Compositions and methods for increasing resistance to soybean cyst nematode

Abstract

Provided are plants, cells, tissues, and germplasm thereof comprising gene and marker alleles associated with increased resistance to soybean cyst nematode (SCN). Also provided are breeding methods and methods of identifying and selecting plants having alleles associated with increased resistance to SCN. Transgenic and genome edited plants comprising the gene alleles associated with increased SCN resistance are provided.

Description

Docket # 212089-WO-SEC-lCOMPOSITIONS AND METHODS FOR INCREASING RESISTANCE TO SOYBEAN CYST NEMATODEREFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0001] The official copy of the sequence listing is submitted electronically via Patent Center as an XML formatted sequence listing with a file named 212089_Sequence_Listing created on September 25, 2025, and having a size of 215,505 bytes and is filed concurrently with the specification. The sequence listing comprised in this XML formatted document is part of the specification and is herein incorporated by reference in its entirety.BACKGROUND

[0002] Soybean diseases are a major threat for soybean production, resulting in yield losses and decrease in grain quality. Soybean cyst nematode (SCN) is one of the most devastating pests to soybean across all major soybean growing regions. Estimated yearly yield reductions due to SCN infection have exceeded millions of tons and resulted in losses of more than $1 billion annually in the United States (Meinhardt et al. 2021, Plant Disease 105(10): 3238-43 and Wrather et al. 2006, J Nematol. 38(2): 173-80).

[0003] SCN management strategies rely on native resistance genes. Several of these resistance genes have been cloned, including Rhgl, Rhg2, and Rhg4. Rhgl and Rhg2 both encode modified a-SNAPs (Soluble N-ethylmaleimide-Sensitive Factor Attachment Proteins), which have been implicated in SCN resistance (Lakhssassi, Naoufal, et al., Scientific Reports 7.1 (2017): 45226).

[0004] Accordingly, there is a need to identify and use genes that provide improved resistance to SCN and methods for creating and selecting plants having genes that are associated with improved resistance to SCN.SUMMARY

[0005] Described herein are plants and plant materials comprising a heterologous nucleic acid associated with increased resistance to soybean cyst nematode (SCN). Also described herein are compositions and methods useful in producing, identifying and / or selecting plants and plant materials comprising the heterologous nucleic acid associated with increased resistance to soybean cyst nematode (SCN). Additionally, the disclosure provides compositions and methodsDocket # 212089-WO-SEC-l for the use of plant molecular markers that are linked to an SCN resistance phenotype. These compositions and methods can be used for selecting SCN resistant plants, breeding for SCN resistant plants, creating transgenic SCN resistant plants, and / or using genome editing to introduce SCN resistance in plants. Also provided herein are plants and methods for making plants having the markers and / or the heterologous nucleic acid associated with enhanced SCN resistance as compared to control plants. The compositions and methods can also be used to introgress SCN resistance into plants.

[0006] Provided herein is a heterologous nucleic acid comprising a sequence that (i) encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, or 9. As used herein the term heterologous refers to a sequence that originates from a foreign species or, if from the same species, is substantially modified from its native form in composition and / or genomic locus by deliberate human intervention. Thus, the disclosed heterologous nucleic acid can be a vector insert, in a transgenic construct, or it can be integrated at a non-native locus that differs from its natural or native location.

[0007] In another aspect, provided is a method of modifying plant material, comprising introducing into the plant material’s genome a heterologous nucleic acid sequence or expressing the heterologous nucleic acid sequence in the plant material, wherein the heterologous nucleic acid (i) encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1, 2, 3,Docket # 212089-WO-SEC-l4, 5, 6, 7, 8, or 9. In particular examples, the heterologous nucleic acid is associated with increased resistance to soybean cyst nematode.

[0008] For example, provided is a method of modifying plant material, comprising introducing into the genome of the plant material a heterologous nucleic acid sequence or expressing the heterologous nucleic acid sequence in the plant material, wherein the heterologous nucleic acid encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27. Provided is a method of modifying plant material, the method comprising introducing into the plant material’s genome a heterologous nucleic acid sequence or expressing the heterologous nucleic acid sequence in the plant material, wherein the heterologous nucleic comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18. Provided is a method of modifying plant material, the method comprising introducing into the plant material’s genome a heterologous nucleic acid sequence or expressing the heterologous nucleic acid sequence in the plant material, wherein the heterologous nucleic comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 100% nucleotide sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.

[0009] In each of the foregoing instances of the disclosed method of modifying plant material, the plant material is preferably soybean and the heterologous nucleic acid can be inserted into a genomic locus on soybean chromosome (Chr) Chr 1, Chr 2, Chr 3, Chr 4, Chr 5, Chr 6, Chr 7, Chr 8, Chr 9, Chr 10, Chr 11, Chr 12, Chr 13, Chr 14, Chr 15, Chr 16, Chr 18, Chr 19, or Chr 20. Alternatively, in each of the foregoing instances, the plant material is preferably soybean and the heterologous nucleic acid can be inserted into a genomic locus on soybean chromosome 17 at location other than its native locus, which corresponds to physical positions 23553783 to 23921640 on soybean chromosome 17 in the publicly available soybean genome for Williams82, a2, version 1 (W82.a2.vl) (Schmutz, J. et al. et al. 2010, Nature, 463(7278): 178-183).Docket # 212089-WO-SEC-l

[0010] In each of the foregoing instances of the disclosed method of modifying plant material, the plant material is preferably soybean and the heterologous nucleic acid can be operably linked to its native promoter. Alternatively, the heterologous nucleic acid can be operably linked to a heterologous promoter.

[0011] In each of the foregoing instances of the disclosed method of modifying plant material, the plant material is preferably soybean and the method comprises introducing the heterologous nucleic acid by creating a double-stranded break in the plant’s genome. Thus, the heterologous nucleic acid can be introduced using TALEN, meganuclease, zinc finger nuclease, or CRISPR- Cas technology. In some examples, the method comprises introducing the heterologous nucleic acid using a Cas endonuclease.

[0012] In another aspect, provided herein is a method of introducing a gene associated with increased resistance to soybean cyst nematode (SCN) into a plant by crossing two plants. The crossing method can comprise (a) crossing a plant having SCN resistance trait with a plant from a second plant line (“second plant”) to obtain progeny plants; (b) obtaining a sample containing nucleic acid from each of one or more of the progeny plants; (c) screening the sample for a nucleic acid that (i) encodes a polypeptide having at least 90% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, or 9; and selecting one or more progeny plants that have the screened-for nucleic acid. Typically, the plant having the SCN resistance trait comprises the screened-for nucleic acid.

[0013] For example, the crossing method can comprise screening the sample for and selecting one or more progeny plants that comprise a nucleic acid that (i) encodes a polypeptide having at least 90% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprises a sequence having at least 70%,Docket # 212089-WO-SEC-l75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, or 9.

[0014] In some examples of each instance of the foregoing crossing method, the screened-for nucleic acid is a heterologous nucleic on soybean chromosome Chr 1, Chr 2, Chr 3, Chr 4, Chr 5, Chr 6, Chr 7, Chr 8, Chr 9, Chr 10 Chr 11, Chr 12, Chr 13, Chr 14, Chr 15, Chr 16, Chr 18, Chr 19, or Chr 20. In other examples of each instance of the foregoing crossing method, the screened-for nucleic acid is a heterologous nucleic acid located on soybean chromosome 17 at location other than its native locus, which corresponds to physical positions 23553783 to 23921640 on soybean chromosome 17 in the publicly available soybean genome W82.a2.vl.

[0015] In certain examples of each instance of the foregoing crossing method, the screened for nucleic acid can be a heterologous nucleic acid that was introduced to the plant having SCN resistance or was introduced to a progenitor of the plant having SCN resistance by genome editing or by transgenic modification.

[0016] Each of the foregoing crossing methods disclosed herein can further comprise crossing the selected one or more progeny plants with the second plant to produce backcross progeny plants. Samples containing nucleic acid from one or more backcross progeny plant can each be screened for the presence of the disclosed screened-for nucleic acid, and one or more backcross progeny plants having the screened-for nucleic acid can be selected.

[0017] This further process can be repeated such that the crossing method includes crossing the selected one or more backcross progeny plants with the second plant to produce additional backcross progeny plants; obtaining a sample containing nucleic acid from one or more of the additional backcross progeny plants; screening each sample for the screened-for nucleic acid; and selecting one or more additional backcross progeny plants that have the screened for nucleic acid. This method can include additional rounds of backcrossing such that the method further includes (a) crossing the selected one or more additional backcross progeny plants with the second plant to produce further additional backcross progeny plants, (b) obtaining samples containing nucleic acid from one or more further additional backcross progeny plants; (c) screening each sample for the screened-for nucleic acid; and (d) selecting one or more further additional backcross progeny plants that have the screened-for nucleic acid. Optionally, steps (a) (d) can be repeated one or more times using the selected one or more further additional backcross progeny plants as the selected additional backcross progeny plants.Docket # 212089-WO-SEC-l

[0018] In yet another aspect, provided herein is a modified (e.g., genome edited or transgenic) plant comprising a heterologous nucleic acid sequence, the heterologous nucleic acid associated with increased resistance to soybean cyst nematode and (i) encodes a polypeptide having at least 90% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, or 9.

[0019] For example, the modified (e.g., genome edited or transgenic) plant can comprise a heterologous nucleic acid sequence the encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27. The modified (e g., genome edited or transgenic) plant can comprise a heterologous nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18. The modified (e.g., genome edited or transgenic) plant can comprise a heterologous nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 100% nucleotide sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.

[0020] In some examples of each instance of the foregoing modified plant, the plant is a transgenic soybean plant and the heterologous nucleic acid comprises coding sequence that is operably linked to a heterologous promoter.

[0021] In other examples of each instance of the foregoing modified plant, the plant is a genome edited soybean plant and the heterologous nucleic is located on soybean chromosome Chr 1, Chr 2, Chr 3, Chr 4, Chr 5, Chr 6, Chr 7, Chr 8, Chr 9, Chr 10, Chr 11, Chr 12, Chr 13, Chr 14, Chr 15, Chr 16, Chr 18, Chr 19, or Chr 20. In still other examples of each instance of the foregoing crossing method, the plant the plant is a genome edited soybean plant and the heterologous nucleic acid is located on soybean chromosome 17 at location other than its native locus, whichDocket # 212089-WO-SEC-l corresponds to physical positions 23553783 to 23921640 on soybean chromosome 17 in the publicly available soybean genome W82.a2.vl. In each of the foregoing examples of genome edited soybean plants, the heterologous nucleic acid can further comprise and be operatively linked to its native promoter (though at a non-native locus).

[0022] Each of the modified plants disclosed herein can be used to control soybean cyst nematode (SCN) inasmuch as the modified plant expresses an effective amount a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27. Thus, disclosed herein is the use of the modified plants disclosed herein to control SCN by expressing heterologous nucleic acid sequence the encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27.

[0023] In an additional aspect, the disclosure provides a method of detecting the presence or absence of a SNP allele at position 201 of one or more of SEQ ID NOs: 28, 33, 38, 43, 50, 53, 58, or 63 in a plant genome. The method can comprise amplifying genomic DNA containing the SNP allele at position 201 of one or more of SEQ ID NOs: 28, 33, 38, 43, 50, 53, 58, or 63 to thereby generate an amplicon. The amplicon is then contacted with one or more probes comprising one or more of SEQ ID NOs: 29, 32, 34, 37, 39, 42, 44, 47, 48, 49, 54, 57, 59, 62, 64, or 67. The method includes detecting whether the one or more probes bind to the amplicon to thereby determine the presence or absence of the one or more SNP allele.

