Rape BnaA03.KNAT1 gene and application thereof in rape breeding

Abstract

The invention discloses an oilseed rape BnaA03.KNAT1 gene and application thereof in oilseed rape breeding, and belongs to the technical field of plant genetic engineering. Aiming at the problems of low population light energy utilization efficiency and difficulty in adapting to close planting caused by neglect of leaf included angle character in existing rape breeding, the CDS sequence of the identified BnaA03.KNAT1 gene is shown as SEQ ID NO: 1, an overexpression vector of the gene is constructed, and a transgenic plant is obtained by agrobacterium-mediated transformation of rape. Verification shows that after the gene is expressed, the included angle between leaves and a main stem of the transgenic rape can be remarkably reduced, the plant type is compact, the canopy light transmission is improved, the phenotype is stably inherited in multiple generations, a new gene resource and a technical means are provided for ideal plant type breeding of the rape, and the cultivation of a new high-yield rape variety is assisted; the method has important application value for cultivating high-yield rape varieties suitable for high-density planting.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a rapeseed BnaA03.KNAT1 gene and its application in rapeseed breeding. Background Technology

[0002] Leaves, as the core organs for photosynthesis and plant architecture in plants, directly determine the light energy utilization efficiency of the crop canopy and the yield potential of the entire crop population through their morphological characteristics, especially the leaf angle. They are key factors influencing crop biomass and economic yield (Li Fangyi, Huang Huang, Guan Mei, et al. Research progress on ideal plant architecture of rapeseed. Chinese Journal of Oil Crops, 2023). In-depth research into the molecular mechanisms of leaf morphogenesis is not only of significant theoretical importance for understanding plant organ development and environmental adaptation, but also lays a scientific foundation for precisely improving crop plant architecture and enhancing photosynthetic efficiency through molecular design breeding.

[0003] Currently, rapeseed breeding practices exhibit a clear tendency to prioritize reproductive growth over vegetative growth. Breeding goals are primarily focused on maturity traits such as plant height, number of branches, and number of siliques, while insufficient attention is paid to key morphological aspects during the vegetative growth stage, such as leaf angle and leaf shape. This has resulted in slow progress in canopy structure optimization through germplasm innovation. Existing mainstream rapeseed varieties generally exhibit characteristics such as flat leaves, excessively large leaf area, and wide leaf angles, leading to a dense canopy, poor light penetration, insufficient light exposure in the middle and lower leaves, low photosynthetic efficiency, and limited assimilate accumulation (Jie Kuai, Xiaoyong Li, Jianli Ji, Zhen Li, YanXie, Bo Wang, Guangsheng Zhou. Response of leaf carbon metabolism and drymatter accumulation to density and row spacing in two rapeseed plants). Brassica napus L. ) genotypes with differing plant architectures. CROP J (2022, 3:680-691). Meanwhile, poor ventilation inside the canopy creates a hot and humid microenvironment, which easily induces the occurrence and spread of diseases such as sclerotinia rot and downy mildew, further limiting the realization of yield potential.

[0004] Leaf angle is a key trait determining plant canopy structure, profoundly influencing canopy light distribution and microclimate. A smaller leaf angle allows leaves to stand upright, significantly enhancing ventilation and light penetration within the canopy, reducing mutual shading, and increasing light capture and utilization efficiency, especially improving photosynthetic status of middle and lower leaves (Jie Kuai, Xiaoyong Li, Jianli Ji, Zhen Li, Yan Xie, Bo Wang, Guangsheng Zhou. Response of leaf carbon metabolism and dry matter accumulation to density and row spacing in two rapeseed plants). Brassica napus L. ) genotypes with differing plantarchitectures. CROP J , 2022, 3:680-691). Meanwhile, upright leaf type can optimize the spatial layout of individual plants, providing possibilities for high-density planting and breakthroughs in group yield. In recent years, although studies have reported the functions of genes such as BnaIAA7 in regulating the leaf angle of rapeseed (Ping X, Ye Q, Yan M, Zeng J, Yan X, Li H, Li J, Liu L. Integrated genetic mapping and transcriptome analysis reveal the BnaA03.IAA7 protein regulates plant architecture and gibberellin signaling in...), Brassica napus L. Theor Appl Genet (2022, 135:3497-3510), but overall, the analysis of the genetic regulatory network for leaf angle, a key trait of vegetative growth, remains very weak, lacking systematic gene mining and functional verification work, especially lacking key gene resources and molecular markers that can be used for practical breeding to improve leaf uprightness. Therefore, in-depth exploration and effective utilization of key genes regulating leaf angle, and the creation of new rapeseed germplasm with compact plant type, upright leaf posture, and suitability for dense planting, are of great significance for achieving breakthroughs in rapeseed yield, efficient resource utilization, and green sustainable development.

