Polypeptide for promoting synthesis of plant anthocyanin and application

Abstract

The invention provides a polypeptide for promoting synthesis of plant anthocyanin and application, and belongs to the technical field of genetic engineering. The invention provides a polypeptide for promoting the synthesis of plant anthocyanin. The polypeptide is characterized in that a key site of a key structural domain for regulating and controlling the synthesis of the anthocyanin is mutated. According to the invention, the existing sequence is subjected to key site mutation and optimization, and is used for promoting the biosynthesis of anthocyanin. By mutating the key amino acid site of the original sequence, the regulation and control capability of the transcription factor in anthocyanin biosynthesis can be obviously improved. The invention also constructs an overexpression vector based on the coding gene or the optimized gene of the polypeptide, and the anthocyanin accumulation amount of a transgenic material can be obviously promoted by overexpressing the gene or the optimized gene in a plant cell.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a polypeptide that promotes anthocyanin synthesis in plants and its applications. Background Technology

[0002] Anthocyanins are a class of bioactive flavonoids that accumulate in different plant tissues and organs, exhibiting various biological functions, such as attracting pollinators and protecting plants from ultraviolet radiation and pests. Furthermore, as phytonutrients, anthocyanins possess strong antioxidant and anti-mutagenic properties, playing an important role in human health.

[0003] Anthocyanin biosynthesis is primarily controlled by two types of genes: structural genes and regulatory genes. Structural genes encode enzymes directly involved in anthocyanin synthesis, comprising two important gene groups: upstream genes (CHS, CHI, F3H, F3'H) and downstream genes (DFR, LAR, ANS, LDOX, ANR, GT). Upstream genes typically encode enzymes at pathway initiation sites involved in the synthesis of substances such as flavonoids; downstream genes exhibit significantly different expression patterns, primarily encoding enzymes that synthesize anthocyanins and proanthocyanidins. This difference is mainly due to the species- and tissue-specific nature of flavonoid functions. Regulatory genes primarily include three types of transcription factors: MYB, bHLH, and WD40. These factors form the MBW complex, which binds to the promoters of structural genes for precise regulation. Currently, overexpression of MYB-type transcription factors can enhance anthocyanin biosynthesis and accumulation; however, due to the limited DNA binding efficiency of MYB transcription factors, their efficiency in promoting anthocyanin biosynthesis needs further improvement. Summary of the Invention

[0004] This invention provides a polypeptide that promotes anthocyanin synthesis in plants and its application.

[0005] This invention provides a polypeptide that promotes anthocyanin synthesis in plants, the polypeptide comprising mutations at key sites of key domains that regulate anthocyanin synthesis.

[0006] In one specific embodiment of the present invention, the key sites of the key structural domains regulating anthocyanin synthesis include the R2 and / or R3 motifs of the MYB transcription factor.

[0007] In one specific embodiment of the present invention, the mutation includes point mutations at one or more sites of the R2 and / or R3 motif of the MYB transcription factor.

[0008] The present invention also provides a gene encoding the above-mentioned polypeptide.

[0009] The present invention also provides an optimized gene obtained by codon optimization of the above-mentioned gene using a target plant as a host.

[0010] The present invention also provides an overexpression vector containing the above-mentioned gene or the above-mentioned optimized gene and expressing the above-mentioned polypeptide.

[0011] The present invention also provides recombinant engineered bacteria comprising the above-described overexpression vector.

[0012] This invention also provides the application of the above-mentioned gene, the above-mentioned optimized gene, the above-mentioned overexpression vector, or the above-mentioned recombinant engineered bacteria in increasing the anthocyanin synthesis in plants.

[0013] This invention also provides the application of the above-mentioned gene, the above-mentioned optimized gene, the above-mentioned overexpression vector, or the above-mentioned recombinant engineered bacteria in the creation of anthocyanin-accumulating plant germplasm.

[0014] The present invention also provides a method for creating anthocyanin-accumulating hairy roots, comprising the following steps: transforming the above-mentioned overexpression vector into Agrobacterium rhizogenes to obtain recombinant Agrobacterium rhizogenes; using the Agrobacterium rhizogenes to infect plant explants, and culturing them to obtain anthocyanin-accumulating hairy roots.

[0015] Beneficial Effects: This invention provides a polypeptide that promotes anthocyanin synthesis in plants, wherein the polypeptide comprises mutations at key sites of key structural domains regulating anthocyanin synthesis. This invention promotes anthocyanin biosynthesis by mutating and optimizing existing sequences at key sites. By mutating key amino acid sites in the original sequence, this invention can significantly improve the regulatory capacity of the transcription factor in anthocyanin biosynthesis.