[0024] In one example, the detection method comprises detecting the zygosity of the SNP allele at position 201 of one or more of SEQ ID NOs: 13, 18, 23, 28, 33, 38, 43, 48, 53, 58, or 63 in a plant genome. Zygosity can be detected by (a) amplifying genomic DNA containing the SNP allele at position 201 of one or more of SEQ ID NOs: 28, 33, 38, 43, 50, 53, 58, or 63; to thereby generate an amplicon; (b) contacting the amplicon with one or both of the following sets of probes: (i) a first probe comprising SEQ ID NO: 29 and a second probe comprising SEQ ID NO: 32; (ii) a first probe comprising SEQ ID NO: 34 and a second probe comprising SEQ ID NO: 37;(iii) a first probe comprising SEQ ID NO: 39 and a second probe comprising SEQ ID NO: 42;(iv) a first probe comprising SEQ ID NO: 44 and a second probe comprising SEQ ID NO: 47; (v) a first probe comprising SEQ ID NO: 48 and a second probe comprising SEQ ID NO: 49; (vi) aDocket # 212089-WO-SEC-l first probe comprising SEQ ID NO: 54 and a second probe comprising SEQ ID NO: 57; (vii) a first probe comprising SEQ ID NO: 59 and a second probe comprising SEQ ID NO: 62; and / or (viii) a first probe comprising SEQ ID NO: 64 and a second probe comprising SEQ ID NO: 67; and (c) detecting whether one or both probes from each set of the contacted probes bind to the amplicon to thereby determine the zygosity of the one or more SNP allele.

[0025] In each of the foregoing detection methods, the amplicon can be amplified using a (1) a first set of two primers: (i) a first primer comprising SEQ ID NO: 30 and a second primer comprising SEQ ID NO: 31; (ii) a first primer comprising SEQ ID NO: 35 and a second primer comprising SEQ ID NO: 36; (iii) a first primer comprising SEQ ID NO: 40 and a second primer comprising SEQ ID NO: 41; (iv) a first primer comprising SEQ ID NO: 45 and a second primer comprising SEQ ID NO: 46; (v) a first primer comprising SEQ ID NO: 51 and a second primer comprising SEQ ID NO: 52; (vi) a first primer comprising SEQ ID NO: 55 and a second primer comprising SEQ ID NO: 56; (vii) a first primer comprising SEQ ID NO: 60 and a second primer comprising SEQ ID NO: 61; and (viii) a first primer comprising SEQ ID NO: 64 and a second primer comprising SEQ ID NO: 66.

[0026] In an additional aspect, the disclosure provides a method of detecting the presence or absence of an insertion at position 100 of SEQ ID NO: 68 in a plant genome. The method can comprise amplifying genomic DNA containing the insertion at position 100 of SEQ ID NO: 68; to thereby generate an amplicon. The amplicon is then contacted with one or more probes comprising one or more of SEQ ID NOs: 69 or 73. The method includes detecting whether the one or more probes bind to the amplicon to thereby determine the presence or absence of the insertion allele.

[0027] In one example, the detection method comprises detecting the zygosity of the insertion allele at position 100 of SEQ ID NO: 68 in a plant genome. Zygosity can be detected by (a) amplifying genomic DNA containing the insertion at position 100 of SEQ ID NO: 68; to thereby generate an amplicon; (b) contacting the amplicon with a first probe comprising SEQ ID NO: 69 and a second probe comprising SEQ ID NO: 73; and (c) detecting whether one or both probes from each set of the contacted probes bind to the amplicon to thereby determine the zygosity of the insertion allele. The amplicon can be amplified using a a first primer comprising SEQ ID NO: 70 and a second primer comprising SEQ ID NO: 71.Docket # 212089-WO-SEC-l

[0028] In an additional aspect, the disclosure provides method of introgressing a soybean cyst nematode (SCN) resistance gene into a soybean plant, the SCN resistance gene comprising a polynucleotide encoding a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27 comprising crossing an SCN resistant soybean plant comprising a polynucleotide encoding a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27 with a second soybean plant to produce progeny, screening the progeny with a nucleic acid marker to detect progeny comprising a polymorphism genetically linked to the SCN resistance gene, and selecting progeny that comprise the polymorphism to obtain soybean plants that contain the SCN resistance gene.

[0029] In one example of the method of introgressing a SCN resistance gene, the polymorphism is within 20 centimorgan (cM), 15 cM, 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM, or 1 cM of the nucleic acid encoding a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27. In one example of the method of introgressing a SCN resistance gene, the polymorphism is within about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 16 kb, 17 kb, 18 kb, 19 kb, 20 kb, 21 kb, 22 kb, 23 kb, 24 kb, 25 kb, 26 kb, 27 kb, 28 kb, 29 kb, 30 kb, 35 kb, 40 kb, 45 kb, 50 kb, 55 kb, 60 kb, 65 kb, 70 kb, 75 kb, 80 kb, 85 kb, 90 kb, 95 kb, 100 kb, 110 kb, 120 kb, 130 kb, 140 kb, 150 kb, 160 kb, 170 kb, 180 kb, 190 kb, or about 200 kb of the nucleic acid encoding a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27. In one example, the polymorphism is a single nucleotide polymorphism (SNP). In one example, the SNP comprises a a C at S101B38, T at S20009Y, a T at S2000B0, a T at S2000CA, an A at S101B39, a G at S101B3B, a C at S20006E, a C at S20006F, or any combination thereof. In one example, the polymorphism comprises an insertion at S2000CT. In one example, the polymorphism comprises the presence of a polynucleotide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 68.

[0030] In an additional aspect, the disclosure provides methods for producing a soybean plant having increased resistance to SCN, comprising genotyping a soybean population comprising aDocket # 212089-WO-SEC-l plurality of soybean plants or soybean germplasm for the presence of at least one maker genetically linked to a locus comprising or corresponding to an SCN resistance gene encoding a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27, selecting from the soybean population one or more soybean plants or soybean germplasm comprising the at least one marker, and crossing the selected soybean plant or soybean germplasm with a second soybean plant or soybean germplasm to produce a progeny population, wherein at least one soybean plant or soybean germplasm of the progeny population comprises the at least one marker and has increased resistance to SCN as compared to a control plant.

[0031] In one example of the method for producing a soybean plant having increased resistance to SCN, the at least one marker genetically linked to the locus is within 20 cM, 15 cM, 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM, or 1 cM of the locus comprising or corresponding to an SCN resistance gene encoding a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27. In one example of the for producing a soybean plant having increased resistance to SCN the at least one marker genetically linked to the locus is within about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb,13 kb, 14 kb, 15 kb, 16 kb, 17 kb, 18 kb, 19 kb, 20 kb, 21 kb, 22 kb, 23 kb, 24 kb, 25 kb, 26 kb,27 kb, 28 kb, 29 kb, 30 kb, 35 kb, 40 kb, 45 kb, 50 kb, 55 kb, 60 kb, 65 kb, 70 kb, 75 kb, 80 kb,85 kb, 90 kb, 95 kb, 100 kb, 110 kb, 120 kb, 130 kb, 140 kb, 150 kb, 160 kb, 170 kb, 180 kb, 190 kb, or about 200 kb of the nucleic acid encoding a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27. In one example, the marker is selected from the group consisting of a C at S101B38, T at S20009Y, a T at S2000B0, a T at S2000CA, an A at S101B39, a G at S101B3B, a C at S20006E, a C at S20006F, the presence of an insertion at S2000CT, and the presence of a polynucleotide having at least 95% sequence identity to SEQ ID NO: 68. In one example, the genotyping comprises amplifying a nucleic acid sequence comprising the at least one marker and detecting the resulting amplified nucleic acid comprising the marker. In one example, the amplification comprising amplification of at least a portion of one or more genomic regions of the soybean genome comprising SEQ ID NO: 28, 33, 38, 43, 50, 53, 58, 63, or 68. In one example, the amplification comprises providing one or more nucleicDocket # 212089-WO-SEC-l acid primers, wherein the nucleic acid primers comprise the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 30, 31, 35, 36, 40, 41, 45, 46, 51, 52, 55, 56, 60, 61, 64, 66, 70 and 71. In one example, the detecting comprises hybridization with one or more nucleic acid probes, the one or more nucleic acid probes comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 29, 32, 34, 37, 39, 42, 44, 47, 48, 49, 54, 57, 59, 62, 64, 67 and 69.BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[0032] The disclosure can be more fully understood from the following detailed description and the accompanying Sequence Listing, which form a part of this application. The sequence descriptions (Table 1) and sequence listing attached hereto comply with the rules governing nucleotide and amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. §§1.831-1.835.Table 1: Sequence Listing DescriptionDocket # 212089-WO-SEC-lDETAILED DESCRIPTIONTerms

[0033] The term “introgression” refers to the transmission of a desired allele of a genetic locus from one genetic background to another. For example, introgression of a desired allele at a specified locus can be transmitted to at least one progeny via a sexual cross between two parentsDocket # 212089-WO-SEC-l of the same species, where at least one of the parents has the desired allele in its genome. Alternatively, for example, transmission of an allele can occur by recombination between two donor genomes, e.g., in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome. The desired allele can be, e.g., detected by a marker that is associated with a phenotype, at a QTL, a transgene, or the like. Offspring comprising the desired allele may be repeatedly backcrossed to a line having a desired genetic background and selected for the desired allele, to result in the allele becoming fixed in a selected genetic background.

[0034] The process of “introgressing” is often referred to as “backcrossing” when the process is repeated two or more times. Backcrossing methods may be used to introduce a nucleic acid sequence into plants. The backcrossing technique has been widely used for decades to introduce new traits into plants. N. Jensen, Ed., Plant Breeding Methodology, John Wiley & Sons, Inc., 1988. In a typical backcross protocol, the original variety of interest (recurrent parent) is crossed to a second variety (non-recurrent parent) that carries a gene of interest to be transferred. The resulting progeny from this cross are then crossed again to the recurrent parent, and the process is repeated until a plant is obtained wherein essentially all of the desired morphological and physiological characteristics of the recurrent plant are recovered in the converted plant, in addition to the transferred gene from the non-recurrent parent.

[0035] A “locus” is a position on a chromosome, e.g. where a trait nucleotide, gene, sequence, or marker is located.

[0036] A “marker” is a means of finding a position on a genetic or physical map, or else linkages among markers and trait loci (loci affecting traits). The position that the marker detects may be known via detection of polymorphic alleles and their genetic mapping, or else by hybridization, sequence match or amplification of a sequence that has been physically mapped. A marker can be a DNA marker (detects DNA polymorphisms), a protein (detects variation at an encoded polypeptide), or a simply inherited phenotype (such as the ‘waxy’ phenotype). A DNA marker can be developed from genomic nucleotide sequence or from expressed nucleotide sequences (e.g., from a spliced RNA or a cDNA). Depending on the DNA marker technology, the marker may consist of primers complementary to sequence flanking the locus and / or probes that hybridize to polymorphic alleles at the locus. A DNA marker, or a genetic marker, may also be used to describe the gene, DNA sequence or nucleotide on the chromosome itself (rather than the components used to detect the gene or DNA sequence) and is often used when that DNA markerDocket # 212089-WO-SEC-l is associated with a particular trait in human genetics (e g. a marker for breast cancer). The term marker locus is the locus (gene, sequence or nucleotide) that the marker detects.

[0037] “Marker(s)” can refer to the type of polymorphism that they detect and also the marker technology used to detect the polymorphism. Marker types include but are not limited to, e.g., detection of restriction fragment length polymorphisms (RFLP), detection of isozyme markers, randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLPs), detection of simple sequence repeats (SSRs), detection of amplified variable sequences of the plant genome, detection of self-sustained sequence replication, or detection of single nucleotide polymorphisms (SNPs). SNPs can be detected e.g. via DNA sequencing, PCR-based sequence specific amplification methods, detection of polynucleotide polymorphisms by allele specific hybridization (ASH), dynamic allele-specific hybridization (DASH), molecular beacons, microarray hybridization, oligonucleotide ligase assays, Flap endonucleases, 5’ endonucleases, primer extension, single strand conformation polymorphism (SSCP) or temperature gradient gel electrophoresis (TGGE). DNA sequencing, such as the pyrosequencing technology has the advantage of being able to detect a series of linked SNP alleles that constitute a haplotype. Haplotypes tend to be more informative (detect a higher level of polymorphism) than SNPs.

[0038] A “marker allele”, can refer to one of a plurality of polymorphic nucleotide sequences found at a marker locus in a population.

