Application of soybean 2-hydroxyisoflavanone dehydratase gene in improvement of intercropping corn growth

Abstract

The invention discloses an application of a soybean 2-hydroxyisoflavanone dehydratase gene in improving the growth of intercropping corn. The gene HID1 can promote soybean to synthesize isoflavone, recruit bacillus and promote mycorrhizal fungi infection, so that the growth of intercropped corn is promoted, and the gene HID1 has important significance in illuminating the biological function of the GmHID1 gene in leguminous crop intercropping and regulating and controlling the synergistic growth promotion of plants, mycorrhizal fungi and bacillus in intercropping.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular to the application of a soybean 2-hydroxyisoflavanone dehydratase gene in improving the growth of intercropped maize. BACKGROUND

[0002] Interplanting is defined as growing two or more crops in the same field, which are grown together for most of their life cycle. Interplanting can promote the growth of intercropped crops through direct effects mediated by root exudates, and indirect effects produced by microbial activities induced by root exudates. Root exudates play an important role in mobilizing poorly soluble nutrients and regulating microbial activity by releasing organic acids, sugars and secondary metabolites. Signal molecules in root exudates, such as flavonoids, can recruit beneficial microorganisms to the rhizosphere, creating more favorable growth conditions for plants. More and more studies have shown that root exudates are an important link between plants, soil and beneficial microorganisms.

[0003] Arbuscular mycorrhizal (AM) fungi can form symbiotic relationships with more than two-thirds of terrestrial plants and play an important role in plant nutrient uptake by relying on their extensive extramatrical hyphal networks, especially in phosphorus acquisition and transport. Bacillus, as an important group of plant growth-promoting bacteria, can coexist with arbuscular mycorrhizal fungi in legume root systems and produce synergistic effects. By dissolving phosphorus, promoting nutrient utilization and improving rhizosphere microenvironment, Bacillus can enhance the plant's ability to absorb nutrients such as nitrogen and phosphorus, thereby promoting plant growth. In intercropping systems, the combined inoculation of arbuscular mycorrhizal fungi and Bacillus can synergistically improve the nutrient acquisition efficiency and growth level of host plants, and may promote nutrient sharing between different crops through the mediation of mycorrhizal common network nutrient transport, thereby improving the overall nitrogen and phosphorus utilization efficiency of the intercropping system and promoting the growth of crops in the intercropping system.

[0004] Isoflavones are important secondary metabolites in soybeans, such as daidzein and genistein metabolites, which play multiple key roles in plant growth, stress resistance, and interaction. They are mainly synthesized through the isoflavone biosynthesis pathway. 2-Hydroxyisoflavanone dehydratase (2-Hydroxyisoflavanone Dehydratase, abbreviated as HID) gene is a key catalytic enzyme gene in the isoflavone biosynthesis pathway, which plays a key role in the biosynthesis of daidzein and genistein. Therefore, it is not clear whether the 2-hydroxyisoflavanone dehydratase gene also plays a key role in the intercropping system inoculated with arbuscular mycorrhizal fungi and Bacillus.

[0005] Maize / soybean intercropping is one of the most widely used intercropping patterns in agricultural production, typically exhibiting a growth advantage dominated by maize. However, to date, it remains unclear whether root exudates participate in the synergistic effect of arbuscular mycorrhizal fungi and Bacillus to promote intercropping advantage; furthermore, it lacks a systematic elucidation of whether the 2-hydroxyisoflavone dehydratase gene plays a key regulatory role in intercropping systems co-inoculated with arbuscular mycorrhizal fungi and Bacillus. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide an application of the soybean 2-hydroxyisoflavone dehydratase gene in improving the growth of intercropped maize.

[0007] The objective of this invention is achieved through the following technical solution: Application of a soybean 2-hydroxyisoflavone dehydratase gene in improving the growth of intercropped maize, wherein the nucleotide sequence of the soybean 2-hydroxyisoflavone dehydratase gene is shown in SEQ ID NO.2.