[0016] The present invention also constructs an overexpression vector based on the coding gene or optimized gene of the polypeptide, and by overexpressing the gene or optimized gene in plant cells, the accumulation of anthocyanins in transgenic materials can be significantly promoted. Attached Figure Description

[0017] Figure 1 A comparison diagram of wild-type MYB transcription factors and mutant sequences;

[0018] Figure 2 A comparison diagram of wild-type MYB transcription factor and m2 mutant sequences;

[0019] Figure 3 The HPLC results for the detection of anthocyanins according to the NY / T 2640-2014 method are shown in the figure.

[0020] Figure 4 The graph shows the expression levels of M2-positive strains using qPCR.

[0021] Figure 5 This is a diagram showing the PCR results of the M2 positive strain.

[0022] Figure 6 An image showing anthocyanin accumulation in the hairy roots of the snapdragon M2 mutant. Detailed Implementation

[0023] This invention provides a polypeptide that promotes anthocyanin synthesis in plants, the polypeptide comprising mutations at key sites of key domains that regulate anthocyanin synthesis.

[0024] In this invention, the major gene in the MBW protein complex is MYB, and some MYB transcription factors have the ability to independently regulate anthocyanin biosynthesis. MYB transcription factors capable of regulating anthocyanin synthesis are typically R2R3 type MYB transcription factors, whose R2R3 domain can bind to the promoter of anthocyanin synthesis structural genes, promoting their transcription and thus regulating their expression. This invention, through artificial design, modifies the R2R3 domain to enhance its binding ability to the promoter, thereby further improving anthocyanin synthesis capacity.

[0025] In one specific embodiment of the present invention, the key sites of the key structural domain regulating anthocyanin synthesis include the R2 and / or R3 motifs of the MYB transcription factor, wherein the MYB transcription factor is Arabidopsis MYB75 (AT1G56650, NP_176057.1). The present invention modifies one or more sites of the R2 and / or R3 motifs of the MYB transcription factor as follows: Figure 1 The point mutation shown, Figure 1 In the sequence WT, the amino acid sequence of the wild-type MYB transcription factor is represented. m1 to m11 represent mutant polypeptides obtained through point mutations, where m1 indicates a mutation from L at position 20 to R (L20R), m2 indicates a mutation from L at position 20 to K (L20K), m3 indicates a mutation from L at position 20 to F (L20F), m4 indicates a mutation from L at position 57 to F (L57F), m5 indicates a mutation from L at position 57 to R (L57R), m6 indicates a mutation from L at position 57 to K (L57K), and m7 indicates a mutation from L at position 99 to R (L57R). The mutations are: D is mutated to K (D99K), m8 represents mutating D at position 99 to F (D99F), m9 represents mutating D at position 99 to W (D99W), m10 represents mutating N at position 102 to W (N102W), and m11 represents mutating L at position 22 to R, L at position 57 to K, and D at position 99 to K (L22R / L57K / D99K). After verification, it was found that compared with the wild-type gene, the binding ability is enhanced, the anthocyanin synthesis ability of the mutant sequence is stronger, and the synthesis ability of mutant m2 is the strongest.

[0026] In a specific embodiment of this invention, the major gene in the MBW protein complex is MYB, and some MYB transcription factors have the ability to independently regulate anthocyanin biosynthesis. MYB transcription factors capable of regulating anthocyanin synthesis are typically R2R3 type MYB transcription factors, whose R2R3 domain can bind to the promoter of anthocyanin synthesis structural genes, promoting their transcription and thus achieving the purpose of regulating their expression. This invention, through artificial design, modifies the R2R3 domain to enhance its binding ability to the promoter, thereby further improving the anthocyanin synthesis capacity.

[0027] The present invention also provides a gene encoding the above-mentioned polypeptide.

[0028] The present invention does not specifically limit the gene, and translation can be performed based on the correspondence between nucleotide sequences and amino acid sequences.

[0029] The present invention also provides an optimized gene obtained by codon optimization of the above-mentioned gene using a target plant as a host.

[0030] The optimized gene described in this invention is optimized based on the host's codon preference, and the nucleotide sequence of the optimized gene of the m2 mutant polypeptide obtained after codon optimization can be as shown in SEQ ID No. 1 to SEQ ID No. 7, or of course, other nucleotide sequences.

[0031] The present invention also provides an overexpression vector containing the above-mentioned gene or the above-mentioned optimized gene and expressing the above-mentioned polypeptide.