[0039] “Marker assisted selection” (of MAS) is a process by which individual plants are selected based on marker genotypes.

[0040] “Marker assisted counter-selection” is a process by which marker genotypes are used to identify plants that will not be selected, allowing them to be removed from a breeding program or planting. A “marker haplotype” refers to a combination of alleles at a marker locus.

[0041] A “marker locus” is a specific chromosome location in the genome of a species where a specific marker can be found. A marker locus can be used to track the presence of a second linked locus, e.g., one that affects the expression of a phenotypic trait. For example, a marker locus can be used to monitor segregation of alleles at a genetically or physically linked locus.

[0042] The term “molecular marker” may be used to refer to a genetic marker, as defined above, or an encoded product thereof (e.g., a protein) used as a point of reference when identifying a linked locus. A molecular marker can be derived from genomic nucleotide sequences or from expressed nucleotide sequences (e.g., from a spliced RNA, a cDNA, etc.), or from an encodedDocket # 212089-WO-SEC-l polypeptide. The term also refers to nucleic acid sequences complementary to or flanking the marker sequences, such as nucleic acids used as probes or primer pairs capable of amplifying the marker sequence. A “molecular marker probe” is a nucleic acid sequence or molecule that can be used to identify the presence of a marker locus, e.g., a nucleic acid probe that is complementary to a marker locus sequence. Alternatively, in some aspects, a marker probe refers to a probe of any type that is able to distinguish (i.e., genotype) the particular allele that is present at a marker locus. Nucleic acids are “complementary” when they specifically hybridize in solution. Some of the markers described herein are also referred to as hybridization markers when located on an indel region, such as the non-collinear region described herein. This is because the insertion region is, by definition, a polymorphism vis a vis a plant without the insertion. Thus, the marker need only indicate whether the indel region is present or absent. Any suitable marker detection technology may be used to identify such a hybridization marker, e.g. SNP technology is used in the examples provided herein.

[0043] An allele “negatively” correlates with a trait when it is linked to it and when presence of the allele is an indicator that a desired trait or trait form will not occur in a plant comprising the allele.

[0044] In some examples disclosed herein, the presence of a gene allele or marker in a plant may be detected through the use of a nucleic acid probe. A probe may be a DNA molecule or an RNA molecule. RNA probes can be synthesized by means known in the art, for example, using a DNA molecule template. A probe may contain all or a portion of the nucleotide sequence of the marker and additional, contiguous nucleotide sequence from the plant genome. This is referred to herein as a “contiguous probe.” The additional, contiguous nucleotide sequence is referred to as “upstream” or “downstream” of the original marker, depending on whether the contiguous nucleotide sequence from the plant chromosome is on the 5' or the 3' side of the original marker, as conventionally understood. As is recognized by those of ordinary skill in the art, the process of obtaining additional, contiguous nucleotide sequence for inclusion in a marker may be repeated nearly indefinitely (limited only by the length of the chromosome), thereby identifying additional markers along the chromosome. All above-described markers may be used in some embodiments of the disclosed methods.

[0045] An oligonucleotide probe sequence may be prepared synthetically or by cloning. An oligonucleotide probe may be labeled or unlabeled. A variety of techniques exist for labelingDocket # 212089-WO-SEC-l nucleic acid molecules, including, for example and without limitation by adding a composition that is detectable which by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means. Thus, a particular allele may be detected using, for example, autoradiography, fluorography, or other similar detection techniques, depending on the particular label to be detected. Useful detectable labels include biotin (for staining with labeled streptavidin conjugate), magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels. Other detectable labels include ligands that bind to antibodies or specific binding targets labeled with fluorophores, chemiluminescent agents, and enzymes. Labeled probe detection techniques include the use of fluorescent dyes. Examples of fluorescent dyes include HEX fluorescent dye, VIC fluorescent dye, FAM fluorescent dye, JOE fluorescent dye, TET fluorescent dye, Cy 3 fluorescent dye, Cy 3.5 fluorescent dye, Cy 5 fluorescent dye, Cy 5.5 fluorescent dye, Cy 7 fluorescent dye, or ROX fluorescent dye. See generally, e.g., Leary et al. (1983) Proc. Natl. Acad. Sci. USA 80:4045-9.

[0046] A probe may be an exact copy of a marker to be detected. A probe may also be a nucleic acid molecule comprising, or consisting of, a nucleotide sequence which is substantially identical to a cloned segment of the subject organism’s (for example, soybean) chromosomal DNA. As used herein, the term “substantially identical” may refer to nucleotide sequences that are more than 85% identical. For example, a substantially identical nucleotide sequence may be 85.5%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% identical to the reference sequence.

[0047] “Marker-assisted selection” (MAS) is a process by which phenotypes are selected based on marker genotypes. Marker assisted selection includes the use of marker genotypes for identifying plants for inclusion in and / or removal from a breeding program or planting.

[0048] Molecular marker technologies generally increase the efficiency of plant breeding through MAS. A molecular marker allele that demonstrates linkage disequilibrium with a desired phenotypic trait (e.g., a SCN resistance described herein) provides a useful tool for the selection of the desired trait in a plant population. The key components to the implementation of an MAS approach are the creation of a dense (information rich) genetic map of molecular markers in the plant germplasm; the detection of at least one QTL based on statistical associations between marker and phenotypic variability; the definition of a set of particular useful marker alleles basedDocket # 212089-WO-SEC-l on the results of the QTL analysis; and the use and / or extrapolation of this information to the current set of breeding germplasm to enable marker-based selection decisions to be made.

[0049] The closer a particular marker is to a gene that encodes a polypeptide that contributes to a particular phenotype (whether measured in terms of genetic or physical distance), the more tightly-linked is the particular marker to the phenotype. In view of the foregoing, it will be appreciated that the closer (whether measured in terms of genetic or physical distance) that a marker is linked to a particular gene, the more likely the marker is to segregate with that gene and its associated phenotype. Thus, the genetic markers disclosed herein can be used in MAS programs to identity plants (e.g., soybean) that have or can generate progeny that have increased SCN resistance (when compared to parental varieties and / or otherwise isogenic plants lacking the SCN resistance genotype), to identify individual plants comprising this increased SCN trait, and to breed this trait into other plant varieties to improve their SCN resistance.

[0050] A “marker set” or a “set” of markers or probes refers to a specific collection of markers (or data derived therefrom) that may be used to identify individuals comprising a trait of interest. While each marker in a marker set may possess utility with respect to trait identification, individual markers selected from the set and subsets including some, but not all, of the markers may also be effective in identifying individuals comprising the trait of interest.

[0051] A “modified gene” is a gene that has been altered through human intervention. Such a “modified” gene has a nucleic acid sequence that differs from the sequence of the corresponding non-mutated gene by at least one nucleotide addition, deletion, or substitution. The modified gene can be altered by introducing one or more double strands break which are specifically targeted to a genomic sequence by a targeted nuclease using TALEN, meganuclease, zinc finger nuclease, or CRISPR-Cas technology.

[0052] As used herein, the term “heterologous” in reference to a nucleic acid means a nucleic acid sequence that originates from a foreign species or, if from the same species, is substantially modified from its native form in composition and / or genomic locus by deliberate human intervention. For example, as used herein, a “heterologous” gene can refer to a gene sequence (that is the same or only minimally altered) as the native gene, but which has been deliberately inserted at a genomic locus that differs from the native gene’s locus. Where the promoter is a native or natural sequence, the expression of the operably linked sequence can be altered from the wild-type expression, which results in an alteration in phenotype.Docket # 212089-WO-SEC-l

[0053] A “modified” plant is a plant comprising a mutated gene or a heterologous nucleic acid.

[0054] As used herein the term “native gene” refers to a gene as found in its natural endogenous location with its own regulatory sequences. In the context of this disclosure, a “transgenic”, “mutated”, “modified” gene is not a native gene.

[0055] As used herein, a “nucleic acid” or “nucleic acid molecule” is a polymeric form of nucleotides, which can include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide, or a modified form of either type of nucleotide. A “nucleic acid molecule” as used herein is synonymous with “nucleic acid”, “nucleotide sequence”, “nucleic acid sequence”, and “polynucleotide.” The term includes single- and double-stranded forms of DNA. A nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotide linkages.

[0056] Nucleic acid molecules may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e g., peptides), intercalators (e.g., acridine, psoralen, etc ), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). The term “nucleic acid molecule” also includes any topological conformation, including single-stranded, doublestranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations. An “endogenous nucleic acid sequence” refers to a nucleic acid sequence within a plant cell, (e.g. an endogenous allele of an cqSCN005 gene present within the genome of a soybean plant cell).

[0057] The term “single-nucleotide polymorphism” (SNP) refers to a DNA sequence variation occurring when a single nucleotide in the genome (or other shared sequence) differs between members of a species or paired chromosomes in an individual. High-throughput genotyping technologies such as GoldenGate® and INFINIUM® assays (Illumina, San Diego, CA) may be used in accurate and quick genotyping methods by multiplexing SNPs from 384-plex to >100,000-plex assays per sample.Docket # 212089-WO-SEC-l

[0058] As used herein, “phenotype” means the detectable characteristics (e.g. SCN susceptibility or SCN resistance) of a cell or organism which can be influenced by genotype.

[0059] As used herein, the term “plant material” refers to any processed or unprocessed material derived, in whole or in part, from a plant. For example, and without limitation, a plant material may be a plant part, a seed, a fruit, a leaf, a root, a plant tissue, a plant tissue culture, a plant explant, or a plant cell.

[0060] As used herein "percent (%) sequence identity" with respect to a reference sequence (subject) is determined as the percentage of amino acid residues or nucleotides in a candidate sequence (query) that are identical with the respective amino acid residues or nucleotides in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any amino acid conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (e.g., percent identity of query sequence = number of identical positions between query and subject sequences / total number of positions of query sequence * 100).

[0061] Unless otherwise stated, sequence identity / similarity values provided herein refer to the value obtained using the BLAST 2.0 suite of programs using default parameters (Altschul, et al., (1997) Nucleic Acids Res. 25:3389-402).

[0062] The terms “trait” and “phenotype” are used interchangeably herein. For the purposes of the present disclosure, a trait of particular interest is SCN resistance.Markers linked to SCN resistance trait

[0063] Markers may be selected that are physically located in, near, or between on or more of the genomic sequences corresponding to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, or 9. For example, polymorphic markers among parental soybean lines are selected to screen SCN resistance mapping populations to determine which, if any, of the polymorphic markers are linked to the SCN resistance trait. Such markers may segregate so that one allele of the SNPDocket # 212089-WO-SEC-l marker appears exclusively in SCN resistant individuals, and the other allele of the SNP marker appears exclusively in SCN susceptible individuals. Mapping populations may be generated by crossing one variety that is SCN resistant with another variety that is SCN susceptible. In embodiments, a mapping population may comprise about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 95, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, or more individuals. In some embodiments, SCN resistant soybean plant may be crossed with one or more SCN susceptible plant(s) to create mapping populations.

[0064] In some embodiments, the polymorphic markers may be single nucleotide polymorphisms (SNPs) linked to or within the genomic sequence corresponding to the SCN resistance trait of interest. These SNP markers may be detected by sequencing through the region containing the gene or QTL using any DNA sequencing methods known in the art, including but not limited to Sanger sequencing or high throughput sequencing (“Next Generation”) methodologies that enable short or long sequence reads through the region of interest. In such embodiments, where genotyping by sequencing is used for the detection of SNP markers, primers corresponding to the flanking sequences of the region containing the SNPs in gene or QTL of interest may be used for the sequencing chemistries in order to sequence through the region of interest. In such embodiments, when different genotypes are used for sequencing through the region of interest for the detection of SNPs exemplified herein, other SNPs may be identified in addition to the SNPs exemplified herein. In such embodiments, the SNPs exemplified herein by themselves (individual SNPs) or in combination with other SNPs linked to exemplified sequences (haplotypes) may be utilized for differentiating genotypes towards marker assisted selection of plants for the SCN resistance trait of interest.Primer design and linkage screening

[0065] Oligonucleotide probes (e.g., primers) may be designed to specifically detect markers that are physically located in, near, genomic sequences corresponding to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, or 9. In general, an oligonucleotide probe may be designed that specifically hybridizes to only one allele of a marker. In some cases, two oligonucleotide probes are designed to detect an SNP marker, such that each specifically hybridizes to the SNP allele to which the other probe does not specifically hybridize. As is understood by those of skill in the art, theDocket # 212089-WO-SEC-l length or composition of oligonucleotide probes for a particular marker may be varied according to established principles without rendering the probe non-specific for one allele of the marker.

