Maize MYB3R gene as well as encoding protein and application thereof

Abstract

The invention relates to a corn MYB3R gene as well as an encoding protein and application thereof, and relates to the technical field of plant genetic engineering, the nucleotide sequence of the corn MYB3R gene is shown as SEQ ID NO.1, and the amino acid of the encoding protein is shown as SEQ ID NO.2. The invention proves that the corn MYB3R gene can negatively regulate and control the stomatal density and opening of corn leaves, so that the corn MYB3R gene, the encoded protein thereof and related biological materials provided by the invention can be used for regulating and controlling the stomatal density and opening of plant leaves, and have great application and popularization values.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a type of maize. MYB3R Genes and their encoded proteins and their applications. Background Technology

[0002] Plant stomata are key structures that regulate gas and water exchange. They allow carbon dioxide to enter the plant for photosynthesis and release oxygen. Therefore, stomata are mainly used for photosynthesis and respiration. The distribution, density, size, and opening and closing of stomata on leaves can affect the resistance to CO2 entry and O2 diffusion, thus affecting the photosynthesis of plants.

[0003] In addition to their physiological functions, stomata play a role in plant immune defense. When plants detect the presence of certain pathogens, they quickly close their stomata to prevent microorganisms from entering. The stomatal response to pathogens is a rapid mechanism independent of physical damage. When the plant's immune system detects a threat, the plant will preferentially close its stomata, even if this temporarily affects its photosynthesis and growth.

[0004] Currently, many genes have been reported to be involved in the regulation of stomatal density and aperture in plant leaves. For example, stomatal development is regulated by the bHLH (basic helix-loop-helix) family transcription factors SPCH (SPEECHLESS), MUTE, FAMA, and binding proteins SCREAM (SCRM / ICE1) and SCRM2. The absence of these transcription factors will lead to the inability of stomata to form normally. The small peptide EPF1 / 2 (epidermal patterning factor 1 / 2) negatively regulates stomatal density by regulating the division pattern of stomatal precursor cells to inhibit stomatal formation. Another small peptide produced in mesophyll tissue, EPFL9 (or STOMAGEN), positively regulates stomatal density. The receptor proteins ER (erecta) and ERL (erecta-like) of the small peptide also positively regulate stomatal density, and their interaction plays a role in regulating stomatal development. The protease SDD1 (stomatal density and distribution 1) is also a negative regulator in stomatal development. MYB transcription factors are one of the largest transcription factor families in plants, including four subfamilies: R1-MYB, R2R3-MYB (2R), R1R2R3-MYB (3R), and R4-MYB. They are widely involved in plant growth, development, and stress responses. The R1R2R3-MYB (3R-MYB) subfamily contains relatively few members, most of which are related to the regulation of mitosis and DNA damage responses. However, their function in plant stomatal regulation has not been reported to date. Summary of the Invention

[0005] The purpose of this invention is to provide a corn variety that solves the above-mentioned problems. MYB3R Genes and their encoded proteins and their applications.

[0006] The present invention achieves the above objectives through the following technical solutions: This invention provides a corn MYB3R Gene ， The corn MYB3R The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] The present invention also provides a corn MYB3R The gene encodes a protein, the amino acids of which are shown in SEQ ID NO.2.

[0008] The present invention also provides a corn MYB3R Application of genes in regulating stomatal density and aperture in plant leaves.

[0009] As a further optimization of the present invention, the corn MYB3R Genes negatively regulate stomatal density and aperture in maize leaves.

[0010] As a further optimization of the present invention, the corn is the corn inbred line KN5585.

[0011] A new method for obtaining maize germplasm, using CRISPR-Cas9 gene editing technology to modify maize germplasm as described above. MYB3R Gene editing to suppress the corn MYB3R Gene expression, construction and acquisition MYB3R-CRISPR-Cas9 Gene editing vectors are used to perform genetic transformation on maize. The resulting positive seedlings are the new maize germplasm. The leaf stomatal density and aperture of the new maize germplasm are higher than those of wild-type maize. Corn as described above MYB3R The gene is introduced into the maize genome as the target gene and overexpressed. The resulting positive seedlings are the new maize germplasm. The leaf stomatal density and aperture of the new maize germplasm are lower than those of wild-type maize.