[0032] In one specific embodiment of the overexpression vector of the present invention, Pcambia1301 is used as the basic backbone vector, and a codon-optimized nucleic acid sequence is inserted into the basic backbone vector to form the above-mentioned overexpression vector.

[0033] The present invention also provides recombinant engineered bacteria comprising the above-described overexpression vector.

[0034] In one specific embodiment of the present invention, Agrobacterium rhizogenes is used as the base strain, and the overexpression vector is used to transform the Agrobacterium rhizogenes to obtain recombinant engineered bacteria.

[0035] This invention also provides the application of the above-mentioned gene, the above-mentioned optimized gene, the above-mentioned overexpression vector, or the above-mentioned recombinant engineered bacteria in increasing the anthocyanin synthesis in plants.

[0036] The recombinant engineered bacteria described in this invention can transform plants through Agrobacterium rhizogenes-mediated transformation, thereby promoting anthocyanin synthesis in the transformed plants.

[0037] This invention also provides the application of the above-mentioned gene, the above-mentioned optimized gene, the above-mentioned overexpression vector, or the above-mentioned recombinant engineered bacteria in the creation of anthocyanin-accumulating plant germplasm.

[0038] In one specific embodiment of the present invention, the plant germplasm can be hairy roots, such as hairy roots of snapdragon or tomato generated through induced expression. In another specific embodiment of the present invention, the plant germplasm can also be a gene-transformed plant.

[0039] The present invention also provides a method for creating anthocyanin-accumulating hairy roots, comprising the following steps: transforming the above-mentioned overexpression vector into Agrobacterium rhizogenes to obtain recombinant Agrobacterium rhizogenes; using the Agrobacterium rhizogenes to infect plant explants, and culturing them to obtain anthocyanin-accumulating hairy roots.

[0040] In one specific embodiment of the present invention, the plant material can be snapdragon or Tomato simonii, and the explant can be the stem of snapdragon or the cotyledon of Tomato simonii. The present invention utilizes a bacterial suspension of Agrobacterium rhizogenes to infect the plant explants. After abstaining from excess bacterial suspension, the explants are placed on a co-culture medium (MS basal medium + 30 g / L sucrose + 100 μM acetylsylgenone; 27°C, 60% humidity) and cultured in the dark for 2 days. After sterilization and washing, the explants are dried and then placed on a sterilization medium (MS basal medium + 30 g / L sucrose + 200 mg / L termethin; 27°C, 60% humidity) for induction culture in the dark to obtain anthocyanin-accumulating hairy roots.

[0041] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a polypeptide that promotes anthocyanin synthesis in plants and its applications, should not be construed as limiting the scope of protection of the present invention.

[0042] In this embodiment of the invention, the anthocyanin content was detected by HPLC according to the national standard method NY / T 2640-2014.

[0043] In this embodiment of the invention, the high-fidelity enzyme (Takara Bio) Max DNA Polymerase); Escherichia coli and Agrobacterium rhizogenes competent cells (Weidi Biotechnology); Snapdragon (field collection); LB, TY and MS (Qingdao Haibo); Acetyleugenone and antibiotics (Merck Biotechnology).

[0044] Example 1

[0045] 1. Mutant sequence acquisition and optimization

[0046] Based on the published amino acid sequence of the MYB transcription factor R2R3 motif (AT1G56650, NCBI Reference Sequence: NP_176057.1), a mutated amino acid sequence was artificially designed to obtain it. Figure 1 and Figure 2 The amino acid sequence was codon-optimized according to the host codon preferences of snapdragon and tomato, resulting in an optimized nucleic acid sequence.

[0047] 2. Construction of overexpression vectors

[0048] 2.1 The optimized nucleic acid sequence was synthesized to obtain a template.

[0049] Target fragment amplification: Primers were designed using the optimized sequence as a template for high-fidelity amplification.

[0050] F(SEQ ID No.8):ATGGAAGGATCTTCAAAAGGACTTCGAA;

[0051] R: (SEQ ID No. 9): ATCGAACTTGACAGTCTCCCCATC.

[0052] 50 μL reaction system: 50-100 ng template, 2 μL each of 10 μM forward and reverse primers, 25 μL Mix, and the remainder ddH2O;

[0053] PCR reaction program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 58℃ annealing for 50 s, 72℃ extension for 1 kb / 5 s, 35 cycles; 72℃ final extension for 5 min; 4℃ hold.

[0054] After PCR, agarose gel electrophoresis and gel recovery were performed.

[0055] 2.2 Carrier linearization

[0056] The empty vector (pCAMBIA1301) was digested with the restriction enzyme BamHI.

