Application of Zm00001d022276 gene in regulation and control of corn plant height
By identifying and regulating the Zm00001d022276 gene, the problem of precision in regulating maize plant height was solved, achieving targeted reduction of plant height and stability of agronomic traits, thus promoting the development of maize breeding technology.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-04
- Publication Date
- 2026-03-13
AI Technical Summary
Existing technologies are insufficient for precise control of maize plant height, and mutations in existing plant height-related genes often lead to excessive dwarfing of plants or other unfavorable agronomic traits, limiting their application in breeding.
By identifying and verifying the Zm00001d022276 gene in the maize genome, it was found that it is specifically highly expressed in the stem tissue. Loss of function can significantly reduce plant height without affecting other agronomic traits. Methods such as sgRNA and recombinant vectors for inhibiting this gene were provided for regulating maize plant height.
This has enabled targeted improvement of maize plant height, cultivated superior varieties that are tolerant to dense planting and lodging, expanded the gene resources for regulating maize plant height, and promoted the development of maize breeding technology.
Smart Images

Figure CN121653162A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of maize plant height regulation technology, specifically to the application of the Zm00001d022276 gene in regulating maize plant height. Background Technology
[0002] Corn is my country's largest grain crop, and its yield is of great significance to ensuring national food security. With the trend towards intensive and mechanized corn production, increasing planting density has become an important way to increase yield per unit area. Plant height is a key trait affecting corn's tolerance to high planting density, lodging resistance, and overall light energy utilization efficiency. Therefore, developing new corn varieties with moderate plant height suitable for high-density planting is an important goal of current breeding work.
[0003] Currently, the genetic regulatory mechanisms of maize plant height are not fully understood. Although some genes related to plant height have been reported, most of these genes are involved in hormone metabolism or signal transduction pathways, and mutations in them often lead to excessive dwarfing or other unfavorable agronomic traits, limiting their direct application in breeding practices. Furthermore, existing research largely focuses on known pathways, with insufficient attention paid to plant height-related genes exhibiting tissue-specific or developmental stage-specific expression patterns, making precise regulation of plant height difficult.
[0004] Therefore, the discovery and identification of new plant height regulating genes, especially gene resources with spatiotemporal expression specificity that can reduce plant height while maintaining the stability of other agronomic traits, is of urgent theoretical and practical importance for maize plant architecture improvement and the breeding of dense-planting tolerant varieties. Summary of the Invention
[0005] In light of this, based on existing research, this application successfully identified a novel plant height-related gene, Zm00001d022276, through systematic screening and functional verification of potential regulatory sites in the maize genome. Further functional studies showed that this gene is specifically highly expressed in maize stalk tissues, and its expression level is significantly correlated with plant height. By constructing mutant materials of this gene, it was found that loss of function leads to a significant reduction in maize plant height, while other important agronomic traits are not significantly affected. This indicates that Zm00001d022276 plays a crucial role in the regulation of maize plant height and has the potential for application in maize plant architecture improvement.
[0006] To achieve the above objectives, this application provides the following technical solution:
[0007] Firstly, this application provides the application of any one of the following substances (1) to (3) in regulating the growth rate of maize plants:
[0008] (1) Protein Zm00001d022276;
[0009] (2) The DNA molecule encoding protein Zm00001d022276;
[0010] (3) Recombinant vectors, expression cassettes, transgenic cells or recombinant bacteria containing DNA molecules encoding protein Zm00001d022276;
[0011] The protein Zm00001d022276 is either (a) or (b) below;
[0012] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1;
[0013] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:1.
[0014] In some embodiments, the DNA molecule encoding protein Zm00001d022276 is any one of the following (1) to (3):
[0015] (1) A DNA molecule with a sequence as shown in the Zm00001d022276 gene; the Zm00001d022276 gene corresponds to the negative strand position chr7:177736541-177758523 on chromosome 7 in the NAM 5.0 version of the maize B73 reference genome;
[0016] (2) A DNA molecule that hybridizes with the DNA sequence defined in (1) and encodes a protein with the same function;
[0017] (3) DNA molecules that have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the DNA molecule sequence defined in (1) and encode a protein having the same function.