[0066] In some examples, oligonucleotide probes may be primers. In specific examples, primers may be designed to detect markers in a KASPar™ genotyping assay. In particular, primers may be designed to detect markers linked to the SCN resistance phenotype in soybean using a KASPar™ genotyping assay. In these and further embodiments, the detection system may provide a high-throughput and convenient format for genotyping individuals in a mapping population, which may greatly facilitate the identification of individuals carrying a particular gene or trait and may also greatly facilitate the implementation or execution of a marker-assisted selection program.

[0067] In specific embodiments, the oligonucleotide probes may be primers designed to detect markers in a TAQMAN® genotyping assay. This method utilizes primers specific to the marker closely linked to the SCN resistance gene and fluorescent labeled probes containing a single nucleotide polymorphism (SNP). The SNP probe associated with resistance is labeled with a fluorescent dye such as FAM while the probe associated with susceptibility is labeled with a different fluorescent dye such as VIC. The data is analyzed as the presence or absence of a fluorescent dye signal. The detection system may provide a high-throughput and convenient format, such as multiplexing for genotyping individuals in a mapping population, which may greatly facilitate the identification of individuals carrying a particular gene or trait and may also greatly facilitate the implementation or execution of a marker-assisted selection program.

[0068] Additional markers may be identified as equivalent to any of the exemplary markers named herein (e.g., markers listed in Table 3 herein), for example, by determining the frequency of recombination between the exemplary marker and an additional marker. Such determinations may utilize a method of orthogonal contrasts based on the method of Mather (1931), The Measurement of Linkage in Heredity, Methuen & Co., London, followed by a test of maximum likelihood to determine a recombination frequency. Allard (1956) Hilgardia 24:235-78. If the value of the recombination frequency is less than or equal to 0.10 (i.e., 10%), then the additional marker is considered equivalent to the particular exemplary marker for the purposes of use in the presently disclosed methods.

[0069] Markers that are linked to any and all SCN resistance genes may be identified in embodiments of the invention. Further, markers that control any and all of resistanceDocket # 212089-WO-SEC-l contributing loci for all SCN HG races may be identified in embodiments of the invention. For example, a means for providing SCN resistance in soybean is a marker selected from the group consisting of the markers listed in Table 3.

[0070] A means for identifying soybean plants having the SCN resistance phenotype may be a molecule that presents a detectable signal when added to a sample that includes the marker sequence, e.g., a probe with a detectable label that specifically hybridizes to an SNP marker allele that is linked to the SCN resistance phenotype may be a means for identifying soybean plants having the SCN resistance phenotype. In some examples, a means for identifying soybean plants having the SCN resistance phenotype is a probe that specifically hybridizes to a marker that is linked to the SCN resistance phenotype.Marker assisted selection

[0071] Molecular markers can be used in a variety of plant breeding applications (e.g. see Staub et al. (1996) Hortscience 31 :729-41; Tanksley (1983) Plant Molecular Biology Reporter. 1 : 3-8). One of the main areas of interest is to increase the efficiency of backcrossing and introgressing genes using marker-assisted selection (MAS). A molecular marker that demonstrates linkage with a locus affecting a desired phenotypic trait provides a useful tool for the selection of the trait in a plant population. This is particularly true where the phenotype is hard to assay. Since DNA marker assays are less laborious and take up less physical space than field phenotyping, much larger populations can be assayed, increasing the chances of finding a recombinant with the target segment from the donor line moved to the recipient line. The closer the linkage, the more useful the marker, as recombination is less likely to occur between the marker and the gene causing the trait, which can result in false positives. Having flanking markers decreases the chances that false positive selection will occur as a double recombination event would be needed. In the most preferred case, a marker is located within the gene itself, so that recombination cannot occur between the marker and the gene. In some embodiments, the methods disclosed herein produce a marker in a disease resistance gene, wherein the gene was identified by inferring genomic location from clustering of conserved domains or a clustering analysis.

[0072] When a gene is introgressed by MAS, it is not only the gene that is introduced but also the flanking regions (Gepts. (2002). Crop Ser, 42: 1780-1790). This is referred to as “linkage drag.”Docket # 212089-WO-SEC-lIn the case where the donor plant is highly unrelated to the recipient plant, these flanking regions carry additional genes that may code for agronomically undesirable traits. Linkage drag may also result in reduced yield or other negative agronomic characteristics even after multiple cycles of backcrossing into the elite line. This is also sometimes referred to as “yield drag.” The size of the flanking region can be decreased by additional backcrossing, although this is not always successful, as breeders do not have control over the size of the region or the recombination breakpoints (Young et al. (1998) Genetics 120:579-585). In classical breeding it is usually only by chance that recombinations are selected that contribute to a reduction in the size of the donor segment (Tanksley et al. (1989). Biotechnology 7: 257-264). Even after 20 backcrosses in backcrosses of this type, one may expect to find a sizeable piece of the donor chromosome still linked to the gene being selected. With markers however, it is possible to select those rare individuals that have experienced recombination near the gene of interest. In 150 backcross plants, there is a 95% chance that at least one plant will have experienced a crossover within 1 cM of the gene, based on a single meiosis map distance. Markers will allow unequivocal identification of those individuals. With one additional backcross of 300 plants, there would be a 95% chance of a crossover within 1 cM single meiosis map distance of the other side of the gene, generating a segment around the target gene of less than 2 cM based on a single meiosis map distance. This can be accomplished in two generations with markers, while it would have required on average 100 generations without markers (See Tanksley et al., supra). When the exact location of a gene is known, flanking markers surrounding the gene can be utilized to select for recombinations in different population sizes. For example, in smaller population sizes, recombinations may be expected further away from the gene, so more distal flanking markers would be required to detect the recombination.

[0073] The key components to the implementation of MAS are: (i) Defining the population within which the marker-trait association will be determined, which can be a segregating population, or a random or structured population; (ii) monitoring the segregation or association of polymorphic markers relative to the trait, and determining linkage or association using statistical methods; (iii) defining a set of desirable markers based on the results of the statistical analysis, and (iv) the use and / or extrapolation of this information to the current set of breeding germplasm to enable marker-based selection decisions to be made. The markers described in thisDocket # 212089-WO-SEC-l disclosure, as well as other marker types such as SSRs and FLPs, can be used in marker assisted selection protocols.

[0074] SSRs can be defined as relatively short runs of tandemly repeated DNA with lengths of 6 bp or less (Tautz (1989) Nucleic Acid Research VT. 6463-6471; Wang et al. (1994) Theoretical and Applied Genetics, 88: 1-6). Polymorphisms arise due to variation in the number of repeat units, probably caused by slippage during DNA replication (Levinson and Gutman (1987) Mol Biol Evol 4: 203-221). The variation in repeat length may be detected by designing PCR primers to the conserved non-repetitive flanking regions (Weber and May (1989) Am J Hum Genet. 44:388-396). SSRs are highly suited to mapping and MAS as they are multi-allelic, codominant, reproducible and amenable to high throughput automation (Rafalski et al. (1996) Generating and using DNA markers in plants. In: Non-mammalian genomic analysis: apractical guide. Academic press, pp 75-135).

[0075] Various types of SSR markers can be generated, and SSR profiles can be obtained by gel electrophoresis of the amplification products. Scoring of marker genotype is based on the size of the amplified fragment.

[0076] Various types of FLP markers can also be generated. Most commonly, amplification primers are used to generate fragment length polymorphisms. Such FLP markers are in many ways similar to SSR markers, except that the region amplified by the primers is not typically a highly repetitive region. Still, the amplified region, or amplicon, will have sufficient variability among germplasm, often due to insertions or deletions, such that the fragments generated by the amplification primers can be distinguished among polymorphic individuals, and such indels are known to occur frequently in maize (Bhattramakki et al. (2002). Plant Mol Biol 48, 539-547; Rafalski (2002b), supra).

[0077] SNP markers detect single base pair nucleotide substitutions. Of all the molecular marker types, SNPs are the most abundant, thus having the potential to provide the highest genetic map resolution (Bhattramakki et al. 2002 Plant Molecular Biology 48:539-547). SNPs can be assayed at an even higher level of throughput than SSRs, in a so-called 'ultra-high-throughpuf fashion, as SNPs do not require large amounts of DNA and automation of the assay may be straightforward. SNPs also have the promise of being relatively low-cost systems. These three factors together make SNPs highly attractive for use in MAS. Several methods are available for SNP genotyping, including but not limited to, hybridization, primer extension, oligonucleotideDocket # 212089-WO-SEC-l ligation, nuclease cleavage, mini sequencing, and coded spheres. Such methods have been reviewed in: Gut (2001) Hum Mutat 17 pp. 475-492; Shi (2001) Clin Chem 47, pp. 164-172; Kwok (2000) Pharmacogenomics 1, pp. 95-100; and Bhattramakki and Rafalski (2001) Discovery and application of single nucleotide polymorphism markers in plants. In: R. J. Henry, Ed, Plant Genotyping: The DNA Fingerprinting of Plants, CABI Publishing, Wallingford. A wide range of commercially available technologies utilize these and other methods to interrogate SNPs including Masscode. TM. (Qiagen), INVADER®. (Third Wave Technologies) and Invader PLUS®, SNAPSHOT®. (Applied Biosystems), TAQMAN®. (Applied Biosystems) and BEAD ARRAYS®. (Illumina).

[0078] A number of SNPs together within a sequence, or across linked sequences, can be used to describe a haplotype for any particular genotype (Ching et al. (2002), BMC Genet. 3: 19 pp Gupta et al. 2001, Rafalski (2002b), Plant Science 162:329-333). Haplotypes can be more informative than single SNPs and can be more descriptive of any particular genotype. For example, a single SNP may be allele “T' for a specific line or variety with disease resistance, but the allele T' might also occur in the breeding population being utilized for recurrent parents. In this case, a haplotype, e.g. a combination of alleles at linked SNP markers, may be more informative. Once a unique haplotype has been assigned to a donor chromosomal region, that haplotype can be used in that population or any subset thereof to determine whether an individual has a particular gene. Using automated high throughput marker detection platforms makes this process highly efficient and effective.

[0079] Single nucleotide polymorphic (SNP) markers can be used to select for the nucleic acid disclosed herein that is associated with SCN resistance, e.g., nucleic acid that (i) encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1-9. Using PCR, the primers are used to amplify DNA segments from individuals (preferably inbred) that represent the diversity in the population of interest. The PCR products are sequenced directly in one or both directions. TheDocket # 212089-WO-SEC-l resulting sequences are aligned and polymorphisms are identified. The polymorphisms are not limited to single nucleotide polymorphisms (SNPs), but also include indels, CAPS, SSRs, and VNTRs (variable number of tandem repeats). Specifically, with respect to the fine map information described herein, one can readily use the information provided herein to obtain additional polymorphic SNPs (and other markers) within the region amplified by the primers disclosed herein. Markers within the described map region can be hybridized to BACs or other genomic libraries, or electronically aligned with genome sequences, to find new sequences in the same approximate location as the described markers.

[0080] In addition to SSR's, FLPs and SNPs, as described above, other types of molecular markers are also widely used, including but not limited to expressed sequence tags (ESTs), SSR markers derived from EST sequences, randomly amplified polymorphic DNA (RAPD), and other nucleic acid-based markers.

[0081] Isozyme profiles and linked morphological characteristics can, in some cases, also be indirectly used as markers. Even though they do not directly detect DNA differences, they are often influenced by specific genetic differences. However, markers that detect DNA variation are far more numerous and polymorphic than isozyme or morphological markers (Tanksley (1983) Plant Molecular Biology Reporter 1 :3-8).