[0008] The intercropping method described above involves intercropping soybeans and corn.

[0009] The soybean variety mentioned is Yuechun 03-3.

[0010] The corn variety mentioned is Zhengtian 68.

[0011] A soybean 2-hydroxyisoflavone dehydratase, the amino acid sequence of which is shown in SEQ ID NO.1.

[0012] The application of a soybean 2-hydroxyisoflavone dehydratase gene in improving soybean isoflavone biosynthesis, wherein the nucleotide sequence of the soybean 2-hydroxyisoflavone dehydratase gene is shown in SEQ ID NO.2.

[0013] The isoflavones mentioned include daidzein or genistein.

[0014] An overexpression vector for the soybean 2-hydroxyisoflavone dehydratase gene, comprising the nucleotide sequence shown in SEQ ID NO.2.

[0015] The overexpression vector has a vector backbone of pFGC5941.

[0016] A method for increasing intercropping yields includes the following steps: An overexpression vector carrying the soybean 2-hydroxyisoflavone dehydratase gene was transferred into soybeans using Agrobacterium tumefaciens. Overexpressing soybean plants were then screened. The overexpressing soybeans were intercropped with corn, and symbiotic bacteria were inoculated during the corn and soybean planting period to increase the yield of the intercropping.

[0017] The symbiotic bacteria include Bacillus and / or arbuscular mycorrhizal fungi.

[0018] The Bacillus mentioned is Bacillus belyssus. Bacillus velezensis PLR22.

[0019] The arbuscular mycorrhizal fungus mentioned is *Rhizocarpium heterotropoides*. Rhizophagus irregularis MUCL 43194.

[0020] The present invention has the following advantages and effects compared with the prior art: The gene of this invention HID1 It can promote the synthesis of isoflavones in soybeans, recruit Bacillus and promote mycorrhizal fungal infection, thereby promoting the growth of intercropped corn. This is important for elucidating... GmHID1 Understanding the biological functions of genes in intercropping leguminous crops is of great significance in regulating the synergistic growth of plants, mycorrhizal fungi, and Bacillus in intercropping. Attached Figure Description

[0021] Figure 1 It is in the roots of soybean compound plants GmHID1 The expression level. The data in the figure are the mean and standard error of five biological replicates.

[0022] Figure 2 Under different inoculation conditions, empty EV-loaded soybeans or soybeans overexpressing EVs... GmHID1 (HID1-OX) Content of daidzein and genistein in soybean roots.

[0023] Figure 3 Under different inoculation conditions, empty EV-loaded soybeans or soybeans overexpressing EVs... GmHID1 (HID1-OX) Abundance of rhizosphere Bacillus in soybean and intercropped maize.

[0024] Figure 4 Under conditions of co-inoculation with arbuscular mycorrhizal fungi and Bacillus (+AB), empty vector EV soybean or overexpression GmHID1 (HID1-OX) Mycorrhizal infection rate of soybean and intercropped maize.

[0025] Figure 5 Under different inoculation conditions, empty EV-loaded soybeans or soybeans overexpressing EVs... GmHID1 (HID1-OX) Growth phenotypes and plant dry weight of soybean and intercropped maize.

[0026] Figure 6 Under different inoculation conditions, empty EV-loaded soybeans or soybeans overexpressing EVs... GmHID1 (HID1-OX) Phosphorus content in soybeans and corn intercropped with them.

[0027] Figure 7 This is a plasmid map of the vector pFGC5941. Detailed Implementation

[0028] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0029] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0030] Example 1: Soybean 2-hydroxyisoflavone dehydratase gene GmHID1 overexpression 1.1 Soybean 2-hydroxyisoflavone dehydratase gene GmHID1 Cloning On the Phytozome website (https: / / phytozome-next.jgi.doe.gov / ) Glycine max Download Wm82.a2.v1 database GmHID1 The full-length CDS sequence of the gene, designed based on the sequence. GmHID1 Gene-specific primers were used, with leaf cDNA from soybean (Yuechun 03-3) as a template, and amplification was performed using the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Novazia, Nanjing). GmHID1 For gene CDS, the specific primers used are as follows: GmHID1-F: TTACAATTACCATGGGGCGCGCCATGTCTGAGATATCGAACTC; GmHID1-R: CTCTAGACTCACCTAGGATCCTCAAACTTTCCCCAAATGCT.