[0018] Secondly, this application provides the application of a substance that inhibits the activity of Zm00001d022276 protein or a substance that inhibits the expression of the gene encoding Zm00001d022276 protein in any one of the following (1) to (3);
[0019] (1) Reduce corn plant height;
[0020] (2) Cultivating low-plant-height maize;
[0021] (3) Cultivating low-stalk corn;
[0022] The protein Zm00001d022276 is either (a) or (b) as follows:
[0023] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1;
[0024] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:1.
[0025] In some embodiments, the substance that inhibits the activity of the Zm00001d022276 protein or the substance that inhibits the expression of the gene encoding the Zm00001d022276 protein is as follows (a) or (b):
[0026] (a) sgRNA used to knock out gene Zm00001d022276;
[0027] (b) A vector or recombinant bacterium or recombinant virus expressing the sgRNA described in (a).
[0028] Secondly, this application provides the application of inhibiting the activity of Zm00001d022276 protein or inhibiting the expression of the Zm00001d022276 protein encoding gene in any one of the following (1) to (3);
[0029] (1) Reduce corn plant height;
[0030] (2) Cultivating low-plant-height maize;
[0031] (3) Cultivating low-stalk corn;
[0032] The protein Zm00001d022276 is either (a) or (b) as follows:
[0033] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1;
[0034] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:1.
[0035] Fourthly, this application provides a method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the expression level and / or activity of the DNA molecule encoding protein Zm00001d022276 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize.
[0036] Fifthly, this application provides a method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the content and / or activity of protein Zm00001d022276 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize;
[0037] The protein Zm00001d022276 is either (a) or (b) as follows:
[0038] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1;
[0039] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:1.
[0040] The above-mentioned methods for cultivating transgenic maize with reduced plant height include: reducing the expression level of the Zm00001d022276 protein in the maize through gene editing, mutagenesis, hybridization, backcrossing, self-pollination or asexual reproduction, so as to reduce the plant height of the maize.
[0041] Compared with the prior art, this application has at least the following advantages:
[0042] 1. This application elucidates for the first time the crucial role of the Zm00001d022276 gene in the regulation of maize plant height. Loss of function of this gene significantly reduces maize plant height, providing new evidence for elucidating the molecular mechanisms underlying plant height formation.
[0043] 2. This application provides new genetic resources and breeding targets for maize plant architecture improvement. The discovery of this gene expands the research scope of maize plant height-related genes and has potential application value for breeding superior varieties that are tolerant of dense planting and resistant to lodging.
[0044] 3. This application contributes to the development of precision breeding and plant type improvement technologies for maize. By regulating the expression or function of this gene, targeted improvement of plant height can be achieved, providing a new technical approach for the breeding of high-yielding maize varieties suitable for mechanized harvesting. Attached Figure Description
[0045] Figure 1 The diagram shows the structure and mutation of the Zm00001d022276 gene provided in the embodiments of this application.
[0046] Figure 2 This application provides a phenotypic comparison between wild-type and mutant maize, where Mu is the mutant and WT is the wild-type.
[0047] Figure 3Phenotypic comparison of materials with the Zm00001d022276 gene from Hainan in the winter of 2024 provided in this application embodiment in the field. The wild type is on the left in the foreground of the photo, and the mutant is on the right.
[0048] Figure 4 Statistical comparison of plant height phenotype of the Zm00001d022276 gene provided in the embodiments of this application in Jilin in the spring of 2024 and Hainan in the winter of 2024. Detailed Implementation
[0049] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.
[0050] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.
[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains. Before a detailed description of this application, the following definitions are provided to better understand it.
[0052] In this application, unless the context clearly indicates otherwise, the terms “including,” “comprising,” “containing,” “having,” etc., shall be understood as open-ended and mean “including but not limited to.”
[0053] To better understand this teaching and without limiting its scope, all figures and other numerical values used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values that may vary depending on the desired properties sought. At a minimum, each numerical parameter should be interpreted based at least on the reported significant figures and by applying common rounding techniques.
