SNP (Single Nucleotide Polymorphism) molecular marker for identifying or assisting in identifying goat foot length and application of SNP molecular marker
By designing SNP molecular markers at specific SNP sites in the coding region of the goat ARMC8 gene, and combining them with PCR amplification and enzyme digestion techniques, the problem of identifying goat leg length was solved, thus achieving rapid breeding progress and improved farming efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-04
- Publication Date
- 2026-03-13
AI Technical Summary
Existing technologies lack effective molecular markers for identifying or assisting in the identification of goat leg length traits, resulting in low breeding efficiency and making it difficult to rapidly improve the breeding progress of goat breeds.
A SNP molecular marker is provided, which is a T/C polymorphic site located at a specific position in the coding region of the ARMC8 gene and its upstream and downstream sequences. Combined with amplification primers and restriction endonuclease HhaI, the genotype of goat leg length can be determined by PCR amplification and enzyme digestion.
It enables rapid and accurate identification of goat leg length, optimizes breeding progress, improves breeding efficiency, and in particular, can distinguish between tall and short goats to meet different breeding needs.
Smart Images

Figure CN121653267A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker breeding technology for goats, and in particular to an SNP molecular marker for identifying or assisting in the identification of goat leg length and its application. Background Technology
[0002] Among goat herds, there are tall-legged and short-legged groups. Tall-legged goats are larger, better at walking and jumping, and produce more single lambs. They prefer to eat shrub branches and leaves, making them suitable for grazing. Short-legged goats are smaller, produce more twins, and are better suited for stall feeding. Therefore, short-legged goats have an advantage over tall-legged goats. They are suitable for stall feeding, and with increased selective breeding, the twin lamb rate tends to increase, with a twin lamb survival rate exceeding 90%. They are highly popular with breeders and farmers, who consciously choose short-legged Leizhou goats to meet production needs. Therefore, exploring the genetic basis of goat leg length (leg length = body height - chest depth) is of great significance for optimizing goat breeding and improving farming efficiency.
[0003] Marker-assisted selection (MAG) is a breeding technique that allows for direct selection of the genotype of leg length at the molecular level. This overcomes the drawbacks of conventional breeding, such as long breeding time and poor results, and can rapidly improve breeding efficiency. Therefore, MAG screening can enable early selection of leg length traits, thereby shortening generation intervals and accelerating the breeding process. It is evident that using MAG to identify genes and SNP loci related to leg length in goats and applying them to molecular breeding techniques is of great significance for goat breed selection. However, currently, there is a lack of genes and SNP loci related to leg length in goats. Summary of the Invention
[0004] To address the aforementioned problems, this invention provides a SNP molecular marker for identifying or assisting in the identification of goat leg length and its application. The SNP molecular marker provided by this invention is a molecular marker related to the leg height trait of goats, and can be used to identify or assist in the identification of goat leg length, which is of great significance for goat breed selection.
[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a SNP molecular marker for identifying or assisting in the identification of goat leg length. The SNP molecular marker is a nucleic acid molecule containing an SNP site and its upstream and downstream sequences. The SNP site is located at accession number XM_018049953.1. ARMC8 A T / C polymorphism exists at position 1188 bp in the gene coding region; or it is located at accession numbers XM_018049962.1 or XM_018049961.1. ARMC8A T / C polymorphism exists at position 1113 bp in the gene coding region; or it is located in accession numbers XM_018049950.1, XM_018049960.1, XM_018049959.1, or XM_018049955.1. ARMC8 A T / C polymorphism exists at position 1314 bp in the gene coding region; or it is located at accession number XM_018049963.1. ARMC8 A T / C polymorphism exists at position 855 bp in the gene coding region; or at accession number ENSCHIG00000001594. ARMC8 A T / C polymorphism exists at position 1381 bp in the gene coding region.
[0006] Preferably, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where Y is C or T.
[0007] This invention provides a kit for detecting the SNP molecular markers described in the above-mentioned technical solutions, comprising: amplification primers and restriction endonucleases. Hha I; The amplification primers consist of the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3.