[0031] 1.2 Construction of overexpression vectors The obtained PCR amplification products were subjected to gel electrophoresis. After confirming the band size, the target band was accurately excised using an agarose gel DNA recovery kit for the recovery and purification of the PCR products. Asc I and Bam HⅠ restriction endonuclease will pFGC5941 - 35S - intron -( GFP - Bar markerThe plasmid was linearized and then ligated with the recovered DNA fragment to generate the CaMV35S:GmHID1 vector. The recombinant plasmid was transformed into *E. coli*, and plasmid extraction yielded a GFP-tagged vector. GmHID1 Overexpression vector plasmid.

[0032] For relevant vector diagrams and experimental procedures, please refer to the literature "Xu H, Li Y, Zhang K, Li M, Fu S, Tian Y, Qin T, Li X, Zhong Y, Liao H. (2021)". miR169c-NFYA-C-ENOD40 modulatesnitrogen inhibitory effects in soybean nodulation. New Phytologist, 229(6),3377-3392".

[0033] 1.3 Transformation and Expression After successful sequencing, the plasmid was transformed into *Agrobacterium rhizogenes* K599 competent cells (with streptomycin resistance) using a freeze-thaw method. Soybean hypocotyl injection transformation was performed using *Agrobacterium rhizogenes*-mediated transformation. Roots containing GFP fluorescence were detected using a fluorescent labeling detector, and non-fluorescent roots were discarded, yielding the desired result. GmHID1 Transgenic composite plants overexpressing (OX) were simultaneously introduced, while those without the target gene were also introduced. pFGC5941 - 35S - intron -( GFP - Bar marker Empty vector plasmids were transferred into K599 competent cells as empty vectors (EVs). (Zheng Linsheng. Physiological and molecular mechanisms of different phosphorus and magnesium treatments affecting the symbiosis between soybean and AM fungi [D]. Master's thesis, South China Agricultural University, 2023).

[0034] 1.4 Detection of gene expression levels RNA was extracted from adventitious roots growing from the hypocotyl wounds of some transgenic plants obtained in step 1.3 and reverse-engineered into cDNA as a template. Plasmid DNA served as a positive control, and root cDNA from non-transgenic soybeans served as a negative control. Quantitative PCR was used to detect the over-absorption effect. In the quantitative PCR experiment, the soybean housekeeping gene was used as the template. EF-1a The reference gene is used, and the relative expression level is used for the target gene. GmHID1 The ratio of the expression level of α to the expression level of housekeeping genes.

[0035] GmHID1q-F: GTGACTCAGCTGGAGGGAAC; GmHID1q-R: TGGAAAGCTGGTGTAAACATGA; EF1α-F: TGCAAAGGAGGCTGCTAACT; EF1α-R: CAGCATCACCGTTCTTCAAA.

[0036] Experimental results are as follows Figure 1 As shown, in the transgenic composite plant sample GmHID1 The expression level was significantly increased, proving that successful expression was achieved. GmHID1 Transgenic composite plants overexpressing (OX).

