, resulting in transgenic plants that flower earlier or later.

[0014] This invention discovered MiABI5-like7 Novel uses of genes to regulate plant development through heterologous overexpression in Arabidopsis thaliana MiABI5-like7 Gene analysis revealed that bolting and flowering in Arabidopsis thaliana were significantly advanced, while the number of rosette leaves was significantly reduced, indicating that this gene has a function in promoting flowering in Arabidopsis thaliana. Furthermore, silencing its expression in mango buds... MiABI5-like7 Gene analysis revealed that the time of mango flower bud transformation was significantly delayed, and the green tip rate (initial flower bud rate) was significantly reduced, indicating that silencing this gene has the function of delaying mango flower bud formation. MiABI5-like7 Genes can be used to regulate the flowering time of mangoes. Attached Figure Description

[0015] Figure 1 Regulating mango flowering MiABI5-like7 Functional analysis and validation of genes in Arabidopsis thaliana and mango buds. Among them: A: Flowering phenotypes of wild-type (WT) and 35S::MiABI5-like7 transgenic Arabidopsis thaliana plants. The scale bar in Figure A is 1 cm.

[0016] Flowering time (B) and number of rosette leaves (C) of BC:35S::MiABI5-like7-GFP transgenic Arabidopsis lines. Values ​​are mean ± standard error. P < 0.05 (Student t-test). Flowering time and rosette leaf number were statistically analyzed when the plant bolted to 1 cm.

[0017] D: Developmental changes in mango buds in the control group and the MiABI5-like7 silent group.

[0018] EF: 10 days after VIGS treatment, in the terminal bud MiABI5-like7 (E) and MiFT3 (F) level of expression.

[0019] G: Silence MiABI5-like7 The green tip rate (initial flower buds) decreased 10 days after VIGS treatment. Values ​​are mean ± standard error. P < 0.01 (n = 3, Student's t-test). Detailed Implementation

[0020] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0021] The experimental materials used in the following examples were: the mango variety “Tainong No. 1 (Mangifera indica L. 'Tainong No. 1')”, obtained from the Mango Resource Nursery of the South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences. The Arabidopsis thaliana seeds used were from the Colombian wild-type Col.

[0022] The primers used in the following examples are as follows: SEQ ID NO:3 Primer F1: 5'-GGCCGCTCTAGAACTAGTGGATCCATGGATGAGCTACTGAAA-3' SEQ ID NO:4 Primer R1: 5'-ATCGATAAGCTTGATATCGAATTCCTACCACGGACCTGTCATTGTC-3' SEQ ID NO:5 Primer F2: 5'-CGAGCTCGGTACCCGGGGATCCATGGATGAGCTACTGAAAA-3' SEQ ID NO:6 Primer R2: 5'-CATGGTCTTTGTAGTCCATGTCGACCCACGGACCTGTCATTGTC-3' SEQ ID NO:7 Primer F3: 5'-TTCATTTGGAGAGAACACGGGGGGAC-3' SEQ ID NO:8 Primer R3: 5'-GCTGGCCAGGAACTGAATTG-3' SEQ ID NO:9 Primer F4: 5'-TCTGTGAGTAAGGTTACCGAATTCCGGAAGGGCCAAATAATG-3' SEQ ID NO:10 Primer R4: 5'-CTTCGGGACATGCCCGGGCCTCGAGTGGGTTTGCAACACTGACA-3' SEQ ID NO:11 Primer F5: 5' - TGTGGCTTTTGCCTCTCCAA-3' SEQ ID NO:12 Primer R5: 5'-ACCCCCAGTACCTAAACCAGA-3' SEQ ID NO:13 Primer F6: 5'-ATGGATGGAGAGGACTATGGT-3' SEQ ID NO:14 Primer R6: 5'-CCATAAGTTGCTCCTGTACT-3'.

[0023] Example 1

[0024] MiABI5-like7 Overexpression of genes promotes early flowering in Arabidopsis thaliana.

[0025] 1. MiABI5-like Construction of gene overexpression vectors

[0026] (1) ​ Gene sequence cloning

[0027] Using cDNA from initial flower bud tissue of mango as a template, the CDS sequence of XM_044635194.1 was obtained from the mango genome (GCA_011075055.1, https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_011075055.1). Primers F1 (SEQ ID NO: 3) and R1 (SEQ ID NO: 4) were designed, and the target fragment (SEQ ID NO: 1) was obtained by PCR amplification using Nanjing Novizan high-fidelity enzyme P505.

[0028] SEQ ID NO: 1 ​ CDS sequence;

[0029] (2) Construction of pGreenII 62-SK-MiABI5-like7 vector

[0030] The purified target gene PCR product was ligated in vitro with the vector pGreenII 62-SK digested with BamHI-EcoRI (recombinase purchased from Shanghai Yisheng Company). After ligation, competent E. coli cells were transformed. The transformed single colonies were identified by PCR using primers F1 and R1 after shaking. The positive bacterial colonies identified by PCR were sequenced.