[0008] Preferably, the kit further includes reagents and restriction endonucleases used for PCR amplification. Hha The reagents used for I enzyme digestion.
[0009] This invention provides the application of the SNP molecular markers or the kits described in the above technical solutions in the identification or auxiliary identification of goat leg length.
[0010] Preferably, the goat is a Leizhou goat.
[0011] This invention provides the application of the SNP molecular markers or the kits described in the above technical solutions in goat breeding, wherein the breeding includes the selection of tall goats or the selection of short goats.
[0012] Preferably, the goat is a Leizhou goat.
[0013] This invention provides a method for identifying or assisting in the identification of goat leg length, comprising the following steps: Using the genomic DNA of the goat to be tested as a template, PCR amplification was performed using the amplification primers in the kit described above to obtain the amplification product; Using restriction endonucleases HhaI. The amplification product is subjected to enzyme digestion, and the genotype of the amplification product is determined according to the size of the enzyme digestion product; the genotype of the amplification product is the genotype of the SNP molecular marker of any one of claims 1 to 3 in the amplification product. If the enzyme digestion products are 659bp, 456bp, and 203bp in size, then the genotype of the amplified product is TC. If the enzyme digestion product is only 659 bp in size, then the genotype of the amplified product is TT; If the enzyme digestion products are 456bp and 203bp in size, then the genotype of the amplified product is CC. The leg length of the goat to be tested is determined based on the genotype of the amplified product; the longer the leg length, the taller the body size. The test goats with genotype CC had longer legs than those with genotypes TC or TT, and the test goats with genotype TC had longer legs than those with genotype TT.
[0014] Preferably, the goat is a Leizhou goat.
[0015] Beneficial effects: This invention uses Leizhou goats as experimental materials to study... ARMC8 Gene sequencing analysis revealed that the gene was located at accession number XM_018049953.1. ARMC8 A T→C mutation exists at the 1188th base of the gene coding region. This is a synonymous mutation. The genotype at this site is related to the leg length trait of goats (goats with the genotype CC have longer legs than goats with the genotypes TC or TT, and goats with the genotype TC have longer legs than goats with the genotype TT). This mutation can be used to identify or assist in the identification of goat leg length, which is of great significance for goat breed selection.
[0016] Furthermore, the present invention designs detection primers based on the aforementioned SNP molecular markers, and the specific amplification products contain... Hha I restriction site, thus can be used Hha Enzyme digestion with endonuclease is used for identification. The genotype of the SNP molecular marker is determined based on the size of the digestion product, thereby identifying or assisting in the identification of goat leg length. This method is not only highly specific but also simple and quick, which is of great significance for optimizing goat breeding and improving breeding efficiency. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0018] Picture 1 The results of gel electrophoresis analysis of Leizhou goat genomic DNA; Picture 2Gel electrophoresis image of PCR amplification products of the SNP molecular marker T1188C site; Picture 3 PCR-RFLP gel electrophoresis image of partial genotyping of the SNP molecular marker T1188C site; Picture 4 This is a sequence of sequencing results for the TC mutant heterozygous genotype in Leizhou goats. Picture 5 The image shows the sequencing results of the CC genotype of the Leizhou goat mutant homozygous. Picture 6 This image shows the sequencing results of the wild homozygous TT genotype of Leizhou goat. Detailed Implementation
[0019] This invention provides a SNP molecular marker for identifying or assisting in the identification of goat leg length. The SNP molecular marker is a nucleic acid molecule containing an SNP site and its upstream and downstream sequences. The SNP site is located at accession number XM_018049953.1. ARMC8 A T / C polymorphism exists at position 1188 bp in the gene coding region; or it is located at accession numbers XM_018049962.1 or XM_018049961.1. ARMC8 A T / C polymorphism exists at position 1113 bp in the gene coding region; or it is located in accession numbers XM_018049950.1, XM_018049960.1, XM_018049959.1, or XM_018049955.1. ARMC8 A T / C polymorphism exists at position 1314 bp in the gene coding region; or it is located at accession number XM_018049963.1. ARMC8 A T / C polymorphism exists at position 855 bp in the gene coding region; or at accession number ENSCHIG00000001594. ARMC8 A T / C polymorphism exists at position 1381 bp in the gene coding region.