[0054] Example 1: Discovery of the Zm00001d022276 gene
[0055] To efficiently screen key genes closely related to maize plant height regulation, this embodiment employs a comprehensive method integrating known functional information and computational biology predictions. The specific steps are as follows:
[0056] 1. Construction of a dataset of functional genes related to maize plant height
[0057] The system collected and organized published maize plant height-related functional genes and included their paralogous genes to construct a basic dataset. Based on the main biological pathways involved, the dataset was divided into four subcategories: hormone pathway-related genes, meristem pathway-related genes, microtubule pathway-related genes, and a comprehensive pathway set integrating the first three pathways. Ultimately, a total of 98 maize plant height-related functional genes were obtained (as shown in Table 1 below), forming a feature dataset for subsequent machine learning model training.
[0058] Table 1 lists 98 plant height-related functional genes.
[0059]
[0060] 2. Machine Learning Model Construction and Evaluation
[0061] Five classic machine learning models were used for training, with the area under the curve (AUC) and F1 score used as performance evaluation metrics. During training, the dataset was randomly divided into a training set (80%) and a test set (20%), and this random division process was repeated 20 times. The AUC and F1 score of the model obtained in each division were calculated, and the model performance was finally quantitatively evaluated in the form of mean ± standard deviation.
[0062] Performance varies across different training sets across various models: In Bagging, Logistic Regression (LR), NeuralNet, and XgBoost models, the All-pathway training set performs best, followed by the Hormone-based set; while in Support Vector Machine (SVM) models, the Meristem-based training set performs relatively well, but its F1 score remains low. Further detailed quantitative comparisons of the performance of Bagging, LR, NeuralNet, and XgBoost models on different training sets are provided.
[0063] (1) Training set of comprehensive approach set (All classes):
[0064] Bagging model: AUC=0.845±0.014, F1=0.839±0.013;
[0065] LR model: AUC=0.793±0.019, F1=0.744±0.019;
[0066] NeuralNet model: AUC=0.875±0.017, F1=0.859±0.013;
[0067] XgBoost model: AUC=0.834±0.014, F1=0.818±0.015. Overall comparison shows that the All training set performs best in the NeuralNet model.
[0068] (2) Hormone pathway (hormone class) training set:
[0069] Bagging model: AUC=0.824±0.015, F1=0.798±0.021;
[0070] LR model: AUC=0.769±0.019, F1=0.706±0.022;
[0071] NeuralNet model: AUC=0.836±0.015, F1=0.824±0.013;
[0072] XgBoost model: AUC=0.778±0.020, F1=0.780±0.021; The comparison shows that the Hormone-class training set performs best in the NeuralNet model, with an AUC of 0.836±0.015 and an F1 score of...
[0073] It is 0.824±0.013.
[0074] Based on the above evaluation results, the combination of the comprehensive pathway set (All classes) training set and the neural network (NeuralNet) model was finally selected as the method for subsequent gene prediction.
[0075] 3. Screening of key candidate genes
[0076] The optimized NeuralNet model was used to predict and score maize genomes, and biological network association analysis was performed on the high-scoring genes based on first-generation maize proteomic data. Among them, gene Zm00001d022276 achieved a prediction score as high as 0.999924183 (scoring range 0-1) in the model, indicating a very strong predictive association with plant height phenotype.
[0077] Further analysis revealed that Zm00001d022276 is closely associated with several validated plant height functional genes (such as fea2, arftf34, ZmTLP9, ub2, *ZmNF-YC13*, etc.) in the protein-protein interaction network. Based on its extremely high prediction score and significant network correlation, this embodiment identifies it as a key candidate gene regulating maize plant height and will conduct subsequent functional verification.
[0078] Example 2: Screening, molecular identification, and mutation effect analysis of the EMS mutant of the Zm00001d022276 gene.
[0079] This embodiment describes in detail the entire process of accurately screening target mutants from public mutant resources and using molecular biology techniques to clarify the nature of their genetic variations.