[0005] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention

[0006] The purpose of this invention is to address the industrial problem that existing rapeseed breeding neglects the plant structure during the vegetative growth period, especially the leaf angle trait, resulting in low light energy utilization efficiency and difficulty in adapting to high-density planting. This invention provides a method for regulating rapeseed leaf angle and improving plant structure through genetic engineering technology.

[0007] To achieve the above objectives, the present invention provides a rapeseed BnaA03.KNAT1 gene, the CDS sequence of which is shown in SEQ ID NO: 1.

[0008] The present invention also provides an overexpression vector containing the above-mentioned BnaA03.KNAT1 gene.

[0009] Preferably, the vector backbone of the overexpression vector is selected from plasmid pCMBIA2306.

[0010] The present invention also provides an Agrobacterium containing the above-mentioned BnaA03.KNAT1 gene.

[0011] Preferably, the Agrobacterium is selected from GV3101.

[0012] The present invention also provides an amplification primer for identifying the above-mentioned BnaA03.KNAT1 gene, wherein the amplification primer is an upstream and downstream primer with nucleotide sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0013] The BnaA03.KNAT1 gene, overexpression vector, or Agrobacterium provided by this invention can all be applied to rapeseed breeding, especially to reduce the angle between rapeseed leaves and main stem, to prepare compact rapeseed plants, or to improve the light transmittance of rapeseed canopy.

[0014] This invention also provides a genetic transformation method for obtaining upright-leaved rapeseed. By transforming wild-type rapeseed with the above-mentioned overexpression vector, the positive plants obtained by screening are the new upright-leaved rapeseed lines.

[0015] The present invention has the following advantages: This invention discloses for the first time a rapeseed gene BnaA03.KNAT1. It has been verified that overexpression of the BnaA03.KNAT1 gene can significantly reduce the angle between rapeseed leaves and main stem, making the plant more compact and the canopy light transmittance better. Moreover, this phenotype is stably inherited in multiple generations.

[0016] Compared with existing technologies, this invention is the first to verify the key role of the BnaA03.KNAT1 gene in the morphogenesis of rapeseed leaves, providing new gene resources and effective technical means for breeding ideal rapeseed plant types. Attached Figure Description

[0017] Figure 1 This is a map of the overexpression vector plasmid constructed in this invention.

[0018] Figure 2 This is a phenotypic diagram of the leaf angle of the BnaA03.KNAT1 gene overexpression line constructed in this invention.

[0019] Figure 3 This is an overhead view of the BnaA03.KNAT1 gene overexpression line constructed in this invention.

[0020] Figure 4 The results are statistical analysis of the leaf angle of the BnaA03.KNAT1 gene overexpression line constructed in this invention. Detailed Implementation

[0021] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] Note: Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0023] Example 1: Identification of BnaA03.KNAT1 gene and construction of overexpression vector The BnaA03.KNAT1 gene was identified from the rapeseed multi-omics database BnIR (https: / / yanglab.hzau.edu.cn / BnIR), and its coding region (CDS) nucleotide sequence is shown in SEQ ID NO: 1.

[0024] BnaA03.KNAT1 gene CDS sequence (SEQ ID NO: 1):

[0025] Using BnaA03.KNAT1 as the target gene, a forward primer F1 was designed at the start codon of its CDS sequence, and a reverse primer R1 was designed at the end of the sequence after removing the stop codon. Subsequently, using the GibsonAssembly function in SNPgene software, the BamHI and SalI restriction sites in the overexpression vector pCMBIA2306 (carrying a 3 × FLAG tag) were selected as insertion sites, and amplification primers containing homologous arms were designed. The sequences of the homologous arm primers used for cloning ligation are shown in SEQ ID NO: 2 and SEQ ID NO: 3. During primer design, the fusion of the CDS sequence with the FLAG tag reading frame was verified to ensure correct expression of the fusion protein. The plasmid map of the constructed overexpression vector is shown below. Figure 1 As shown.

[0026] F1 (SEQ ID NO: 2): AGCTCGGTACCCGGGGATCCATGGAAGAATATCAACATGAA; R1 (SEQ ID NO: 3): GCGAATTGGTCGACTCTAGAGTATTTATATAGTGTATATTTTAAAAGACT.