[0020] The registration numbers XM_018049953.1, XM_018049962.1, XM_018049961.1, XM_018049950.1, XM_018049960.1, XM_018049959.1, XM_018049955.1, or XM_018049963.1 mentioned in this invention are all... ARMC8 The gene's accession number in the NCBI database is: ENSCHIG00000001594. ARMC8 The accession number of the gene in the Ensembl database.
[0021] As one implementation, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where Y is C or T, as follows: SEQ ID NO.1: 5'-GTGCCAGCAGTTATCTCCATGCAATGCCATGTAATCTTGGTTTACAAAATTGGGTCTTAATTTATTCTTTAGTAAATATAATTTGAAAACAGTCTATTACTTGTGTAATTATTTTCTATATTTACAATTTTAGACAGTTCAGATTGACTATAAGCTATAATATCTTTAAAAAAAACTGCATATGCCAGGCAGAGAAGGGATAACAGCGAATGACAACTATATTTT AAAATTAATTTAATGCCCCCCAACCCCCAACATCCAAACAATTCAGAAGTAGTGTTAAATCCCAAGCCTCAAATTTTAACGTCAACTACAGTGAAAATTATTTAACTAAGCTCTAGACTGGGCAGAAGTCATCTAGGAAGAGAAAATCAACACTAACCTCTTTGCTTGGAGAAAATTCAAGAAGGAGATTACACAGCATGGACGATGCTACTACTAGGATTTCATCTG GYGC ATTTTGTAAAACCTATGGAATTAAAAAAAAAGGATACTATTAACAGTTTGCAATCGTGCAGGTGAGATCATCAGAACAAATGAGAACAAAAACAATTTATCTTTTAATCTGATTTCTCATCTTGGAGAGAGGAAAGATCCACCTGACACTGAGTGAGACTTCACCTAGTGCTGTCATTATGACTGACTAAGGCCCTCAGG-3'.
[0022] This invention uses Leizhou goats as experimental materials to study... ARMC8 Gene sequencing analysis revealed that the gene was located at accession number XM_018049953.1. ARMC8 A T→C mutation exists at the 1188th base of the gene coding region. This is a synonymous mutation. The genotype at this site is related to the leg length trait of goats (goats with the genotype CC have longer legs than goats with the genotypes TC or TT, and goats with the genotype TC have longer legs than goats with the genotype TT). This mutation can be used to identify or assist in the identification of goat leg length, which is of great significance for goat breed selection.
[0023] Based on the above advantages, the present invention provides a kit for detecting the SNP molecular markers described in the above technical solution, comprising: amplification primers and restriction endonuclease. Hha I; The amplification primers consist of the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3.
[0024] In one embodiment, the kit also includes reagents and restriction endonucleases used for PCR amplification. Hha The reagents used for I enzyme digestion.
[0025] The amplification primers provided by this invention are specific amplification primers designed based on the SNP molecular marker, and the specific amplification products contain... Hha I restriction site, thus can be used Hha Enzyme digestion with I endonuclease is used for identification. The genotype of the SNP molecular marker is determined based on the size of the digestion product, thereby identifying or assisting in the identification of goat leg length.
[0026] Based on the above advantages, this invention provides the application of the SNP molecular markers or the kits described in the above technical solutions in the identification or auxiliary identification of goat leg length. As one embodiment, the goat is a Leizhou goat.
[0027] Based on the above advantages, this invention provides the application of the SNP molecular markers or the kits described in the above technical solutions in goat breeding, wherein the breeding includes the selection of tall-legged goats or the selection of short-legged goats. As one embodiment, the goat is the Leizhou goat.