[0080] 1. Source of mutants
[0081] The mutant materials used in this application embodiment are derived from the EMS mutant library of maize B73 inbred lines constructed and published by Professor Lu Xiaoduo's research group at Qilu Normal University. This mutant library uses the superior inbred line B73 with consistent genetic background as starting material. Through treatment with the chemical mutagen ethyl methanesulfonate (EMS), a population rich in random single-base mutations (mainly G / C→A / T transitions) was created, serving as a standardized resource for reverse genetics research on gene function.
[0082] 2. Mutant Screening and Identification Strategies
[0083] To efficiently and accurately screen for loss-of-function mutants of the Zm00001d022276 gene from this library, the following molecular screening protocol was designed and executed:
[0084] (1) Primer design and synthesis
[0085] Based on the annotation information of the ZmPOK2 gene (Gene ID: Zm00001d022276) in the maize B73_RefGen_v4 reference genome, two pairs of specific primers were designed for PCR amplification to ensure the accuracy of the identification results. The specific primer pairs include:
[0086] Pre-primer for detection primer 1: TCATGCGGACCAAACCTCTG (SEQ ID NO:2);
[0087] Detection primer 1 followed by primer: ATTGTGCCAAACCTTGCAGT (SEQ ID NO:3);
[0088] Pre-primer for detection primer 2: TGTGCAAGAATCTCAGCTTGC (SEQ ID NO:4);
[0089] The primer following primer 2 is: GCCAAACCTTGCAGTCAAAG (SEQ ID NO:5).
[0090] (2) Genomic DNA extraction:
[0091] High-quality genomic DNA was extracted from young leaves of candidate plants from the EMS mutant library and wild-type B73 control using a modified CTAB method. The concentration and purity (A260 / A280 = 1.8-2.0) were determined by agarose gel electrophoresis and Nanodrop spectrophotometry, and the DNA was uniformly diluted to 50 ng / μL for later use.
[0092] (3) PCR amplification and sequencing screening:
[0093] The PCR reaction system (50 μL) is shown in Table 2 below:
[0094] Table 2 PCR reaction system
[0095]
[0096] The PCR reaction procedure is shown in Table 3 below:
[0097] Table 3
[0098]
[0099] (4) Product detection and purification:
[0100] After the PCR products were verified by 1.2% agarose gel electrophoresis, the target band was purified by gel excision.
[0101] (5) Sanger sequencing and sequence alignment
[0102] Use SnapGene or BioEdit software to align the sequencing peaks with the B73 reference sequence.
[0103] 3. Mutation site identification and functional prediction
[0104] Through the sequencing and comparative analysis described above, a single strain carrying a homozygous pathogenic mutation was successfully identified. Key information is as follows:
[0105] (1) Genomic coordinates: The mutation is located at 174,242,530 bp on chromosome 7 (Chr7) of maize (B73_RefGen_v4).
[0106] (2) Mutation type: STOP_GAINED (stop codon acquisition).
[0107] (3) Molecular changes: The wild type (B73) has the codon CAG (encoding glutamine, Gln) at this site, while the mutant sequence is TAG (stop codon), which means that a C→T base substitution has occurred.
[0108] (4) Biological consequences: This mutation causes premature termination of the translation of the ZmPOK2 protein at the mutation site, resulting in a C-terminal truncated, non-functional abnormal protein (see appendix). Figure 1 This shows the location of the mutation in the gene structure.
[0109] 4. Genotypic stability and verification of mutant offspring
[0110] The Zm00001d022276 mutant was self-crossed to obtain M3 generation seeds. PCR amplification was performed on the M3 population. Because this mutation introduces an altered restriction enzyme site that could be used to develop dCAPS markers, the genotype of the M3 plants could be rapidly identified by restriction endonuclease digestion analysis or direct sequencing. Genetically stable homozygous mutant lines were then screened for subsequent phenotypic analysis.
[0111] Example 3: Multi-environment field phenotypic identification of the Zm00001d022276 mutant.
[0112] This embodiment aims to rigorously evaluate the physiological effects of loss of function of the Zm00001d022276 gene on maize, especially the plant height trait.