[0031] (3) Construction of pCAMBIA1300-35S-MiABI5-like7 expression vector

[0032] Using pGreenII 62-SK-MiABI5-like7 plasmid as a template, primers F2 (SEQ ID NO: 5) and R2 (SEQ ID NO: 6) were designed based on the target sequence and the final vector backbone for PCR amplification, and the target fragment was recovered. The purified target gene PCR product was ligated in vitro with the vector pCAMBIA1300-35S-3xFlag digested with BamHI-SalI (recombinase purchased from Shanghai Yisheng Company). After ligation, competent E. coli cells were transformed. The transformed single colonies were identified by PCR using primers F2 and R2 after shaking. The positive bacterial colonies identified by PCR were sequenced.

[0033] 2. Obtaining MiABI5-like7 transgenic Arabidopsis plants (lines)

[0034] (1) Preparation of Agrobacterium tumefaciens bacterial culture

[0035] The pCAMBIA1300-35S-MiABI5-like7 expression vector was introduced into Agrobacterium tumefaciens GV3101 for Arabidopsis thaliana transformation. Bacterial cells with OD600 = 0.8-1.2 were collected from LB broth culture and placed in a 5% sucrose solution with 0.02% silwet L-77 surfactant added.

[0036] (2) Preparation of Arabidopsis thaliana plants

[0037] Sow Arabidopsis thaliana seeds in nutrient soil, ensuring that only a small amount of water remains in the water tray after the soil has absorbed water. Incubate at 22℃±2℃ until flowering.

[0038] (3) Transformation of Arabidopsis thaliana by inflorescence infection method

[0039] Remove the formed pods, then immerse the surface of Arabidopsis thaliana flowers in Agrobacterium tumefaciens solution for 60 seconds, followed by overnight moistening. The immersion cycle is 7 days, with a total of 3 immersions.

[0040] (4) Screening of positive plants

[0041] After harvesting the transformed plants, they were sterilized with sodium hypochlorite and evenly spread on MS medium containing 50 mg / L hygromycin, and placed at 4°C for 2 days. Then, the plates were placed at 23°C±2°C and cultured for 16h / 8h (light / dark) for two weeks. After that, the positive plants that germinated normally were selected and planted in the soil, and continued to be cultured and managed until harvest.

[0042] (5) PCR detection of transgenic seedlings and acquisition of T3 transgenic lines

[0043] Leaves were harvested from T1 generation transgenic plants, and DNA was extracted using the CTAB method. Primers F3 (SEQ ID NO: 7) and R3 (SEQ ID NO: 8) were designed to verify the target gene sequence via PCR. Subsequently, seeds of the transgenic plants were screened on MS medium supplemented with 50 mg / L hygromycin to ultimately establish a homozygous T3 transgenic line. The study focused on phenotypic characteristics, including parameters such as flowering time and the number of rosette leaves.

[0044] 3. Phenotypic analysis of transgenic Arabidopsis thaliana

[0045] Three independent transgenic Arabidopsis lines (OE-1, OE-3, and OE-5) were selected for flowering phenotypic analysis. ​ A). Compared to the wild type (WT), under the same conditions, all transgenic lines exhibited an early flowering phenotype (Fig. 1A-B) and a significantly reduced number of rosette leaves (Fig. 1C), indicating that... ​ Genes can help plants flower earlier.

[0046] Example 2

[0047] mango buds ​ Gene silencing delays the timing of flower bud transition.

[0048] 1. Construction of pTRV2-MiABI5-like7-VIGS vector and genetic transformation of mango buds

[0049] (1) Using cDNA from mango flower bud tissue as a template, PCR amplification was performed using primer pair F4 and R4. The sequences of primers F4 and R4 are detailed in SEQ ID NO: 9 and SEQ ID NO: 10, respectively. The PCR amplification product was 350 bp (SEQ ID NO: 2).

[0050] SEQ ID NO: 2 MiABI5-like7 VIGS (RNAi) fragment: CGGAAGGGCCAAATAATGTTGGACTTTTTGCGAATAATGGCAATACGAGTTTAGCTCTTGGATTTCAGCAGCCAAGTAGAGACAATGGGCTGTTGGCTAAATGTGTAATGGCGAACAGCAATTCAGTTCCTGGCCAGCCTTCTGGTTTGGCACTGAATGTTGGCGGAGTCATCTC CTCACAGCAACCACAGCAGCTGCAACAGCATCGGTATCAACCTCAGCAGCAGCGGCCTCTCTTCCCTAAGCAAGCAACTGTGGCTTTTGCCTCTCCAATGAATTTAGTGAACACAACAGAGCTTACTGGAACTTCTCCGAGAGCAAGGGGTCCAGTTGTCAGTGTTGCAAACCCA.

[0051] (2) 350 bp ​ The CDS fragment was inserted into the vector pTRV2 to construct the recombinant viral vector pTRV2-MiABI5-like7.

[0052] (3) After sequencing verification, plasmids pTRV2-MiABI5-like7, pTRV1 and pTRV2 were transformed into Agrobacterium GV3101.