[0028] Based on the above advantages, the present invention provides a method for identifying or assisting in the identification of goat leg length, comprising the following steps: Using the genomic DNA of the goat to be tested as a template, PCR amplification was performed using the amplification primers in the product described in the above technical solution to obtain the amplification product; Using restriction endonucleases Hha I. The amplification product is subjected to enzyme digestion, and the genotype of the amplification product is determined according to the size of the enzyme digestion product; the genotype of the amplification product is the genotype of the SNP molecular marker of any one of claims 1 to 3 in the amplification product. If the enzyme digestion products are 659bp, 456bp, and 203bp in size, then the genotype of the amplified product is TC. If the enzyme digestion product is only 659 bp in size, then the genotype of the amplified product is TT; If the enzyme digestion products are 456bp and 203bp in size, then the genotype of the amplified product is CC. The leg length of the goat to be tested is determined based on the genotype of the amplified product; the longer the leg length, the taller the body size. The test goats with genotype CC had longer legs than the test goats with genotypes TC or TT, and the test goats with genotype TC had longer legs than the test goats with genotype TT.
[0029] In one implementation, the goat is a Leizhou goat.
[0030] The method provided by this invention is highly specific, simple, and quick in determining the genotype of the amplified product based on the size of the enzyme digestion product. It is of great significance for optimizing goat breeding and improving farming efficiency.
[0031] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides an SNP molecular marker for identifying or assisting in the identification of goat leg length and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.
[0032] Example 1 Sample collection A total of 235 blood samples were collected from Guangdong Leading Sheep Agricultural Smart Agriculture Co., Ltd. 5 mL of blood was collected from the jugular vein, treated with EDTK2 anticoagulation, and stored at -20°C for later use. Ear number and body size data of each individual were also recorded.
[0033] Extraction and quality testing of blood genomic DNA Genomic DNA was extracted from blood using the Hipure Universal DNA Kit D3018 from Meiji Biotechnology. The concentration and purity of the extracted DNA fragments were measured using a nanodrop spectrophotometer. Buffer AE was used as a blank control to ensure that the concentration of the extracted DNA sample was not less than 30 ng / μL. OD 260 / OD 280 The values were between 1.8 and 2.0, and the quality of the extracted DNA was then determined by 1% agarose gel electrophoresis.
[0034] Genomic DNA samples from Leizhou goats were analyzed using a nucleic acid analyzer and found OD. 260 / OD 280 The values were all between 1.8 and 2.0, and the concentrations were all between 50 and 200 ng / μL. Further analysis by 1% agarose gel electrophoresis showed clear, dense, bright bands. Picture 1 This indicates that the extracted goat genomic DNA sample is of good quality, with purity and concentration meeting the experimental requirements, and can be used for subsequent experiments. Candidate gene primer synthesis Based on the candidate gene sequences published on Ensembl, primers were designed for the 1381 bp (accession number: ENSCHIG00000001594) coding region of the ARMC8 gene on goat chromosome 1. The primers were synthesized by Sangon Biotech Co., Ltd. The primer sequences are as follows: F: 5'-GTGCCAGCAGTATCTCCATGC-3' (SEQ ID NO. 2); R: 5'-CCTGAGGGGCCTTAGTCAGTCAT-3' (SEQ ID NO. 3).
[0035] PCR amplification The PCR amplification reaction system was as follows: 1 μL genomic DNA template, 0.4 μL each of upstream and downstream primers, 10 μL Taq DNA polymerase, and deionized double-distilled water to a final volume of 20 μL.
[0036] The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 10 s, 35 cycles; 72℃ extension for 5 min, and storage at 4℃.
[0037] After the reaction was completed, 5 μL of the reaction product was taken and its length and integrity were detected by 2% agarose gel electrophoresis.
[0038] RELP detection Using SnapGene software, the corresponding restriction endonucleases were identified for the screened SNP sites. A 130423480 bp SNP mutation site was found on goat chromosome NC_030808.1. Primer-induced restriction enzyme digestion analysis revealed that this specific fragment product contained… HhaI Restriction endonuclease polymorphic sites.
[0039] The enzyme digestion system was: 10×Buffer O 2μL. Hha 1 μL of IgA, 10 μL of genomic DNA, and 17 μL of ddH2O were mixed thoroughly by vortexing and then placed in a 37°C constant temperature water bath for enzyme digestion for 2 hours. After digestion, the sample was removed and subjected to 1% agarose gel electrophoresis. The genotypes presented in each lane were analyzed based on the gel imaging results.