[0082] Sequence alignments or contigs may also be used to find sequences upstream or downstream of the specific markers listed herein. These new sequences, close to the markers described herein, are then used to discover and develop functionally equivalent markers. For example, different physical and / or genetic maps are aligned to locate equivalent markers not described within this disclosure but that are within similar regions. These maps may be within the species, or even across other species that have been genetically or physically aligned.

[0083] In general, MAS uses polymorphic markers that have been identified as having a significant likelihood of co-segregation with a trait such as the SCN resistance trait. Such markers are presumed to map near a gene or genes that give the plant its disease or pest resistant phenotype, and are considered indicators for the desired trait, or markers. Plants are tested for the presence of a desired allele in the marker, and plants containing a desired genotype at one or more loci are expected to transfer the desired genotype, along with a desired phenotype, to their progeny. Thus, plants with SCN resistance may be selected for by detecting one or more marker alleles, and in addition, progeny plants derived from those plants can also be selected. Hence, aDocket # 212089-WO-SEC-l plant containing a desired genotype in a given chromosomal region (i.e. a genotype associated with disease or pest resistance) is obtained and then crossed to another plant. The progeny of such a cross would then be evaluated genotypically using one or more markers and the progeny plants with the same genotype in a given chromosomal region would then be selected as having disease or pest resistance.

[0084] The SNPs could be used alone or in combination (i.e. a SNP haplotype) to select for a favorable resistant gene allele associated with SCNresistance. For example, a SNP haplotype can include a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 of markers for the nucleic acid disclosed herein which (i) encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1- 9.

[0085] There may be additional polymorphic sites at marker loci in and around a ri den tilled by the methods disclosed herein, wherein one or more polymorphic sites is in linkage disequilibrium (LD) with an allele at one or more of the polymorphic sites in the haplotype and thus could be used in a marker assisted selection program to introgress a gene allele or genomic fragment of interest. Two particular alleles at different polymorphic sites are said to be in LD if the presence of the allele at one of the sites tends to predict the presence of the allele at the other site on the same chromosome (Stevens, Mol. Diag. 4:309-17 (1999)). The marker loci can be located within 20 cM, 15 cM, 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM, or 1 cM (on a single meiosis based genetic map) of the SCN resistance trait QTL.

[0086] Allelic frequency (and hence, haplotype frequency) can differ from one germplasm pool to another. Germplasm pools vary due to maturity differences, heterotic groupings, geographical distribution, etc. As a result, SNPs and other polymorphisms may not be informative in some germplasm pools.Recombinant Nucleic Acid Molecules, Variants and Fragments ThereofDocket # 212089-WO-SEC-l

[0087] Provided herein are isolated or recombinant nucleic acid molecules comprising a nucleic acid sequence encoding a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27. Also provided herein are isolated or recombinant nucleic acid molecules comprising a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1-18. Also provided are nucleic acids encoding biologically active portions of a polypeptide having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27. Additionally provided are nucleic acid molecules sufficient for use as hybridization probes to identify nucleic acid molecules encoding proteins with regions of sequence homology are provided. As used herein, the term “nucleic acid molecule” refers to DNA molecules (e.g., recombinant DNA, cDNA, genomic DNA, plastid DNA, mitochondrial DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. In some examples, the nucleic acid molecule can be single-stranded. In some examples, the nucleic acid molecule can be double-stranded.

[0088] An “isolated” nucleic acid molecule (e.g., RNA or DNA) is used herein to refer to a nucleic acid sequence (e.g., RNA or DNA) that is no longer in its natural environment, for example in vitro. A “recombinant” nucleic acid molecule (e.g., RNA or DNA) is used herein to refer to a nucleic acid sequence (e g., RNA or DNA) that is in a recombinant bacterial or plant host cell; has been edited from its native sequence; or is located in a different location than the native sequence. In some embodiments, an “isolated” or “recombinant” nucleic acid is free of sequences (preferably protein encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For purposes of the disclosure, “isolated” or “recombinant” when used to refer to nucleic acid molecules excludes isolated chromosomes. For example, in various embodiments, the recombinant nucleic acid molecules encoding a SCN resistant gene allele can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleic acid sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.Docket # 212089-WO-SEC-l

[0089] In some embodiments, an isolated nucleic acid molecule encodes the polypeptide of SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27 that has one or more changes in the nucleic acid sequence compared to the native or genomic nucleic acid sequence. In some embodiments, the change in the native or genomic nucleic acid sequence includes but is not limited to: changes in the nucleic acid sequence due to the degeneracy of the genetic code; changes in the nucleic acid sequence due to the amino acid substitution, insertion, deletion and / or addition compared to the native or genomic sequence; removal of one or more intron; deletion of one or more upstream or downstream regulatory regions; and deletion of the 5’ and / or 3’ untranslated region associated with the genomic nucleic acid sequence. In some embodiments, the nucleic acid molecule encoding SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27 is a non-genomic sequence.

[0090] A variety of polynucleotides that encode SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27 or related proteins are contemplated. Such polynucleotides are useful for production of this polypeptide in host cells when operably linked to a suitable promoter, transcription termination and / or polyadenylation sequences. Such polynucleotides are also useful as probes for isolating homologous or substantially homologous polynucleotides that encode SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27 or related proteins.

[0091] Provided herein are nucleic acid molecules associated with SCN resistance. Such a nucleic acids can have the sequence set forth in SEQ ID NOs: 1-18, and variants, fragments and complements thereof. “Complement” is used herein to refer to a nucleic acid sequence that is sufficiently complementary to a given nucleic acid sequence such that it can hybridize to the given nucleic acid sequence to thereby form a stable duplex. A reverse complement is a complement formed by exchanging each A with T, T with A, C with G, and G with C in a sequence and then reversing the 5’ to 3’ order of the exchanged sequence, such that the reverse complement of 5’-ACCTGAG-3’ is 5’-CTCAGGT-3’. “Polynucleotide sequence variants” is used herein to refer to a nucleic acid sequence that except for the degeneracy of the genetic code encodes the same polypeptide.

[0092] In some examples, the nucleic acid molecule encoding the polypeptide of SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, or 27 is a non-genomic nucleic acid sequence. As used herein a “non-genomic nucleic acid sequence” or “non-genomic nucleic acid molecule” or “non-genomic polynucleotide” refers to a nucleic acid molecule that has one or more change in the nucleic acid sequence compared to a native or genomic nucleic acid sequence. In some examples, the changeDocket # 212089-WO-SEC-l to a native or genomic nucleic acid molecule includes but is not limited to: changes in the nucleic acid sequence due to the degeneracy of the genetic code; optimization of the nucleic acid sequence for expression in plants; changes in the nucleic acid sequence to introduce at least one amino acid substitution, insertion, deletion and / or addition compared to the native or genomic sequence; removal of one or more intron associated with the genomic nucleic acid sequence; insertion of one or more heterologous introns; deletion of one or more upstream or downstream regulatory regions associated with the genomic nucleic acid sequence; insertion of one or more heterologous upstream or downstream regulatory regions; deletion of the 5’ and / or 3’ untranslated region associated with the genomic nucleic acid sequence; insertion of a heterologous 5’ and / or 3’ untranslated region; and modification of a polyadenylation site. In some examples, the non-genomic nucleic acid molecule is a synthetic nucleic acid sequence.

[0093] Examples of a recombinant nucleic acid molecule provided herein include those associated with and capable of conferring SCN resistance when expressed in a plant, e.g., improved SCN resistance relative to an isogenic or near-isogenic plant lacking the recombinant nucleic acid molecule and (i) encoding a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprising a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprising a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1-9.

[0094] Nucleic acid molecules that are fragments of these nucleic acid sequences are also encompassed by the disclosure. A fragment of a nucleic acid sequence may encode a biologically active portion of the encoded polypeptide or it may be a fragment that can be used as a hybridization probe or PCR primer. Nucleic acid molecules that are fragments can comprise at least about 150, 180, 210, 240, 270, 300, 330, 360, 400, 450, or 500 contiguous nucleotides or up to the number of nucleotides present in a full-length nucleic acid sequence encoding any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27. “Contiguous nucleotides” is used herein to refer to nucleotide residues that are immediately adjacent to one another. Fragments of the nucleic acid sequences will encode protein fragments that retain the biological activity of theDocket # 212089-WO-SEC-l full-length polypeptide and, hence, retain SCN resistance. “Retains SCN resistance” is used herein to refer to a polypeptide having at least about 10%, at least about 30%, at least about 50%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more of the SCN resistance of the full-length polypeptide.

[0095] The skilled artisan will further appreciate that changes can be introduced by mutation of the nucleic acid sequences thereby leading to changes in the amino acid sequence of the encoded polypeptides of any of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, without altering the biological activity of the proteins. Thus, variant nucleic acid molecules can be created by introducing one or more nucleotide substitutions, additions and / or deletions into the corresponding nucleic acid sequence disclosed herein, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Such variant nucleic acid sequences are also encompassed by the present disclosure.

[0096] Alternatively, variant nucleic acid sequences can be made by introducing mutations randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for ability to confer activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombinantly, and the activity of the protein can be determined using standard assay techniques.

[0097] The polynucleotides of the disclosure and fragments thereof are optionally used as substrates for a variety of recombination and recursive recombination reactions, in addition to standard cloning methods as set forth in, e.g., Ausubel, Berger and Sambrook, i.e., to produce additional polypeptide homologues and fragments thereof with desired properties. A variety of such reactions are known. Methods for producing a variant of any nucleic acid listed herein comprising recursively recombining such polynucleotide with a second (or more) polynucleotide, thus forming a library of variant polynucleotides are also examples of the disclosure, as are the libraries produced, the cells comprising the libraries and any recombinant polynucleotide produced by such methods. Additionally, such methods optionally comprise selecting a variant polynucleotide from such libraries based on activity, as is wherein such recursive recombination is done in vitro or in vivo.Docket # 212089-WO-SEC-l

[0098] A variety of diversity generating protocols, including nucleic acid recursive recombination protocols are available. The procedures can be used separately, and / or in combination to produce one or more variants of a nucleic acid or set of nucleic acids, as well as variants of encoded proteins. Individually and collectively, these procedures provide robust, widely applicable ways of generating diversified nucleic acids and sets of nucleic acids (including, e.g., nucleic acid libraries) useful, e.g., for the engineering or rapid evolution of nucleic acids, proteins, pathways, cells and / or organisms with new and / or improved characteristics.

[0099] While distinctions and classifications are made in the course of the ensuing discussion for clarity, it will be appreciated that the techniques are often not mutually exclusive. Indeed, the various methods can be used singly or in combination, in parallel or in series, to access diverse sequence variants.

[0100] The result of any of the diversity generating procedures described herein can be the generation of one or more nucleic acids, which can be selected or screened for nucleic acids with, or which confer, desirable properties or that encode proteins with, or which confer, desirable properties. Following diversification by one or more of the methods herein or otherwise available to one of skill, any nucleic acids that are produced can be selected for a desired activity or property, e.g. such activity at a desired pH, etc. This can include identifying any activity that can be detected, for example, in an automated or automatable format, by any of the assays in the art. A variety of related (or even unrelated) properties can be evaluated, in serial or in parallel, at the discretion of the practitioner.

[0101] The nucleotide sequences disclosed herein can also be used to isolate corresponding sequences from a different source. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences identified by the methods disclosed herein. Sequences that are selected based on their sequence identity to the entire sequences set forth herein or to fragments thereof are encompassed by the disclosure. Such sequences include sequences that are orthologs of the sequences. The term “orthologs” refers to genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and / or their encoded protein sequences share substantial identity as defined elsewhere herein.Docket # 212089-WO-SEC-l

[0102] In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York), hereinafter “Sambrook”. See also, Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially- mismatched primers, and the like.