[0027] Using cDNA from the rapeseed variety Westar as a template, the target fragment was amplified using primers with homologous arms. The PCR product was ligated into the pCMBIA2306 linearized vector, which had been double-digested with BamHI and SalI, via a TOPO isomerase-mediated ligation reaction. The ligation product was transformed into E. coli competent cells, and positive clones were selected for sequence verification. The verified plasmid was extracted and transformed into Agrobacterium GV3101 competent cells using a heat shock method, ultimately obtaining an Agrobacterium strain carrying the BnaA03.KNAT1 overexpression vector for subsequent genetic transformation experiments.

[0028] Example 2: Rapeseed genetic transformation Using the Brassica napus cultivar Westar as the recipient material, hypocotyls of its sterile seedlings were used as explants. The explants were infected with Agrobacterium tumefaciens overexpression vector, co-cultured, and then transferred to a kanamycin-containing selection medium for callus induction and shoot differentiation. Transgenic seedlings were then transplanted to a greenhouse. The specific steps are as follows:

[0029] 1. Explant preparation: Select mature and plump seeds, treat with 75% alcohol for 1 min, sterilize with 0.1% HgCl2 solution for 15 min, rinse with sterile water 5–6 times, sow on MO solid medium, and incubate in the dark at 24 ℃ for 5–7 days to obtain sterile seedlings.

[0030] 2. Preparation of Agrobacterium bacterial culture: The preserved strain was inoculated into LB liquid medium containing triple antibiotics (kanamycin, gentamicin, and rifampin) and cultured at 28°C with shaking at 180 r / min until OD. 600 The value is 0.8–1.0; collect the bacterial cells by centrifugation, and resuspend them in DM liquid medium containing 100 μmol / L AS (acetylsyringone) to the same OD value for later use.

[0031] 3. Explant infection and co-culture: Cut hypocotyls from sterile seedlings into 0.8–1.0 cm segments, immerse them in bacterial solution for 13–15 min with slight shaking during the process; remove them, blot dry the surface bacterial solution, spread them evenly on M1 medium, and co-culture in the dark at 24 ℃ for 36–48 h.

[0032] 4. Induction of resistant callus: After co-culture, the explants were transferred to M2 selection medium containing termethin and kanamycin and cultured at 24℃ with a photoperiod of 16 h / 8 h for 2–3 weeks to induce the formation of resistant callus.

[0033] 5. Bud differentiation and regeneration: Select well-grown callus tissues and transfer them to M3 differentiation medium. Culture them under the same photoperiodic conditions and subculture them every 10-15 days until green bud differentiation occurs.

[0034] 6. Rooting, transplanting and harvesting: Cut off well-grown young shoots and transfer them to M4 rooting medium, and culture them until the root system is well developed; after hardening off, transplant them to the greenhouse.

[0035] The formulations for each culture medium are as follows: M0: 2.2 g / L MS dry powder + 6 g / L agarose.

[0036] DM: 4.4 g / L MS dry powder + 30 g / L sucrose + 100 µm / L AS.

[0037] M1: 4.4 g / L MS dry powder + 30 g / L sucrose + 18 g / L mannitol + 1 mg / L 2,4-D + 0.3 mg / L KT + 100 µm / L AS + 6 g / L agarose.

[0038] M2: M1 medium + 30 mg / L STS + 300 mg / L TMT + 50 mg / L Kana.

[0039] M3: 4.4 g / L MS dry powder + 10 g / L glucose + 0.25 g / L xylose + 0.6 g / L MES + 2.0 mg / L ZT + 0.1 mg / L IAA + 200 mg / L TMT + 50 mg / L Kana.

[0040] M4: 4.4 g / L MS dry powder + 10 g / L sucrose + 6 g / L agarose + 100 mg / L TMT.

[0041] The pH of all the above culture media was adjusted to 5.8-5.9.

[0042] Example 3: Positive screening and purification of transgenic plants To accurately and efficiently identify transgenic positive plants containing the target gene, this embodiment designed PCR identification primers targeting specific regions of the overexpression vector. Specifically, a forward primer F2 was designed within the 3' terminal sequence region of the constitutive strong promoter 35S, and a reverse primer R2 was designed approximately 250 bp downstream within the CDS region of the BnaA03.KNAT1 gene. The sequences of this primer pair are shown in SEQ ID NO: 4 and SEQ ID NO: 5. This primer design specifically amplifies the exogenous insert fragment without amplifying the endogenous genomic sequence of rapeseed, thereby effectively distinguishing transgenic and wild-type plants.

[0043] F2 (SEQ ID NO: 4): CATTTGGAGAGAACACGGGG; R2 (SEQ ID NO: 5): GGAAGAAGAGAGCTCATATGTGGG.