[0037] Example 2: Soybean 2-hydroxyisoflavone dehydratase gene GmHID1 Functional analysis in intercropping systems 2.1 Overexpression GmHID1 Effects of intercropped soybean roots on isoflavone content Sterilized quartz sand was used as the substrate. First, quartz sand was mixed evenly in a 1:2:1 mass ratio according to three particle sizes: coarse (1-2 mm), medium (0.5-1 mm), and fine (<0.5 mm). The mixed quartz sand was sterilized in an autoclave at 121°C for 40 minutes. To completely inactivate potential microorganisms, this sterilization process was repeated twice, 24 hours apart. The sterilized quartz sand was left at room temperature for one week before use. Intercropping of corn and soybean was carried out using a two-compartment system with a 30-μm nylon mesh partition (roots could not pass through, but arbuscular mycorrhizal fungal hyphae could). Each compartment contained 1 kg of the above-mentioned sterilized quartz sand, mixed with 250 mg of insoluble calcium phosphate, equivalent to 50 mg of phosphorus per kilogram of sand. Corn seeds were surface-sterilized with a 10% (v / v) sodium hypochlorite solution for 15 seconds and then directly sown in the corn (Zhengtian 68) compartment, while the transgenic soybean plants were simultaneously transferred to the soybean compartment. The first inoculation with arbuscular mycorrhizal fungi was conducted on the same day. The experiment included three inoculation treatments: an uninoculated control (-AB), and a single inoculation with Bacillus (Bacillus belyssus). Bacillus velezensis PLR22, accession number CGMCC.No: 63091) (+B), Arbuscular mycorrhizal fungi (Heteromorpha rhizocarp) Rhizophagus irregularisCo-inoculation (+AB) of arbuscular mycorrhizal fungi (AM) with Bacillus was performed, and plants were harvested 5 weeks after inoculation with AM. For the AM inoculation treatment, a suspension containing 500 AM fungal spores was added near the roots of each seedling using a pipette. Two days after the first inoculation, the first Bacillus inoculation was performed. For the Bacillus inoculation treatment, 3 mL of Bacillus resuspension (OD600=0.8) was added near the roots of each seedling. All uninoculated control treatments were treated with an equal volume of sterile water at the corresponding time points. Within one week after the first inoculation, the AM and Bacillus treatments were repeated for a second and third time, respectively, to ensure successful inoculation. The experiment was conducted under low phosphorus (50 µMP) conditions. During plant culture, the plants were irrigated weekly with 100 mL of a modified low-phosphorus 1 / 2 Hoagland nutrient solution. The nutrient solution is specifically composed of: 7.5 mmol / L total nitrogen from KNO3 (2.5 mmol / L) and Ca(NO3)2·4H2O (2.5 mmol / L), and 50 μmol / L phosphorus from KH2PO4 (50 μmol / L). Other components and concentrations (μmol / L) of the nutrient solution are as follows: K2SO4 (700), C 10 H 12 FeN2NaO8 (Fe-EDTA-Na,80), MnCl2 (4.50), MgSO4 (1000), ZnSO4(0.30), CuSO4 (0.16), (NH4)6Mo7O 24 (0.16), H3BO3 (20). Adjust the pH of the nutrient solution to 5.8-6.0 with NaOH or HCl before use.

[0038] The relevant experimental procedures can be found in the literature "Zhou Y, Li Y, Pan L, Lambers H, Wang X. Intercropping promotes maize growth by enhancing accumulation of specific metabolites in the rhizosphere and synergistic interaction between arbuscular mycorrhizal fungi and..." Bacillus Plant Soil. 2025. https: / / doi.org / 10.1007 / s11104-025-07530-3. or Zhao Shaopeng. Physiological and molecular mechanisms of differences in soybean mycorrhizal growth response and related factors. GmSWEET6Gene function analysis [D]. South China Agricultural University, 2019.

[0039] The plant roots were ground into a fine powder and transferred to centrifuge tubes containing 70% (v / v) ethanol and 0.1% (v / v) acetic acid. The sample was homogenized for 12 hours under continuous shaking. It was then centrifuged at 2700g for 10 minutes, and the supernatant was filtered through a 0.22 μm organic phase filter membrane (Jinteng Company, Tianjin, China). Quantitative analysis of daidzein and genistein was performed using an Agilent 1260 high-performance liquid chromatography system (Agilent Technologies, USA) equipped with an Eclipse XDB-C18 column (250 mm × 4.6 mm, 5 μm; Agilent Technologies, USA).