[0103] In hybridization methods, all or part of the nucleic acid sequence can be used to screen cDNA or genomic libraries. Methods for construction of such cDNA and genomic libraries are disclosed in Sambrook and Russell (2001), supra. The so-called hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments or other oligonucleotides and may be labeled with a detectable group such as32P or any other detectable marker, such as other radioisotopes, a fluorescent compound, an enzyme or an enzyme co-factor. Probes for hybridization can be made by labeling synthetic oligonucleotides based on the known polypeptide-encoding nucleic acid sequences disclosed herein. Degenerate primers designed on the basis of conserved nucleotides or amino acid residues in the nucleic acid sequence or encoded amino acid sequence can additionally be used. The probe typically comprises a region of nucleic acid sequence that hybridizes under stringent conditions to at least about 12, at least about 25, at least about 50, 75, 100, 125, 150, 175 or 200 consecutive nucleotides of nucleic acid sequences encoding polypeptides or a fragment or variant thereof. Methods for the preparation of probes for hybridization and stringency conditions are disclosed in Sambrook and Russell (2001), supra.Nucleotide Constructs, Expression Cassettes and Vectors

[0104] The use of the term “construct” in connection with isolated and / or heterologous polynucleotides herein is not intended to limit the disclosure to constructs comprising DNA. Polynucleotide constructs, particularly polynucleotides and oligonucleotides composed ofDocket # 212089-WO-SEC-l ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides, may also be employed in the methods disclosed herein. The isolated polynucleotide constructs, nucleic acids, and nucleotide sequences disclosed herein additionally encompass all complementary forms (e.g., the reverse complement) of each sequence disclosed for such a construct. Further, polynucleotide constructs and nucleotide sequences disclosed herein can encompass any such constructs, molecules, and sequences suitable for use in a method for transforming plant material disclosed herein. Such constructs can include naturally occurring molecules and / or synthetic analogues. The disclosed nucleotide constructs, nucleic acids, and nucleotide sequences also encompass all forms of nucleotide constructs including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures and the like.

[0105] Transformed organisms disclosed herein include plant cells, bacteria, yeast, baculovirus, protozoa, nematodes and algae. The transformed organism comprises a disclosed sequence (e.g., as part of a construct, expression cassette, or vector comprising the nucleotide sequence disclosed herein which are associated with SCN resistance.

[0106] The disclosed sequences can be used in constructs for expression in the plant of interest, e.g. soybean. Constructs can include 5’ and 3’; regulatory sequences operably linked to a coding sequence for a nucleic acid that encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27. The term “operably linked” as used herein refers to a functional linkage between a promoter and / or a regulatory sequence and a second sequence, wherein the promoter and / or regulatory sequence initiates, mediates, and / or affects transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary, to join two protein coding regions in the same reading frame. The construct may additionally contain at least one additional gene to be cotransformed into the organism.Alternatively, the additional gene(s) can be provided on multiple DNA constructs.

[0107] Such a DNA construct is provided with a plurality of restriction sites for insertion of the polypeptide gene sequence of the disclosure to be under the transcriptional regulation of the regulatory regions. The DNA construct may additionally contain selectable marker genes.

[0108] The DNA construct will generally include in the 5' to 3' direction of transcription: a transcriptional and translational initiation region (e.g., a promoter), a DNA sequence of theDocket # 212089-WO-SEC-l embodiments, and a transcriptional and translational termination region (e.g., termination region) functional in the organism serving as a host. The transcriptional initiation region (e.g., the promoter) may be native, analogous, foreign or heterologous to the host organism and / or to the sequence of the embodiments. Additionally, the promoter or regulatory sequence may be the natural sequence or alternatively a synthetic sequence. The term “foreign” as used herein indicates that the promoter is not found in the native organism into which the promoter is introduced. As used herein, the term “heterologous” in reference to a sequence means a sequence that originates from a foreign species or, if from the same species, is substantially modified from its native form in composition and / or genomic locus by deliberate human intervention. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence. Where the promoter is a native or natural sequence, the expression of the operably linked sequence is altered from the wild-type expression, which results in an alteration in phenotype.

[0109] In some embodiments the DNA construct comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1-18. In some embodiments the DNA construct comprises a polynucleotide encoding a fusion protein, one part of the fusion protein comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27.

[0110] In some examples, the DNA construct may also include a transcriptional enhancer sequence. As used herein, the term an “enhancer” refers to a DNA sequence which can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Various enhancers include, for example, introns with gene expression enhancing properties in plants (US Patent Application Publication Number 2009 / 0144863, the ubiquitin intron (i.e., the maize ubiquitin intron 1 (see, for example, NCBI sequence S94464)), the omega enhancer or the omega prime enhancer (Gallie et al. (1989) Molecular Biology) ofRNA ed. Cech (Liss, New York) 237-256 and Gallie et al. (1987) Gene 60:217-25), the CaMV 35S enhancer (see, e.g., Benfey et al. (1990) EMBO J. 9: 1685-96) and the enhancers of US Patent Number 7,803,992 may also be used. The above listDocket # 212089-WO-SEC-l of transcriptional enhancers is not meant to be limiting. Any appropriate transcriptional enhancer can be used in the embodiments.

[0111] The termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest, may be native with the plant host or may be derived from another source (i.e., foreign or heterologous to the promoter, the sequence of interest, the plant host or any combination thereof).

[0112] Convenient termination regions are available from the Ti-plasmid of A. tumefaciens. such as the octopine synthase and nopaline synthase termination regions. See also, Guerineau et al.(1991) Mol. Gen. Genet. 262: 141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5: 141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91 : 151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903 and Joshi et al. (1987) Nucleic AcidRes. 15:9627-9639.

[0113] Where appropriate, a nucleic acid may be optimized for increased expression in the host organism. Thus, where the host organism is a plant, the synthetic nucleic acids can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred usage. For example, although nucleic acid sequences of the embodiments may be expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific preferences and GC content preferences of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray et al. (1989) Nucleic Acids Res. 17:477-498).Thus, the plant-preferred for a particular amino acid may be derived from known gene sequences from plants.

[0114] Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exonintron splice site signals, transposon-like repeats, and other well -characterized sequences that may be deleterious to gene expression. The GC content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. The term “host cell” as used herein refers to a cell which contains a vector and supports the replication and / or expression of the expression vector is intended. Host cells may be prokaryotic cells such as E. coli or eukaryotic cells such as yeast, insect, amphibian or mammalian cells or monocotyledonous or dicotyledonous plant cells. An example of a monocotyledonous host cell isDocket # 212089-WO-SEC-l a maize host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.

[0115] In preparing the expression cassette, the various DNA fragments may be manipulated so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.

[0116] A number of promoters can be used in the practice of the embodiments. The promoters can be selected based on the desired outcome. The nucleic acids can be combined with constitutive, tissue-preferred, inducible or other promoters for expression in the host organism.Plant Transformation

[0117] The methods of the embodiments involve introducing a polypeptide or polynucleotide into a plant. “Introducing” is as used herein means presenting to the plant the polynucleotide or polypeptide in such a manner that the sequence gains access to the interior of a cell of the plant. The methods of the embodiments do not depend on a particular method for introducing a polynucleotide or polypeptide into a plant, only that the polynucleotide(s) or polypeptide(s) gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotide(s) or polypeptide(s) into plants include, but are not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

[0118] “Stable transformation” as used herein means that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. “Transient transformation” as used herein means that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant. “Plant” as used herein refers to whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant cells, propagules, embryos and progeny of the same. Plant cells can be differentiated or undifferentiated (e.g. callus, suspension culture cells, protoplasts, leaf cells, root cells, phloem cells and pollen).Docket # 212089-WO-SEC-l

[0119] Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium-mQtXalQA transformation (US Patent Numbers 5,563,055 and 5,981,840), direct gene transfer (Paszkowski et al. (1984) £A7BO J. 3:2717-2722) and ballistic particle acceleration (see, for example, US Patent Numbers 4,945,050; 5,879,918; 5,886,244 and 5,932,782; Tomes et al. (1995) in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin) and McCabe et al. (1988) Biotechnology 6:923-926) and Led transformation (WO 00 / 28058). For potato transformation see, Tu et al. (1998) Plant Molecular Biology 37:829-838 and Chong et al. (2000) Transgenic Research 9:71- 78. Additional transformation procedures can be found in Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (soybean); McCabe et al. (1988)Bio / Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P: 175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988) Biotechnology 6:559-563 (maize); US Patent Numbers 5,240,855; 5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol. 91 :440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311 :763-764; US Patent Number 5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl.Genet. 84:560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4: 1495- 1505 (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75 :407-413 (rice); Osjoda et aL (1996) Nature Biotechnology 14:745- 750 (maize via Agrobacterium tumefaciens).Methods to Introduce Genome Editing Technologies into PlantsDocket # 212089-WO-SEC-l

[0120] In some examples disclosed herein, a nucleic acid that (i) encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, or 9 is introduced into the genome of a plant (e.g. soybean) using genome editing technologies. For example, the foregoing nucleic acid can be introduced into a desired location in the genome of a plant through the use of endonuclease or double-stranded break technologies such as TALENs, meganucleases, zinc finger nucleases, CRISPR-Cas, and the like. For example, a genomic sequence (having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1-9) or a coding sequence (having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10-18) can be introduced into a desired location in a genome using a CRISPR-Cas system, for the purpose of site-specific insertion. The desired location in a plant genome can be any desired target site for insertion, such as a genomic region amenable for breeding or may be a target site located in a genomic window with an existing trait of interest. Existing traits of interest could be either an endogenous trait or a previously introduced trait. Thus, for example, a native gene (SCN susceptible allele) can be altered though genome editing to the SCN resistant allele disclosed herein. Alternatively or additionally, the disclosed SCN resistant allele (that (i) encodes a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to any one of SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, or 27, (ii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, or 18, or (iii) comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, or 9 can be introduced by genome editing at a different genomic location (e.g., in soybean). The different genome location can be soybean chromosome Chr 1, Chr 2, Chr 3,Docket # 212089-WO-SEC-lChr 4, Chr 5, Chr 6, Chr 7, Chr 8, Chr 9, Chr 10, Chr 1 1, Chr 12, Chr 13, Chr 14, Chr 15, Chr 16, Chr 18, Chr 19, or Chr 20. Alternatively, the different genome location can be on soybean chromosome 17 at location other than its native locus, which corresponds to physical positions 23553783 to 23921640 on soybean chromosome 17 in the publicly available soybean genome W82.a2.vl .

[0121] The use of double-stranded break technologies such as Cas endonuclease-gRNA complexes, has been described, for example in U.S. Patent Application Publications 2015 / 0082478, and 2015 / 0059010, International Application Publications WO2015 / 026886, W02016 / 007347, and WO2016 / 25131, and US Patent No. 10,934,536. As used herein, a Cas endonuclease refers to a polypeptide encoded by a Cas (CRISPR-associated) gene. A Cas protein includes but is not limited to: a Cas9 protein, a Cpfl (Cas 12) protein, a C2cl protein, a C2c2 protein, a C2c3 protein, Cas3, Cas3-HD, Cas 5, Cas7, Cas8, CaslO, or combinations or complexes of these. When complexed with a guide polynucleotide, the guide polynucleotide / Cas endonuclease complex”, (or “guide polynucleotide / Cas endonuclease system”, “ guide polynucleotide / Cas complex”, “guide polynucleotide / Cas system” and “guided Cas system” or “Polynucleotide-guided endonuclease”, “PGEN”” are capable of directing the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and nick or cleave (introduce a single or double-strand break) the DNA target site. A guided Cas system referred to herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any known CRISPR systems (Horvath and Barrangou, 2010, Science 327: 167-170; Makarova el al. 2015, Nature Reviews Microbiology Vol. 13:1-15; Zetsche et al., 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13).