[0012] As a further optimization of the present invention, in CRISPR-Cas9 gene editing technology, using maize... MYB3R Two sgRNA target sites were designed using the gene's nucleotide sequence as a template to construct... MYB3R-CRISPR-Cas9 The gene editing vector, wherein the sgRNA target sequence is shown in SEQ ID NO.3 and SEQ ID NO.4; Target 1 sequence: SEQ ID NO.3: GGAATGATAAGCTCTTCCAG; Target 2 sequence: SEQ ID NO.4: GGTAATGAGTTGAAGACGGG.

[0013] The beneficial effects of this invention are as follows: This invention proves that corn MYB3R Genes can negatively regulate stomatal density and aperture in maize leaves; therefore, the maize provided by this invention... MYB3R Genes and their encoded proteins, as well as related biological materials, can be used to regulate stomatal density and aperture in plant leaves, and have significant application and promotion value. Attached Figure Description

[0014] Figure 1 For corn myb3r-1 and myb3r-2 A schematic diagram illustrating gene editing in mutants; Figure 2 For overexpression MYB3R Genetic maize lines MYB3R A comparison chart of gene expression levels; Figure 3 For corn myb3r-1 mutants and maize MYB3R Phenotypic diagrams (AB) and statistical graphs (C) of stomatal density and aperture in leaves of OE4 gene-overexpressing plants; different lowercase letters represent significance analysis ( P <0.05). Detailed Implementation

[0015] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0016] 1. Materials Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0017] 2. Method 2.1 MYB3R Obtaining CRISPR / Cas9 knockout mutant genetic material and overexpression genetic material MYB3R Obtaining a gene knockout vector: This involves... MYB3R Gene( MYB3RThe full-length coding sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. Two 20bp target sequences (nucleotide sequences of target 1 are shown in SEQ ID NO.3; nucleotide sequences of target 2 are shown in SEQ ID NO.4) were synthesized and ligated between the maize U6 promoter and terminator. Subsequently, the fragment containing the U6 promoter-synthetic fragment-U6 terminator was ligated into a CRISPR / Cas9 knockout vector to obtain... MYB3R Gene knockout vector; Target 1 sequence: SEQ ID NO.3: GGAATGATAAGCTCTTCCAG; Target 2 sequence: SEQ ID NO.4: GGTAATGAGTTGAAGACGGG; MYB3R Obtaining a gene overexpression vector: This involves... MYB3R The full-length coding sequence of the gene (nucleotide sequence as shown in SEQ ID NO.1) was amplified using cDNA from the maize inbred line KN5585 as a template, and primers with nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6. The amplified fragment was then ligated into the WMV017 vector (from Weimi Biotechnology (Jiangsu) Co., Ltd.) to obtain... MYB3R Gene overexpression vector, wherein the primer sequences shown in SEQ ID NO.5 and SEQ ID NO.6 are as follows: SEQ ID NO.5: gtcgactctagaggatccATGTGCATGGGACTAACAAAAAG; SEQ ID NO.6: atctttgtaatccatcccgggCATCCTGTTAGAATCTACG; Will MYB3R Gene knockout vectors and MYB3R Gene overexpression vectors were genetically transformed into the maize inbred line KN5585 by Weimi Biotechnology (Jiangsu) Co., Ltd., to obtain CRISPR / Cas9 knockout mutant genetic material and MYB3R Genetic material with overexpressed genes.

[0018] 2.2 Editing and Identification of Transgenic Plants Using maize DNA as a template, gene-specific identification primers were designed upstream and downstream of the target sequence, and PCR was used to amplify the fragment containing the target sites of SEQ ID NO.3 and SEQ ID NO.4 (fragment size 796bp).