[0053] (4) Agrobacterium solution containing pTRV2-MiABI5-like7 and pTRV1 (in a ratio of 1:1) was used to infect dormant buds of mango branches that were about 70 days old, while Agrobacterium solution containing pTRV2 and pTRV1 (in a ratio of 1:1) was used as a negative control.

[0054] (5) The specific infection process is as follows: Use a 1 ml syringe to inject the bacterial suspension into the base of the bud, that is, the connection between the bud and the branch. Then cover the injection site and the entire bud with a cotton ball soaked in the same Agrobacterium solution and keep it moist for 48 hours to ensure that Agrobacterium is in long-term contact with the bud tissue.

[0055] (6) Experimental design: The experiment included three replicates, each containing 30 dormant buds; 10 buds were used to analyze the silencing effect, and 20 buds were used to calculate the proportion of green tip buds (initial flower buds). Samples were collected 10 days after infection, and the gene silencing status in the apical buds was assessed by real-time quantitative PCR (RT-qPCR), while the proportion of green tip buds was determined.

[0056] (7) RT-qPCR analysis: Total RNA was extracted from shoots using the EASYspin Plant Rapid RNA Extraction Kit (Aide Biotechnology, Beijing). Reverse transcription was performed using the HiScript® Q Select RT SuperMix for qPCR Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number: R312-02) according to the manufacturer's protocol. RT-qPCR reactions were performed using the DyNAmo Flash SYBR Green qPCR Kit (Thermo Fisher Scientific, USA), strictly following the specified experimental procedures. The reaction conditions were as follows: 95°C pre-denaturation for 5 minutes, followed by 40 cycles of 95°C for 10 seconds, 60°C for 20 seconds, and 72°C for 10 seconds per cycle. Gene expression levels were analyzed by 2... -ΔΔT The formula was used for calculation. Quantitative analysis of the target gene was performed using the LightCycler 480 II system (Roche, Switzerland). Detection. ​ Primers F5 and R5 for gene expression are detailed in SEQ ID NO: 11 and SEQ ID NO: 12; detection of flowering genes that have undergone functional validation. ​ For details of the expressed primers F6 and R6, please refer to sequences SEQ ID NO: 13 and SEQ ID NO: 14.

[0057] 2. In mango buds ​ Gene silencing effect analysis

[0058] In order to clarify ​ The role of genes in the transition from dormant buds to flower buds in mangoes was investigated. Virus-induced gene silencing (VIGS) analysis was performed on dormant buds at approximately 70 days of age to determine the role of genes in the transition. ​ Gene. Ten days after infection treatment, the pTRV:MiABI5-like7 group inhibited the transformation of mango buds from dormant to green tips. ​ D). Compared with the blank pTRV treatment group, the pTRV: MiABI5-like7 group ​ and ​ The expression level was significantly reduced ( ​ EF), resulting in a significantly lower green tip percentage compared to the control group ( ​ G). Therefore, we have confirmed that ​ The expression of this is crucial for flower bud differentiation in mangoes. ​ Gene silencing delays the time of mango flower bud transformation.

[0059] As can be seen from the above embodiments, (1) the present invention constructs ​ Gene overexpression vectors were heterologously overexpressed in Arabidopsis thaliana. ​After gene sequencing, it was found that the bolting and flowering period of Arabidopsis thaliana were significantly advanced, and the number of rosette leaves was significantly reduced, indicating that the gene has the function of promoting flowering in Arabidopsis thaliana. (2) This invention constructs ​ Gene silencing vectors silence expression in mango buds ​ After gene silencing, it was found that the mango flower bud transition time was significantly delayed and the green tip rate (initial flower bud rate) was significantly reduced, indicating that silencing this gene has the function of delaying mango flower bud formation. ​ Genes can be used to study the molecular mechanisms regulating flowering in evergreen fruit trees, and can also be used to regulate the flowering time of mangoes.

[0060] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A mango flowering regulatory gene MiABI5-like7 Its characteristics are, The gene MiABI5-like7 The nucleotide sequence is shown in SEQ ID NO:

1.

2. A gene comprising the gene of claim 1 MiABI5-like7 The carrier of expression.

3. The expression vector as described in claim 2, characterized in that, The expression vectors include overexpression vectors and silent expression vectors.

4. The expression vector as described in claim 3, characterized in that, The overexpression vector is pCAMBIA1300-35S-MiABI5-like7, and the silencing expression vector is pTRV2-MiABI5-like7-VIGS.

5. The gene according to claim 1 MiABI5-like7 Or the application of the expression vector according to any one of claims 2 to 4 in regulating plant flowering.

6. The application as described in claim 5, characterized in that, Overexpression of the gene in plants MiABI5-like7 Promotes early flowering in plants by silencing the expression of the gene in the plant. MiABI5-like7 Delay plant flowering.

7. The application as described in claim 6, characterized in that, The plant that flowers early is Arabidopsis thaliana, and the plant that flowers late is mango.

8. Using the gene according to claim 1 MiABI5-like7 Or the method for regulating plant flowering using an expression vector as described in any one of claims 2 to 4, characterized in that, Constructing genes MiABI5-like7 The overexpression vector or silenced expression vector is used to infect plants, resulting in transgenic plants that flower earlier or later.

Images