[0040] Experimental results are as follows Figure 2 As shown, under conditions of no inoculation (-AB) and co-inoculation with arbuscular mycorrhizal fungi and Bacillus (+AB), overexpression was observed compared to the empty vector control (EV). GmHID1 It significantly increased the content of daidzein and genistein in soybean roots; while under the condition of inoculation with Bacillus (+B) alone, it overexpressed GmHID1 It had no significant effect on daidzein content, but significantly increased genistein content.

[0041] 2.2 Overexpression GmHID1 Effects on mycorrhizal infection of intercropped maize and soybean roots and recruitment of rhizosphere Bacillus. Five weeks after inoculation with arbuscular mycorrhizal fungi in the intercropping experiment in section 2.1, corn and soybean plants were harvested. Small sections of fresh root samples were soaked in 10% KOH (w / v) solution for one week until transparent. After rinsing with water, the transparent root samples were stained with 5% acetic acid ink (v / v) for 60 seconds, rinsed until colorless, and then preserved in 7.5% mycorrhizal preservation solution (v / v). The mycorrhizal infection rate of the roots was observed and recorded using a solid microscope using the cross-stripe method. The mycorrhizal infection rate was determined using the grid method (experimental procedures can be found in the literature: Zhou Y, Li Y, Pan L, Lambers H, Wang X. Intercropping promotes maize growth by enhancing accumulation of specific metabolites in the rhizosphere and synergistic interaction between arbuscular mycorrhizal fungi and...). BacillusPlant Soil. 2025. https: / / doi.org / 10.1007 / s11104-025-07530-3. Simultaneously, Bacillus abundance was determined from rhizosphere sand collected from maize and soybean. Total DNA was extracted from the rhizosphere sand using the FastDNA® Spin Kit for Soil (MPBIO, USA). Quantitative PCR (qPCR) was performed on an Applied Biosystems StepOnePlus real-time quantitative PCR system (ABI, USA) using primer B. velezensis The specific primers for PLR22 are as follows: BvPLR22-F:GTGTCTCAGTCCCAGTGTGG; BvPLR22-R:GTGAGGTAACGGCTACCAA.

[0042] Sterile water was used as a negative control. Four biological replicates were set up for each treatment. The standard curve was constructed by serially diluting the plasmid carrying the target gene 10-fold, and the gene copy number was calculated based on the cycle threshold (Ct). The PCR reaction efficiency was 96%–100% (based on the slope of the standard curve).

[0043] Experimental results are as follows Figure 3 and 4 As shown, under conditions of co-inoculation with arbuscular mycorrhizal fungi and Bacillus (+AB), overexpression GmHID1 It also significantly increased the mycorrhizal infection rate of corn and soybean plants in the intercropping system. Figure 3 Under conditions of inoculation with Bacillus alone (+B) and co-inoculation with arbuscular mycorrhizal fungi and Bacillus (+AB), overexpression was observed compared to the empty vector control (EV). GmHID1 Significantly increased the relative abundance of rhizosphere Bacillus in maize and soybean plants in the intercropping system ( Figure 4 ).

[0044] 2.3 Overexpression GmHID1 Effects on the growth of intercropped maize and soybean plants Five weeks after inoculation with arbuscular mycorrhizal fungi in the intercropping experiment in section 2.1, corn and soybean plants were harvested, and their growth phenotypes were photographed and recorded. The aboveground parts and roots of the plants were collected, dried, and their dry weight measured. The dried plants were ground and digested using the H₂SO₄-H₂O₂ method. The specific steps included: weighing 0.1 g of sample into a digestion tube; adding 1 mL of water and 5 mL of concentrated sulfuric acid to the digestion tube; placing a separatory funnel at the mouth of the tube; and incubating overnight. The next day, the digestion tube was heated to 180°C and maintained for 30 minutes, then the temperature was increased to 350°C. The digestion tube was removed, and hydrogen peroxide was added dropwise several times until the solution became clear. After completion, the solution was diluted to 100 mL with distilled water, shaken well, and allowed to stand. The phosphorus concentration was determined using a wet-on-flow analyzer (Skalar Breda, Netherlands). Phosphorus content in plants (mg / plant) = phosphorus concentration in aboveground parts (mg / g) × dry weight of aboveground parts (g / plant) + phosphorus concentration in roots (mg / g) × dry weight of roots (g / plant).