[0019] The identification primers are as follows: SEQ ID NO.7: MYB3R -F:CAAGGATAAAATGAAGCCCGTGG; SEQ ID NO.8: MYB3R -R:TAGCCCATCAACAGAACCCAGCG; PCR amplification was performed on fragments containing the targets described above in SEQ ID NO.3 and SEQ ID NO.4. The PCR reaction system (25 μl reaction system) consisted of: 12.5 μl of 2×Rapid Taq Master Mix; 2 μl of DNA template. ZmCYCB1;2 -F primer, 1 μl; ZmCYCB1;2 -R primer, 1 μl; ddH2O, 8.5 μl; PCR reaction conditions: 95℃, 3 min; 95℃, 15 sec, 53℃, 15 sec, 72℃, 1 min, 32 cycles; 72℃, 5 min.

[0020] PCR amplification and sequencing verification were performed to obtain MYB3R Information on gene editing has been obtained. myb3r-1 and myb3r-2 homozygous mutant lines, such as Figure 1 As shown, myb3r-1 mutants in MYB3R Gene target 1 has two bases missing, and target 2 has one base added; myb3r-2 The mutant is in MYB3R The addition of one base at the gene target site and the deletion of eight bases at target site 2 both prematurely introduce stop codons, causing premature termination of protein translation; for example... As shown, the results indicate that both overexpression maize materials, as verified by quantitative real-time PCR, resulted in... Figure 2 Gene expression was significantly upregulated.

[0021] 2.3 MYB3R Phenotypic observation of gene knockout and overexpression MYB3R After the ears of gene knockout and overexpression homozygous maize plants matured, single ears were harvested per plant, with the wild-type maize inbred line KN5585 (WT) serving as a control. MYB3R mutant ( myb3r and myb3r-1 Analysis of stomatal density and aperture of leaves from overexpression materials (OE3, OE4) and WT, results are as follows: myb3r-2 As shown, Figure 3 myb3r The stomatal density and stomatal aperture of the mutant leaves were significantly higher than those of the wild type.

[0022] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A type of corn MYB3R Genes, characterized by, The corn MYB3R The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. A type of corn as described in claim 1 MYB3R The protein encoded by the gene is characterized by, The amino acids encoding the protein are shown in SEQ ID NO.

2.

3. A type of corn as described in claim 1 MYB3R Application of genes in regulating stomatal density and aperture in plant leaves.

4. The application according to claim 3, characterized in that, The corn MYB3R Genes negatively regulate stomatal density and aperture in maize leaves.

5. The application according to claim 4, characterized in that, The corn in question is the corn inbred line KN5585.

6. A method for obtaining new maize germplasm, characterized in that, Using CRISPR-Cas9 gene editing technology, the maize as described in any one of claims 1-5 was subjected to... MYB3R Gene editing to suppress the corn MYB3R Gene expression, construction and acquisition MYB3R-CRISPR-Cas9 Gene editing vectors are used to perform genetic transformation on maize. The resulting positive seedlings are the new maize germplasm. The leaf stomatal density and aperture of the new maize germplasm are higher than those of wild-type maize. The corn as described in any one of claims 1-5 MYB3R The gene is introduced into the maize genome as the target gene and overexpressed. The resulting positive seedlings are the new maize germplasm. The leaf stomatal density and aperture of the new maize germplasm are lower than those of wild-type maize.

7. The method for obtaining new maize germplasm according to claim 6 ， Its characteristic is that, in CRISPR-Cas9 gene editing technology, maize... MYB3R Two sgRNA target sites were designed using the gene's nucleotide sequence as a template to construct... MYB3R- CRISPR-Cas9 The gene editing vector, wherein the sgRNA target sequence is shown in SEQ ID NO.3 and SEQ ID NO.4; Target 1 sequence: SEQ ID NO.3: GGAATGATAAGCTCTTCCAG; Target 2 sequence: SEQ ID NO.4: GGTAATGAGTTGAAGACGGG.

Images