[0122] In some examples, an SCN susceptible gene allele can be modified by genome editing technology to include the SCN resistance allele. In some examples, an SCN susceptible gene allele (e.g., Glyma. l7Gl 86600) is modified to introduce a polynucleotide sequence encoding SEQ ID NO: 83 at the 3 ’end of the endogenous susceptible translation elongation factor polynucleotide sequence, such that the C-terminus of the protein encoded by the modified polynucleotide will include an extension comprising SEQ ID NO: 83. Site specific modifications can include those any method for introducing site specific modification, including, but not limited to, through the use of gene repair oligonucleotides (e.g. US Publication 2013 / 0019349), or through the use of double-stranded break technologies such as TALENs, meganucleases, zincDocket # 212089-WO-SEC-l finger nucleases, CRISPR-Cas, and the like. Such technologies can be used to modify the previously introduced polynucleotide through the insertion, deletion or substitution of nucleotides within the introduced polynucleotide. Alternatively, double-stranded break technologies can be used to add additional nucleotide sequences to the introduced polynucleotide. Additional sequences that may be added include, additional expression elements, such as enhancer and promoter sequences. In another embodiment, genome editing technologies may be used to position additional disease or pest resistant genes in close proximity to the SCN resistant gene within the genome of a plant, in order to generate molecular stacks with multiple disease / pest resistant proteins.

[0123] An “altered target site,” “altered target sequence.” “modified target site,” and “modified target sequence” are used interchangeably herein and refer to a target sequence as disclosed herein that comprises at least one alteration when compared to non-altered target sequence. Such “alterations” include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i) - (iii).

[0124] The following are examples of specific embodiments of some aspects of the invention. The examples are offered for illustrative purposes only and are not intended to limit the scope of the invention in any way.EXAMPLE 1

[0125] This example demonstrates the identification of a candidate gene within the cqSCN005 QTL on Chromosome 17 for soybean cyst nematode resistance.

[0126] An SCN resistance QTL named cqSCN005 (previously referred to as Rhg5) from the donor cultivars Hartwig and PI437654 has been previously reported within the pericentromeric region of chromosome 17. Given the QTL lies within the low-recombination, pericentromeric region of chromosome 17 spanning multiple megabases of DNA, fine-mapping of the QTL was necessary to enable discovery of candidate genes underlying the resistance. To this end, cqSCN005 fine-mapping was completed using two RIL mapping populations: Population 1 comprised the Fl 1 progeny of a cross between a SCN race 2 susceptible Peking-derived elite line carrying the SCN resistance genes Rhgla, Rhg2, and Rhg4 and a race 2 resistant Hartwig- derived elite line carrying Rhgla, Rhg2, Rhg4, SNAP14, and cqSCN005; Population 2Docket # 212089-WO-SEC-l comprised the F4 progeny of a cross between a race 4 resistant Hartwig-derived elite line with the resistance genes Rhgla, Rhg2, Rhg4, SNAP14, and cqSCN005 and a race 4 susceptible Pi90763-dervied elite line with Rhgla, Rhg2, Rhg4, and SNAP02 (Chr02). Progeny from these populations were phenotyped against either Race 2 or Race 4, respectively, and genotyped with SNP markers spanning the Chrl7 interval 18329035 bp - 32513859bp (See example 4). Analysis of recombinants revealed that the cqSCN005 resistance gene lies within an approximate 539.9 Kb interval between 23442761 bp - 23982671 bp based on the W82.a2.vl assembly.

[0127] To investigate whether variation within the narrowed cqSCN005 interval is associated with the resistance phenotype, whole genome references for Hartwig and PI437654 were generated and sequences from candidate cqSCN005 gene models within the interval were compared to analogous gene sequences within the w82.a2.vl reference gene set. To generate the references, genomic DNA was sequenced on the PacBio Sequel2e platform (Pacific Biosciences of California, Inc, Menlo Park, CA USA) to generate HiFi long reads with greater than 99.9% predicted accuracy. HiFi reads were assembled with the de novo assembler hifiasm (github.com / chhylpl23 / hifiasm) with default parameters. The resulting contigs were filtered for a minimum length of 70kb and minimum coverage of lOx. Contigs were placed into hybrid scaffolds using BioNano optical maps (San Diego, CA USA). Hybrid scaffolds were ordered and orientated relative to the W82.a5 assembly available from Soybase. Brown et al. 2021, Nucl.Acids Res. 49(D1): D1496-D15012. doi: 10.1093 / nar / gkaal 107.

[0128] Comparative genomic analysis within the fine-mapped interval revealed that Hartwig and PI437654 contained nine candidate genes (Table 2). Of the nine candidate genes, 5 genes, including a predicted NAM transcription factor (SEQ ID NO: 2), a tRNA ligase (SEQ ID NO: 8), a receptor like kinase (SEQ ID NO: 9), a Noc2 secretory vesicle exocytosis gene (SEQ ID NO: 5) and a translation elongation factor (SEQ ID NO: 6), have genomic variations that differentiate them from sequences in susceptible lines like williams82. For example, the translation elongation factor (SEQ ID NO: 6) has a complex insertion that modifies the stop codon ofGlyma.17G186600 and extends the predicated encoded protein by approximately seven amino acids.Table 2: Candidate Resistance Genes in the Fine Mapped IntervalDocket # 212089-WO-SEC-l*Gene model and position based on the Williams82 assembly. Wm82_NJAU (soybase.org)EXAMPLE 2

[0129] This example demonstrates that PI437654 and Hartwig carry transcriptionally active cqSCN005 resistance alleles.

[0130] To determine the impact of the cqSCN005 mutations identified in Example 1 on transcription, RNAseq analysis was performed on root samples that were infected with SCN race 3 (HG Type 7). Twelve seeds from PI437654, Hartwig and the susceptible control Williams82 were placed in a sand media within containers. The sand media was then treated with an SCN solution containing 2,000 J2 individuals. Seven days after inoculation, germinated plants were removed from the sand, briefly rinsed with tepid water, and severed at the stem / root junction; roots from three plants of each variety were pooled separately into single 50 mL tubes, frozen with liquid nitrogen, and stored at -80°C. Three replicates of pooled root tissue were collected per genotype. Total RNA was collected from ground frozen tissue using a Qiagen RNeasy plant kit (Qiagen, Germantown, MD, USA) and then spiked with the Ambion ERCC Mix 1 (ThermoFisher Scientific, Inc.) as an internal control; mRNA libraries were prepared from the isolated RNA using the Illumina® Stranded mRNA Prep, Ligation kit (Illumina.com) and sequencing was performed on an Illumina Novaseq 6000 instrument. On average, 31.4 million reads were generated per replicate. Additionally, the isolated RNA was used to generate long- read sequences using the PacBio Sequel2e platform (Pacific Biosciences of California, Inc, Menlo Park, CA USA) and the IsoSeq v3 chemistry.Docket # 212089-WO-SEC-l

[0131] Paired-end RNA-seq and PacBio Iso-seq reads were aligned to the Hartwig, PI437654 and Williams82 genomes using HISAT2 and MiniMap2, respectively. Analysis of aligned reads revealed that the cqSCN005 alleles of SEQ ID NOs: 2, 5, 6, 8, and 9 are expressed in Hartwig or PI437654 in both the treated and untreated root and shoot samples. The combination of genetic and genomic data suggests these cqSCN005 candidates could confer enhanced SCN resistance in soybean.EXAMPLE 3

[0132] This example demonstrates the cqSCN005 candidates condition resistance to SCN race 2.

[0133] To demonstrate that the cqSCN005 candidates of Example 1 condition resistance to SCN race 2, the resistant alleles from Hartwig and PI437654 are expressed in a variety that is susceptible to Race 2, such as Peking. Sequences comprising the cqSCN005 candidate coding sequences (SEQ ID NOs: 10-18) are introduced separately to the line Peking using Agrobacterium -mediated transformation. Transgene expression in stable transgenic plants is evaluated using a quantitative RT-PCR approach. Roots of transgenic plants are treated with SCN race 2 or a mock treatment as in Example 2. After approximately 30 days, SCN cysts are counted on the roots, and a comparison is made between the cyst counts from the control plants and the transgenic plants expressing the cqSCN005 candidates. A decrease in the total number of cysts is observed in cqSCN005 expressing plants confirming that SCN resistance is conditioned by the resistance alleles of these genes.EXAMPLE 4

[0134] This example demonstrates that the cqSCN005 candidate gene encoding a translation elongation factor (SEQ ID NOs: 6, 24) conditions resistance to SCN race 4.

[0135] To demonstrate that the cqSCN005 candidate gene, cqSCN005 Isoform 6 (SEQ ID NO: 6), which encodes a modified translation elongation factor (SEQ ID NO: 24), conditions resistance to SCN race 4, the resistant allele from Hartwig and PI437654 was expressed in PI90763, a variety that is susceptible to race 4. Genomic sequence comprising cqSCN005 Isoform 6 and its native promoter (SEQ ID NO: 6) was introduced to the variety PI90763 using Agrobacteriu -mediated transformation. Copy number of the inserted construct was determinedDocket # 212089-WO-SEC-l using qPCR analysis, and single-copy TO plants were self-fertilized to produce segregating T1 seed.

[0136] Four transgenic events were evaluated each segregating for 0, 1, or 2 copies of the candidate gene cqSCN005 Isoform 6. Specifically, transgenic T1 plants segregating for cqSCN005 Isoform 6 along with the resistant control Hartwig and the susceptible controls Williams82 and PI90763 were treated with SCN race 4 as described in Example 2. A comparison was made between cyst counts of control plants and the transgenic plants expressing 0, 1, and 2 copies of cqSCN005 Isoform 6 (Table 3). A decrease in the total number of cysts was observed in plants that contain one and two copies of the cqSCN005 Isoform 6 when compared to null plants and susceptible controls. Unexpectedly, the resistance phenotype of the T1 plants expressing two copies was stronger than the resistant control, Hartwig. These data indicate that SCN resistance is conditioned by the resistance allele of the translation elongation factor derived from Hartwig and PI437654.Table 3: SCN cyst counts of T1 plants expressing cqSCN005 Isoform 6 and control plants following inoculation with SCN Race 4EXAMPLE 5Docket # 212089-WO-SEC-l

[0137] This example demonstrates how molecular markers are used to track and select for a favorable allele of cqSCN005 for developing soybean products with improved SCN resistance.

[0138] To enable efficient development of new material, plant breeders use genotypic data from molecular assays to select plants with favorable genetic alleles, including those alleles that condition disease resistance, improve agronomic performance, and impart higher yield. Marker assisted selection of plants obviates the need for phenotypic observation, which saves costs and time during the breeding process.

[0139] Table 4 provides single nucleotide polymorphism (SNP) alleles and molecular assays that can be used individually or in combination (e.g., a haplotype) for selecting an SCN resistant QTL on Chrl7. Marker S2000CT-00-Q001 is used to specifically genotype the insertion in the candidate gene of SEQ ID NO: 6. The “M” allele is associated with resistance while the “W” allele is associated with susceptibility or decreased resistance. Physical positions shown in Table 4 are based on the W82.a2.vl assembly (Brown et al. 2021 supra , chromosome 17; “Expected alleles” refers to the expected genomic variation at the nucleotide position of the indicated context sequence; “Res” indicates the favorable, resistance allele to SCN and “Sus” indicates the less favorable allele, which is relatively more susceptible to SCN. Tables 5 and 6 provide primer and probe sequences that can be used to detect and select for one or more of the resistance alleles disclosed in Table 4.Table 4: Molecular Markers for Selecting and Developing Soybean Products Having the Chrl7 QTL Associated with Improved SCN ResistanceDocket # 212089-WO-SEC-lTable 5: Primer Sequences for Detecting the Markers on Chrl7Table 6: Probe Sequences for Detecting the Markers on Chrl7Docket # 212089-WO-SEC-l

[0140] A population or germplasm with improved resistance to SCN is generated by genotyping with marker S2000CT-00-Q001 and breeding with plants that have the “M” allele. Similarly, the SNP markers of Table 4 are tightly linked to the insertion and are used either independently from or in addition to marker S2000CT-00-Q001 to select for resistant plants.

[0141] Assays are developed at a unique sequence identified in Hartwig that are linked to the causative gene or to unique sequences of SEQ ID NO: 6 to aid marker assisted selection of SCN resistance conferred by the chromosome 17 QTL. Example assays are provided by S2000CT-00-Q001 which detect the presence or absence of unique sequence from Hartwig.EXAMPLE 6

[0142] This example demonstrates how inserting native resistance gene sequences of cqSCN005 using a gene-editing approach will improve SCN resistance.