[0045] Experimental results are as follows Figures 5-6 As shown, under the condition of no inoculation (-AB), overexpression GmHID1 It had no significant effect on the dry weight of intercropped soybean and maize plants; however, under conditions of inoculation with Bacillus alone (+B) and co-inoculation with arbuscular mycorrhizal fungi and Bacillus (+AB), it showed overexpression compared to the empty vector control (EV). GmHID1 It significantly increased the dry weight of intercropped maize plants, but had no significant effect on the dry weight of soybean plants. Figure 5 ).

[0046] Regarding nutrient accumulation, under uninoculated (-AB) conditions, overexpression... GmHID1 It had no significant effect on phosphorus content in intercropped soybean and maize plants; under co-inoculation (+AB) conditions, overexpression GmHID1 It significantly increased the phosphorus content of intercropped maize plants, while having no significant effect on the phosphorus content of soybean plants; under the condition of inoculation with Bacillus (+B) alone, overexpression GmHID1 Significantly increased the phosphorus content of corn and soybean plants in the intercropping system ( Figure 6 ).

[0047] In summary, in the corn / soybean intercropping system, GmHID1 It may enhance the ability of soybean and maize rhizosphere to recruit Bacillus by regulating the synthesis and secretion of isoflavones in soybean roots, and further promote the infection of arbuscular mycorrhizal fungi, thereby improving the nutrient acquisition efficiency in the intercropping system, especially promoting the growth of intercropped maize, and having an important impact on the formation of maize / soybean intercropping advantage.

[0048] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Application of soybean 2-hydroxyisoflavanone dehydratase gene in improving the growth of intercropped corn, characterized in that: the nucleotide sequence of the soybean 2-hydroxyisoflavanone dehydratase gene is shown as SEQ ID NO.

2.

2. The application of soybean 2-hydroxyisoflavanone dehydratase gene in improving the growth of intercropped corn according to claim 1, characterized in that: the intercropping is soybean and corn; the variety of the soybean is Yuechun 03-3; the variety of the corn is Zhengtian 68.

3. Soybean 2-hydroxyisoflavanone dehydratase, characterized in that: the amino acid sequence of the soybean 2-hydroxyisoflavanone dehydratase is shown as SEQ ID NO.

1.

4. Application of soybean 2-hydroxyisoflavanone dehydratase gene in improving the biosynthesis of soybean isoflavones according to claim 2.

5. The application according to claim 4, characterized in that: the isoflavones include daidzein or genistein.

6. A soybean 2-hydroxyisoflavanone dehydratase gene overexpression vector, characterized in that: it comprises the nucleotide sequence shown as SEQ ID NO.

2.

7. The overexpression vector according to claim 6, characterized in that: the vector backbone of the overexpression vector is pFGC5941. comprising the following steps: After the overexpression vector carrying the soybean 2-hydroxyisoflavanone dehydratase gene is transformed into soybean by Agrobacterium, the overexpression soybean plant is screened, the overexpression soybean is intercropped with corn, and symbiotic bacteria are inoculated during the planting of corn and soybean to improve the yield of intercropping.

9. The method for improving the yield of intercropping according to claim 8, characterized in that: the symbiotic bacteria include Bacillus or / and arbuscular mycorrhizal fungi.

10. The method for improving the yield of intercropping according to claim 9, characterized in that: Bacillus velezensis Rhizophagus irregularis ​ ​ 8. A method of increasing intercropping yield, characterized by ​ ​ ​ ​ ​ The Bacillus is Bacillus velezensis ​ PLR22; The arbuscular mycorrhizal fungus is Glomus heterosporum ​ MUCL 43194.

Images