[0040] Data Statistics and Analysis Data were statistically analyzed using the GLM (General Linear Model) program in SPSS 26.0 statistical analysis software with a constructed unit point effect model. Multiple comparisons between means were performed using the LSD and Dunnett's T3 methods to investigate the effect of genotype on the leg length of Leizhou goats. Results are presented as mean ± standard deviation (Mean ± SD). The linear model used for statistical analysis is as follows: yjkl=μ+G k +ejkl; Where: yjkl is the leg length of Leizhou goats; μ is the population average; G k represents the fixed effect of the k-th genotype; ejkl represents the random residual effect.
[0041] Results and Analysis 1. PCR amplification results of the mutant gene Specific primers (F and R) were designed based on the SNP mutation site at the 1188 bp coding region of the ARMC8 gene (Genome Accession Number: XM_018049953.1) on goat chromosome NC_030808.1. PCR amplification was performed using Leizhou goat genomic DNA as a template. After PCR electrophoresis, the target band was clear and bright, without any extraneous bands, and the size of the target fragment was consistent with the expected result, being 659 bp. Picture 2 ).
[0042] 2. PCR-RFLP analysis of the mutant gene DNA samples were extracted from 20 and 50 different individuals of Leizhou goats, respectively, and mixed in equal amounts to form two DNA pools. These pools were then used as templates for PCR amplification, and the PCR products were sequenced. The sequencing results were processed using DNAMAN software and compared with genome sequences on NCBI. A T→C mutation was found at 455 bp in the amplified sequence, which is a synonymous mutation and the SNP site. Enzyme digestion analysis was then used to identify the specific fragment containing... HhaI Restriction endonuclease polymorphic sites, amplified products via HhaI After restriction endonuclease digestion, the results, as detected by 1% agarose gel electrophoresis, showed three genotypes ( Picture 3 : Mutant heterozygous TC (659bp, 456bp and 203bp), wild homozygous TT (659bp) and mutant homozygous CC (456bp and 203bp).
[0043] Determination of Sequencing Results for Different Genotypes: Sequencing was performed at Sangon Biotech Co., Ltd. Bidirectional sequencing was conducted on gene fragments. PCR products from three different genotypes at the T1188C molecular marker site were sent for analysis. The results are as follows: Picture 4-Picture 6 As shown.
[0044] 3. Genetic parameter analysis of the T1188C locus Heterozygosity ( He ), genetic homozygosity ( Ho ), polymorphic information content ( PIC ) and effective number of alleles ( Ne Genetic parameters such as , , and are important parameters for evaluating population genetic variation, and different genetic parameters represent the essential genetic differences between populations. The genetic parameters of the T1188C locus are shown in Table 1. As shown in Table 1, the polymorphism information content is 0.37, ranging from 0.25 to 0.5, indicating moderate polymorphism. Both homozygosity and heterozygosity are between 0.5, indicating that these two alleles are relatively evenly distributed in the Leizhou goat population. The chi-square results show that the genotype distribution conforms to . Hardy-Weinberg The equilibrium state suggests that the T1188C locus may not be affected by current breeding measures (such as artificial selection pressure), and their genetic changes during the breeding process are random.
[0045] Table 1. Genetic parameter analysis of the T1188C locus.
[0046] 4. Association analysis between T1188C locus and leg length trait Association analysis between the T1188C variant and leg length of different genotypes of Leizhou goats was performed using SPSS 26.0 software. The T1188C variant was significantly associated with leg length in Leizhou goats. P <0.05), as shown in Table 2, the mean leg length of Leizhou goats with the TT genotype was 28.203 cm, the mean leg length of Leizhou goats with the TC genotype was 29.988 cm, and the mean leg length of Leizhou goats with the CC genotype was 31.808 cm. Regarding leg length, the CC type was 3.605 cm longer than the TT type, a significant difference (<0.05). P <0.05). The foot length of the CC type was 1.82 cm longer than that of the TC type, a significant difference. P <0.05), the foot length of the TC type was 1.785cm longer than that of the TT type, a significant difference. P <0.05). The results showed that the CC variant at the T1188C site of the ARMC8 gene was present in the tall-legged Leizhou goat population, while the TT variant was present in the short-legged Leizhou goat population. The effect of the T1188C site on goat leg length was mainly additive.