[0057] 50μL enzyme digestion system: 1μg plasmid, 1μL BamHI enzyme, 5μL 10×buffer and the remainder ddH2O.

[0058] After enzyme digestion in a constant temperature water bath at 37℃ for 15 min, the sample was placed on ice and recovered by 1.5% agarose gel electrophoresis.

[0059] Adhesive recovery: Perform adhesive recovery for the target segment according to the instructions.

[0060] 2.3 Homologous Recombination of Target Fragment: Perform homologous recombination of the target fragment according to the instructions.

[0061] Calculation of carrier fragment usage:

[0062] The optimal amount of cloning vector used in the ClonExpress II recombination reaction system is 0.03 pmol, and the optimal amount of insert fragment is 0.06 pmol (vector to insert molar ratio of 1:2). The DNA mass corresponding to these molar amounts can be roughly calculated using the following formula:

[0063] Optimal cloning vector usage = [0.02 × number of base pairs in the cloning vector] ng (0.03 pmol)

[0064] Optimal insert size = [0.04 × number of insert base pairs] ng (0.06 pmol)

[0065] For example, when cloning a 2kb insert fragment into a 5kb cloning vector, the optimal amount of cloning vector should be 0.02 × 5,000 = 100 ng; the optimal amount of insert fragment should be 0.04 × 2,000 = 80 ng.

[0066] Prepare a 20 μL system on ice: X μL of linearized vector, y μL of insert fragment, 2 μL of 5× buffer, 1 μL of BamHI enzyme, and the remainder ddH2O;

[0067] Gently mix the mixture using a pipette, and briefly centrifuge to collect the reaction solution at the bottom of the tube. React at 37°C for 30 minutes; then cool to 4°C or immediately place on ice to cool.

[0068] 3. Transformation of Escherichia coli

[0069] Hapinate competent E. coli DH5α cells on ice; add 10 μL of recombinant product to 100 μL of competent cells, gently pipette to mix, incubate on ice for 5 min, heat shock at 42°C for 45 sec, incubate on ice for 2 min; add 700 μL of antibiotic-free LB liquid medium, shake at 37°C for 30 min; centrifuge at 2000 rpm for 2 min, discard the supernatant, resuspend the cells in the remaining medium, spread on a plate containing kanamycin, and incubate upside down for 14–18 h.

[0070] Identification of positive colonies: After overnight incubation, use a pipette tip to pick up well-grown colonies for positive clone PCR identification.

[0071] 25 μL PCR reaction system: 1 μL template, 1 μL each of 10 μM forward and reverse primers, 12.5 μL mix, and the remainder ddH2O; the forward and reverse primer sequences are SEQ ID No. 8 and SEQ ID No. 9;

[0072] PCR amplification program: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 30 s, 58℃ annealing for 50 s, 72℃ extension for 1 kb / min, 35 cycles; 72℃ final extension for 5 min; 4℃ hold.

[0073] After PCR, agarose gel electrophoresis was performed, and colonies with clear bands and the correct size were selected for amplification and sequencing.

[0074] 4. Plasmid extraction

[0075] Amplify the correctly sequenced single clones and extract plasmids according to the instructions.

[0076] 5. Transformation of Agrobacterium rhizogenes

[0077] Dissolve *Agrobacterium rhizogenes* competent cells MSU440 on ice; add 10 μL of plasmid to 100 μL of competent cells, gently pipette to mix, incubate on ice for 5 min, incubate in liquid nitrogen for 5 min, heat shock at 37°C for 5 min, and incubate on ice for 5 min; add 700 μL of antibiotic-free LB liquid medium, shake at 28°C for 2–3 h; centrifuge at 6000 rpm for 6 min, discard the supernatant, resuspend the bacterial cells in the remaining medium, spread on plates containing the corresponding antibiotic, and incubate upside down for 48–72 h.

[0078] Identification of Agrobacterium colony-positive clones: The method is the same as that for Escherichia coli colony-positive clone identification. Results are as follows: Figure 5 As shown.

[0079] 6. Anthocyanin accumulation induced by hairy roots

[0080] The obtained positive Agrobacterium strain was expanded and used to infect the stems of snapdragons and the cotyledons of Tomato simonii, respectively. After removing excess bacterial solution, the strains were placed on co-culture medium (MS basal medium + 30 g / L sucrose + 100 μM acetylsyringone, 27℃, 60% humidity) and cultured in the dark for 2 days. After desiccation and washing, the strains were dried and placed on desiccation medium (MS basal medium + 30 g / L sucrose + 200 mg / L termethin, 27℃, 60% humidity) for 15 days of induction culture in the dark to obtain anthocyanin-accumulating hairy roots.