[0113] 1. Multi-environment field trial design
[0114] (1) Test site and season:
[0115] Location 1: Hainan, winter growing season (24 winters in Hainan)
[0116] Location 2: Jilin, spring growing season (24 springs in Jilin)
[0117] (2) Experimental materials: Zm00001d022276 homozygous mutant and its wild-type parent B73, which were verified in Example 2.
[0118] (3) Experimental design: A randomized block design with 3 replicates was adopted. Each plot was planted in double rows with a row spacing of 60 cm and a plant spacing of 25 cm. Water and fertilizer management and pest and disease control were carried out uniformly throughout the growth period.
[0119] 2. Systematic investigation of phenotypic traits
[0120] The following measurements were taken during the critical periods of vegetative and reproductive growth:
[0121] Main trait (plant height): One week after silking, measure the vertical height (cm) from the ground to the tip of the tassel on each plant. Measure at least 15 representative plants from each plot.
[0122] Analysis of traits (internodes): After maturity, five standard plants were taken, and the length of each internode was measured and recorded.
[0123] Relevant agronomic traits: record the tasseling period, pollen shedding period, silking period, ear height, ear length, ear diameter, and length of barren tips.
[0124] 3. Data Analysis and Conclusions
[0125] Significant dwarfing effect: In all three test environments, the Zm00001d022276 gene mutant exhibited a visually visibly consistent dwarfing phenotype (see appendix). Figure 2 , attached Figure 3 ).
[0126] Plant height data statistics: Statistical analysis was performed on the plant height data (using one-way ANOVA and Duncan's multiple comparisons, significance level α=0.01). The results are summarized below (see appendix). Figure 4 ):
[0127] 24 Spring Jilin: The average plant height of the mutant was 248.5±5.6 cm, which was significantly reduced by 19.8 cm compared with the wild type (268.3±6.8 cm).
[0128] 24 Winter Hainan: The average plant height of the mutant was 135.6±3.2 cm, which was significantly reduced by 22.5 cm compared with the wild type (158.1±4.1 cm).
[0129] Key findings: Loss of function of the Zm00001d022276 gene resulted in a stable reduction of maize plant height by approximately 20–23 cm under different ecological conditions, with a significant and reproducible reduction.
[0130] 4. Phenotypic mechanism and specificity analysis:
[0131] (1) Causes of dwarfing: Internode analysis showed that the plant height reduction was due to the uniform shortening of all internodes rather than the reduction in the number of nodes, suggesting that the Zm00001d022276 gene mainly regulates the longitudinal elongation of cells.
[0132] (2) Trait specificity: Most importantly, the Zm00001d022276 gene mutant showed no statistically significant differences in tasseling and pollen shedding period and major yield traits of the ear (ear length, number of ear rows) compared to the wild type. This indicates that the reduction in plant height achieved by regulating the Zm00001d022276 gene was not accompanied by significant growth and development delays or loss of yield components, solving the technical problem of "loss of all due to dwarfing" in many existing dwarfing gene applications, highlighting its unique application value in maize high-density lodging-resistant breeding.
[0133] Based on the above-mentioned regulatory mechanism of the Zm00001d022276 gene on maize plant height, this application also found the following applications, which are reflected in:
[0134] This application provides the application of a substance that inhibits the activity of Zm00001d022276 protein or a substance that inhibits the expression of the gene encoding Zm00001d022276 protein in any one of the following (1) to (3);
[0135] (1) Reduce corn plant height;
[0136] (2) Cultivating low-plant-height maize;
[0137] (3) Cultivating low-stalk corn;
[0138] The protein Zm00001d022276 is either (a) or (b) as follows:
[0139] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1;
[0140] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:1.
[0141] In some embodiments, the substance that inhibits the activity of the Zm00001d022276 protein or the substance that inhibits the expression of the gene encoding the Zm00001d022276 protein is as follows (a) or (b):
[0142] (a) sgRNA used to knock out gene Zm00001d022276;
[0143] (b) A vector or recombinant bacterium or recombinant virus expressing the sgRNA described in (a).