[0047] Table 2. Association analysis between T1188C locus and foot length in Leizhou.
[0048] Note: Different letters indicate significant differences. P <0.05).
[0049] In summary, the SNP molecular markers and their detection methods provided by this invention can quickly and accurately distinguish the leg length of Leizhou goats, which is of great significance for optimizing goat breeding and improving breeding efficiency.
[0050] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A SNP molecular marker for identifying or assisting in the identification of goat leg length, characterized in that, The SNP molecular marker is a nucleic acid molecule containing the SNP site and its upstream and downstream sequences, wherein the SNP site is located at accession number XM_018049953.
1. ARMC8 A T / C polymorphism exists at position 1188 bp in the gene coding region; or it is located at accession numbers XM_018049962.1 or XM_018049961.
1. ARMC8 A T / C polymorphism exists at position 1113 bp in the gene coding region; or it is located in accession numbers XM_018049950.1, XM_018049960.1, XM_018049959.1, or XM_018049955.
1. ARMC8 A T / C polymorphism exists at position 1314 bp in the gene coding region; or it is located at accession number XM_018049963.
1. ARMC8 A T / C polymorphism exists at position 855 bp in the gene coding region; or at accession number ENSCHIG00000001594. ARMC8 A T / C polymorphism exists at position 1381 bp in the gene coding region.
2. The SNP molecular marker according to claim 1, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where Y is C or T.
3. A kit for detecting the SNP molecular marker of claim 1 or 2, characterized in that, include: Amplification primers and restriction endonucleases Hha I; The amplification primers consist of the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.
3.
4. The reagent kit according to claim 3, characterized in that, The kit also includes reagents and restriction endonucleases used for PCR amplification. Hha The reagents used for I enzyme digestion.
5. The use of the SNP molecular marker of claim 1 or 2 or the kit of claim 3 or 4 in the identification or auxiliary identification of goat leg length.
6. The application according to claim 5, characterized in that, The goat in question is a Leizhou goat.
7. The application of the SNP molecular marker of claim 1 or 2 or the kit of claim 3 or 4 in goat breeding, wherein the breeding includes the selection of tall goats or the selection of short goats.
8. The application according to claim 7, characterized in that, The goat in question is a Leizhou goat.
9. A method for identifying or assisting in the identification of goat leg length, characterized in that, Includes the following steps: Using the genomic DNA of the goat to be tested as a template, PCR amplification was performed using the amplification primers in the kit described in claim 3 or 4 to obtain the amplification product; Using restriction endonucleases Hha I. The amplification product is subjected to enzyme digestion, and the genotype of the amplification product is determined according to the size of the enzyme digestion product; the genotype of the amplification product is the genotype of the SNP molecular marker of any one of claims 1 to 3 in the amplification product. If the enzyme digestion products are 659bp, 456bp, and 203bp in size, then the genotype of the amplified product is TC. If the enzyme digestion product is only 659 bp in size, then the genotype of the amplified product is TT; If the enzyme digestion products are 456bp and 203bp in size, then the genotype of the amplified product is CC. The leg length of the goat to be tested is determined based on the genotype of the amplified product; the longer the leg length, the taller the body size. The test goats with genotype CC had longer legs than those with genotypes TC or TT, and the test goats with genotype TC had longer legs than those with genotype TT.
10. The method according to claim 9, characterized in that, The goat in question is a Leizhou goat.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to tall and short foot characters of Leizhou goats, detection primer, kit, detection method and application
CN118638939A
SNP (Single Nucleotide Polymorphism) molecular marker for identifying or assisting in identifying height of goat body type and application of SNP molecular marker
CN119410796A
Biomarkers for conformation of riding traits in horses
US20240043926A1