[0081] 7. Identification of positive strains

[0082] DNA Extraction: Take 0.1g of hairy root material, wash with double-distilled water, and blot dry with filter paper. Cut the plant material into sections about 1cm long, place them in a grinding tube with grinding beads, and quickly place them in liquid nitrogen. Grind into a fine powder using a tissue homogenizer. Add 1mL of CTAB extraction buffer and 1% β-mercaptoethanol to the grinding tube, incubate at 65℃ for 30min, inverting to mix every 5min. After incubation, allow to reach room temperature for 2-3min, then centrifuge at 10000rpm for 5min. Transfer the supernatant to a clean centrifuge tube, add 1mL of chloroform, vortex to mix, and centrifuge at 13000rpm for 10min. Transfer 900μL of supernatant to a clean centrifuge tube, add 900μL of chloroform, vortex for 1min, and centrifuge at 13000rpm for 10min. Transfer 600μL of supernatant to a clean centrifuge tube, add an equal volume of 8M LiCl, mix, and precipitate at 4℃ for 3h. Centrifuge at 13000 rpm for 10 min, remove the supernatant, wash with 75% ethanol, centrifuge at 8000 rpm for 3 min, remove the supernatant, and repeat this step once. Place the sample in a clean bench to dry any residual ethanol, add RNase-ddH2O to resuspend the DNA, and determine the concentration and purity.

[0083] PCR identification: PCR verification was performed using the Agrobacterium rhizogenes marker genes RolA, RolB, RolC, RolD and the target gene. The reaction system and reaction procedure were the same as shown in (3).

[0084] rolA-F(SEQ ID No.10):ATGGAATTAGCCGGACTAAACG;

[0085] rolA-R (SEQ ID No. 11):TTAATCCCGTAGGTTTGTTTCGA;

[0086] rolB-F (SEQ ID No. 12):gcaggcttcatatcaccctcttcac;

[0087] rolB-R(SEQ ID No.13):caccctcccatgcttgtcg;

[0088] rolC-F (SEQ ID No. 14): ggcggaatttgacctatgtgctc;

[0089] rolC-R (SEQ ID No. 15):ccattccaaatttgcattcgccat;

[0090] rolD-F (SEQ ID No. 16):ggctcgttatttcggcagtagc;

[0091] rolD-R (SEQ ID No. 17): ccaacaggaccttgccaattgc.

[0092] The results are as follows Figure 4 and Figure 5 As shown, gene expression levels were detected in hairy root materials with anthocyanin accumulation. The results showed that the mutant sequence promoted anthocyanin accumulation by increasing the expression of genes responsible for anthocyanin synthesis.

[0093] 8. Anthocyanin detection: Anthocyanin content was determined by HPLC according to national standard methods.

[0094] The results are as follows Figure 3 and Figure 6 As shown, anthocyanins can accumulate in the hairy roots of the snapdragon m2 mutant.

[0095] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A polypeptide that promotes the synthesis of anthocyanins in plants, characterized in that, The polypeptide includes mutations at key sites of key domains that regulate anthocyanin synthesis.

2. The polypeptide according to claim 1, characterized in that, The key sites of the critical domains regulating anthocyanin synthesis include the R2 and / or R3 motifs of the MYB transcription factor.

3. The polypeptide according to claim 1 or 2, characterized in that, The mutations include point mutations at one or more sites of the R2 and / or R3 motifs of the MYB transcription factor.

4. A gene encoding the polypeptide of any one of claims 1 to 3.

5. An optimized gene obtained by codon optimization of the gene described in claim 4 using the target plant as the host.

6. An overexpression vector comprising the gene of claim 4 or the optimized gene of claim 5 and expressing the polypeptide of any one of claims 1 to 3.

7. Recombinant engineered bacteria comprising the overexpression vector of claim 6.

8. The application of the gene of claim 4, the optimized gene of claim 5, the overexpression vector of claim 6, or the recombinant engineered bacteria of claim 7 in increasing the anthocyanin synthesis in plants.

9. The application of the gene of claim 4, the optimized gene of claim 5, the overexpression vector of claim 6, or the recombinant engineered bacteria of claim 7 in the creation of anthocyanin-accumulating plant germplasm.

10. A method for creating hairy roots that accumulate anthocyanins, characterized in that, The process includes the following steps: transforming the overexpression vector of claim 6 into Agrobacterium rhizogenes to obtain recombinant Agrobacterium rhizogenes; using the Agrobacterium rhizogenes to infect plant explants, and then culturing them to obtain anthocyanin-accumulating hairy roots.

Images