[0144] This application provides an application of inhibiting the activity of Zm00001d022276 protein or inhibiting the expression of the Zm00001d022276 protein encoding gene in any one of the following (1) to (3);
[0145] (1) Reduce corn plant height;
[0146] (2) Cultivating low-plant-height maize;
[0147] (3) Cultivating low-stalk corn;
[0148] The protein Zm00001d022276 is either (a) or (b) as follows:
[0149] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1;
[0150] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:1.
[0151] This application provides a method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the expression level and / or activity of the DNA molecule encoding protein Zm00001d022276 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize.
[0152] This application provides a method for cultivating transgenic maize with reduced plant height, comprising the following steps: reducing the content and / or activity of protein Zm00001d022481 in the starting maize to obtain transgenic maize, wherein the plant height of the transgenic maize is lower than that of the starting maize;
[0153] The protein Zm00001d022276 is either (a) or (b) as follows:
[0154] (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1;
[0155] (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:1.
[0156] In some embodiments, methods for cultivating transgenic maize with reduced plant height include reducing the expression level of the Zm00001d022276 protein in the maize by means of gene editing, mutagenesis, hybridization, backcrossing, self-pollination or asexual reproduction, so as to reduce the plant height of the maize.
[0157] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.
Claims
1. The application of any one of the following substances (1) to (3) in regulating the growth rate of maize plants: (1) Protein Zm00001d022276; (2) The DNA molecule encoding protein Zm00001d022276; (3) Recombinant vectors, expression cassettes, transgenic cells or recombinant bacteria containing DNA molecules encoding protein Zm00001d022276; The protein Zm00001d022276 is either (a) or (b) below; (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1; (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:
1.
2. The application according to claim 1, wherein the DNA molecule encoding protein Zm00001d022276 is any one of the following (1) to (3): (1) A DNA molecule with a sequence as shown in the Zm00001d022276 gene; the Zm00001d022276 gene corresponds to the negative strand position chr7:177736541-177758523 on chromosome 7 in the NAM 5.0 version of the maize B73 reference genome; (2) A DNA molecule that hybridizes with the DNA sequence defined in (1) and encodes a protein with the same function; (3) DNA molecules that have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the DNA molecule sequence defined in (1) and encode a protein having the same function.
3. The application of any one of the following (1) to (3) of the substance that inhibits the activity of Zm00001d022276 protein or the substance that inhibits the expression of the gene encoding Zm00001d022276 protein; (1) Reduce corn plant height; (2) Cultivating low-plant-height maize; (3) Cultivating low-stalk corn; in, The protein Zm00001d022276 is either (a) or (b) as follows: (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1; (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:
1.
4. In the application according to claim 3, the substance that inhibits the activity of Zm00001d022276 protein or the substance that inhibits the expression of the gene encoding Zm00001d022276 protein is as follows (a) or (b): (a) sgRNA used to knock out gene Zm00001d022276; (b) A vector or recombinant bacterium or recombinant virus expressing the sgRNA described in (a).
5. Inhibit the activity of Zm00001d022276 protein or inhibit the expression of the gene encoding Zm00001d022276 protein in any of the following (1) to (3); (1) Reduce corn plant height; (2) Cultivating low-plant-height maize; (3) Cultivating low-stalk corn; in, The protein Zm00001d022276 is either (a) or (b) as follows: (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:1; (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID NO:
1.
6. A method for cultivating transgenic maize with reduced plant height, comprising the following steps: By reducing the expression level and / or activity of the DNA molecule encoding protein Zm00001d022276 in the starting maize, transgenic maize is obtained, wherein the plant height of the transgenic maize is lower than that of the starting maize.
7. A method for cultivating transgenic maize with reduced plant height, comprising the following steps: The content and / or activity of protein Zm00001d022481 in the starting corn were reduced to obtain transgenic corn, wherein the plant height of the transgenic corn was lower than that of the starting corn. The protein Zm00001d022276 is either (a) or (b) as follows: (a) A protein consisting of an amino acid sequence as shown in SEQ ID NO:2; (b) A protein derived from (a) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:
2.
8. The method of claim 7, comprising: The expression level of the Zm00001d022276 protein in maize was reduced by means of gene editing, mutagenesis, hybridization, backcrossing, self-pollination or asexual reproduction, so as to reduce the plant height of maize.