[0044] Genomic DNA (gDNA) was extracted from T0 generation transgenic plants transplanted to a greenhouse. Using non-transgenic Westar wild-type plants as a negative control, PCR amplification was performed using the specific primers described above. After the reaction, the amplification products were analyzed by 1% agarose gel electrophoresis. Plants that consistently amplified specific bands of the expected size were identified as transgenic positive plants.

[0045] Individual plants identified as positive (T0 generation) were harvested and sown to obtain T1 generation lines. Leaves from T1 generation plants were collected at the seedling stage, gDNA was extracted, and the same PCR method was used for re-identification. The ratio of positive to negative segregation was calculated, and positive plants were selected for further propagation. Through continuous self-pollination and multiple generations (usually up to T2 generation) of genotyping and screening, genetically stable, homozygous transgenic positive lines of the target gene were finally obtained. These homozygous lines can be used for subsequent molecular detection, phenotypic observation, and functional analysis to comprehensively evaluate the regulatory effect of BnaA03.KNAT1 gene overexpression on rapeseed phenotype.

[0046] Example 4: Phenotypic Observation and Statistical Analysis A systematic phenotypic observation and comparison were conducted on wild-type Westar (WT-1, WT-2) and homozygous transgenic lines overexpressing BnaA03.KNAT1 (OE-1, OE-2). During the critical period of rapeseed vegetative growth (seedling stage to pre-bolting stage), the overexpression lines exhibited significant improved plant architecture characteristics: their leaf angles were significantly smaller than those of the wild type, and the leaves showed a more upright spatial distribution. The leaf angle phenotype of the BnaA03.KNAT1 gene overexpression lines is shown in [Figure 1]. Figure 2 As shown, the blades are upright.

[0047] From the overall plant morphology, the transgenic lines exhibited a more compact plant structure and a significantly reduced leaf opening. A top-down image of the BnaA03.KNAT1 gene overexpression line can be found here. Figure 3 It can be seen that the situation of individual plants directly shading each other in the group has been effectively improved.

[0048] To obtain reliable and quantifiable phenotypic data, 10 healthy plants with consistent growth were randomly selected from each line, and leaf angles were accurately measured using a standardized method. The measurement sites were uniformly selected as the 3rd to 6th fully expanded true leaves from top to bottom. A protractor was used to measure the angle between the petiole and the main stem. Each leaf was measured three times, and the average value was taken as the final measurement value for that leaf to minimize operational errors. GraphPad Prism 9.0 software was used for data processing and statistical analysis. A t-test was used to compare the differences in leaf angles between the wild type and each transgenic line. The statistical analysis results of leaf angles in the BnaA03.KNAT1 gene overexpression lines are shown below. Figure 4As shown in the results, the leaf angle of the BnaA03.KNAT1 overexpressing lines was significantly smaller than that of the wild type, and this phenotype remained stable across multiple generations from T2 to T3, demonstrating good genetic stability and phenotypic consistency. Further correlation analysis indicated a positive correlation between the reduction in leaf angle and the expression level of the BnaA03.KNAT1 gene. These results fully confirm that overexpression of the BnaA03.KNAT1 gene can significantly reduce the leaf angle of rapeseed, optimize the plant canopy structure, and improve the light energy utilization efficiency of the canopy, providing important genetic resources and theoretical basis for breeding high-yielding rapeseed varieties suitable for high-density planting.

[0049] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. Application of the rapeseed BnaA03.KNAT1 gene in rapeseed breeding, wherein, The CDS sequence of the BnaA03.KNAT1 gene is shown in SEQ ID NO:

1.

2. Application of an overexpression vector containing the BnaA03.KNAT1 gene in rapeseed breeding, wherein, The CDS sequence of the BnaA03.KNAT1 gene is shown in SEQ ID NO:

1.

3. The application according to claim 2, characterized in that, The vector backbone of the overexpression vector is selected from plasmid pCMBIA2306.

4. Application of Agrobacterium containing the BnaA03.KNAT1 gene in rapeseed breeding, wherein, The CDS sequence of the BnaA03.KNAT1 gene is shown in SEQ ID NO:

1.

5. The application according to claim 4, characterized in that, The Agrobacterium was selected from GV3101.

6. The application according to any one of claims 1-5, characterized in that, The application includes: Reduce the angle between the rapeseed leaves and the main stem; Preparation of compact plant type rapeseed; or Improve the light transmittance of the rapeseed canopy.

7. A genetic transformation method for obtaining rapeseed with upright leaves, characterized in that, Wild-type rapeseed was transformed using an overexpression vector containing the BnaA03.KNAT1 gene, and the positive plants obtained by screening were identified as upright-leaved rapeseed. The CDS sequence of the BnaA03.KNAT1 gene is shown in SEQ ID NO: 1.

Images