[0143] Introgression of native alleles from exotic material or older varieties, like PI437654 and Hartwig, into current elite cultivars through breeding is complicated by the unintended transfer of unfavorable linked DNA that decrease yield (e.g., linkage drag). To eliminate the negative effects of linked loci, an SDN3 CRISPR / Cas9 approach that introduces cqSCN005 resistance gene sequences into elite breeding material is performed. In one example, a guide RNA is used with Cas9 to integrate the cqSCN005 candidate genes into favorable positions of the genome of a Race 2 susceptible variety. The cqSCN005 candidate genes are introduced with 2 kb of the native protomer to drive transcript levels and patterns that mimic their expression in native positions. Plants expressing cqSCN005 alleles of the candidate resistance genes are then used to create cultivars with improved SCN resistance. A marker assisted selection strategy as demonstrated in Example 5 can be used to select for plants harboring newly generated cqSCN005 alleles. The new alleles can be further crossed into additional elite material through breeding.EXAMPLE 7

[0144] This example demonstrates how breeding for resistant allele of cqSCN005 is used to create broader spectrum SCN resistance.Docket # 212089-WO-SEC-l

[0145] Breeding lines carrying Rhgla, Rhg4 and Rhg2 QTL from the SCN resistant line Peking were used as recurrent parents to introgress SCN resistant alleles at the SNAP 14 and cqSCN005 genes, derived from PI437654 or Hartwig, via marker assisted backcrossing to create a novel stack of SCN resistant genes. cqSCN005 is introgressed using the markers of example 5. BC3F3 individuals carrying the novel gene stack were screened with multiple races of SCN, including race 2 to which Peking is susceptible. Screening results showed soybean lines carrying the novel stack, i.e., Rhgla, Rhg4 and Rhg2 from Peking and SNAP14 and cqSCN005 from PI437654, were resistant to SCN races 1, 2, 3, 4 and 5.

[0146] The SCN resistant line Hartwig also carries a resistant allele at cqSCN005 and has been used to create novel gene stacks that result in broader SCN resistance. Breeding lines carrying the Rh la, Rhg4 and Rhg2 QTL from the SCN resistant line Peking were used as recurrent parents to introgress SCN resistant alleles at the SNAP14 gene and at the cqSCN005 QTL derived from Hartwig via marker assisted backcrossing to create a novel stack of SCN resistant genes. BC3F3 individuals carrying the novel gene stack were screened with multiple races of SCN, including races 2 and 4 to which Peking is susceptible. Screening results showed that soybean lines carrying the novel stack, i.e., Rhgla, Rhg4 and Rhg2 from Peking and SNAP14 and cqSCN005 from Hartwig were resistant to SCN races 1, 2, 3, 4 and 5.EXAMPLE 8

[0147] This example illustrates a gene-editing approach targeting an endogenous translation elongation factor to improve resistance to soybean cyst nematode (SCN).

[0148] The resistant allele cqSCN005 Isoform 6 (SEQ ID NO: 6) encodes a translation elongation factor (SEQ ID NO: 24) that has a predicted amino acid sequence that contains a seven amino acid C-terminal extension, SPLGWLQ (SEQ ID NO: 83) as compared to the amino acid sequence encoded by the susceptible Williams 82 allele Glyma.l7Gl 86600 (SEQ ID NO: 79). The extension arises from a combination of an 18-bp deletion at the 3’ end of the coding sequencing that removes the William 82 stop codon and additional downstream genomic variants that extend the coding sequence by 21 nucleotides prior to a new stop codon, TAA.

[0149] To convert a susceptible translation elongation factor, such as Glyma.l7Gl 86600, to a resistant form, an endogenous susceptible translation elongation factor (e.g.Docket # 212089-WO-SEC-lGlyma.17G186600) gene in the soybean genome is modified to introduce a polynucleotide sequence encoding SEQ ID NO: 83 at the 3 ’end of the endogenous susceptible translation elongation factor polynucleotide sequence, such that the C-terminus of the protein encoded by the modified polynucleotide will include the SPLGWLQ (SEQ ID NO: 83) extension. In one example, a CRISPR / Cas9 SDN3 approach is used to introduce the nucleotide sequence TCACCACTTGGTTGGTTACAA (SEQ ID NO: 84) in front of the native stop codon. Following agrobacterium mediated transformation to introduce Cas9 components and a genomic template with the sequence of SEQ ID NO: 84, TO plants are screened for insertion of the sequence; those that carry the intact sequence are brought to the next generation using self- pollination. Progeny plants carrying genomic insertion will have the extended amino acid sequence and increased resistance to soybean cyst nematode. Variations of this nucleotide sequence that leverage codon redundancy and maintain the coding sequence for SEQ ID NO: 83 are also suitable for creating a resistant allele.

[0150] Alternatively, the same sequence with the addition of a stop codon (e.g. TAA) can be used to replace and modify the susceptible sequence using an SDN2 approach such that the final product replicates the resistant allele sequence. Other examples may include gene editing, and chemical or physical mutational approaches that achieve the necessary genomic mutations to extend the amino acid sequence.

[0151] All publications and patent applications in this specification are indicative of the level of ordinary skill in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated by reference.

[0152] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless mentioned otherwise, the techniques employed or contemplated herein are standard methodologies well known to one of ordinary skill in the art. The materials, methods and examples are illustrative only and not limiting.

[0153] Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is toDocket # 212089-WO-SEC-l be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

[0154] Units, prefixes and symbols may be denoted in their SI accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5’ to 3’ orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges are inclusive of the numbers defining the range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

Claims

Docket # 212089-WO-SEC-lWe claim:

1. A method of modifying plant material, the method comprising introducing into the genome of the plant material a heterologous nucleic acid sequence or expressing the heterologous nucleic acid sequence in the plant material, wherein the heterologous nucleic acid is associated with increased resistance to soybean cyst nematode and (i) encodes a polypeptide having at least 90% amino acid sequence identity to any one of SEQ ID NOs: 24, 19, 20, 21, 22, 23, 25, 26, or 27, (ii) comprises a sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 15, 10, 11, 12, 13, 14, 16, 17, or 18, or (iii) comprises a sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 6, 1, 2, 3, 4, 5, 7, 8, or 9.

2. The method of claim 1, wherein the plant material is soybean plant material, and the heterologous nucleic acid is inserted into a location on soybean chromosome 1-16 or 18-20.

3. The method of any one of claims 1 or 2, wherein the plant material is soybean plant material, and the heterologous nucleic acid is inserted into a location other than its native locus corresponding to physical positions 23553783 to 23921640 on soybean chromosome 17 in soybean genome W82.a2.vl.

4. The method of any one of claims 1-3, wherein the heterologous nucleic acid further comprises a heterologous promoter.

5. The method of any one of claims 1-3, wherein the heterologous nucleic acid further comprises its native promoter.

6. The method of any one of claims 1-5, wherein the method comprises introducing the heterologous nucleic acid using a double-stranded break.

7. The method of claim 6, wherein the method comprises introducing the heterologous nucleic acid using TALEN, meganuclease, zinc finger nuclease, or CRISPR-Cas technology.

8. The method of claim 6, wherein the method comprises introducing the heterologous nucleic acid using Cas endonuclease.Docket # 212089-WO-SEC-l9. A method of introducing a gene associated with increased resistance to soybean cyst nematode (SCN) into a plant, the method comprising: a. crossing a first plant having SCN resistance with a second plant to obtain progeny plants; b. obtaining a sample containing nucleic acid from each of one or more of the progeny plants; c. screening the sample for a nucleic acid that (i) encodes a polypeptide having at least 90% amino acid sequence identity to any one of SEQ ID NOs: 24, 19, 20, 21, 22, 23, 25, 26, or 27, (ii) comprises a sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 15, 10, 11, 12, 13, 14, 16, 17, or 18, or (iii) comprises a sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 6, 1, 2, 3, 4, 5, 7, 8, or 9; and d. selecting one or more progeny plants that have the screened-for nucleic acid.

10. The method of claim 9, wherein the first plant having SCN resistance comprises the screened-for nucleic acid.

11. The method of claim 9 or 10, wherein the screened-for nucleic acid comprises a nucleic acid that (i) encodes a polypeptide having at least 90% amino acid sequence identity to any one of SEQ ID NOs: 24, 19, 20, 21, 22, 23, 25, 26, or 27, (ii) comprises a sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 15, 10, 11, 12, 13, 14, 16, 17, or 18, or (iii) comprises a sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 6, 1, 2, 3, 4, 5, 7, 8, or 9.

12. The method of any one of claims 9-11, wherein the screened-for nucleic acid is a heterologous nucleic acid on soybean chromosome 1-16 or 18-20.

13. The method of any one of claims 9-11, wherein the screened-for nucleic acid is a heterologous nucleic on soybean chromosome 17 at a locus other than its native locus corresponding to physical positions 23553783 to 23921640 on soybean chromosome 17 in soybean genome W82.a2.vl.Docket # 212089-WO-SEC-l14. The method of claim 12 or 13, wherein the heterologous nucleic acid has been introduced to the first plant having SCN resistance or was introduced to a progenitor of the plant having SCN resistance by genome editing or by transgenic modification.

15. The method of any one of claims 9-14, further comprising crossing the selected one or more progeny plants with the second plant to produce backcross progeny plants.

16. The method of claim 15, further comprising: a. obtaining a sample containing nucleic acid from one or more of the backcross progeny plants; b. screening each sample for the screened for screened-for nucleic acid; and c. selecting one or more backcross progeny plants that have the screened for nucleic acid.

17. The method of claim 16, further comprising: d. crossing the selected one or more backcross progeny plants with the second plant to produce additional backcross progeny plants; e. obtaining a sample containing nucleic acid from one or more of the additional backcross progeny plants; f. screening each sample for the screened-for nucleic acid; and g. selecting one or more additional backcross progeny plants that have the screened for nucleic acid.

18. The method of claim 17, further comprising one or more repeated steps of: h. crossing the selected one or more additional backcross progeny plants with the second plant to produce further additional backcross progeny plants, i. obtaining samples containing nucleic acid from one or more further additional backcross progeny plants;Docket # 212089-WO-SEC-l j. screening each sample for the screened-for nucleic acid; k. selecting one or more further additional backcross progeny plants that have the screened for nucleic acid; and l. optionally repeating steps h.-k. one or more times using the selected one or more further additional backcross progeny plants as the selected additional backcross progeny plants.

19. A genome edited or transgenic plant comprising a heterologous nucleic acid sequence or expressing the heterologous nucleic acid sequence, wherein the heterologous nucleic acid is associated with increased resistance to soybean cyst nematode and (i) encodes a polypeptide having at least 90% amino acid sequence identity to any one of SEQ ID NOs: 24, 19, 20, 21, 22, 23, 25, 26, or 27, (ii) comprises a sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 15, 10, 11, 12, 13, 14, 16, 17, or 18, or (iii) comprises a sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 6, 1, 2, 3, 4, 5, 7, 8, or 9.

20. The genome edited or transgenic plant of claim 19, wherein the plant is a soybean plant, and the heterologous nucleic acid is inserted into a location on soybean chromosome 1-16 or 18- 20.

21. The genome edited or transgenic plant of any one of claims 19-20, wherein the plant is a soybean plant and the heterologous nucleic acid is inserted into a location other than its native locus corresponding to physical positions 23553783 to 23921640 on soybean chromosome 17 in soybean genome W82.a2.vl.

22. The genome edited or transgenic plant of any one of claims 19-21, wherein the heterologous nucleic acid further comprises a heterologous promoter.

23. The genome edited or transgenic plant of any one of claims 19-21, wherein the heterologous nucleic acid further comprises its native promoter.

24. Use of the genome edited or transgenic plant of any one of claims 19-23 for control of soybean cyst nematode (SCN) comprising providing to the SCN an effective amount of aDocket # 212089-WO-SEC-l polypeptide having at least 90% amino acid sequence identity to any one of SEQ ID NOs: 24, 19, 20, 21, 22, 23, 25, 26, or 27.

25. A method of detecting the presence or absence of a SNP allele at position 201 of one or more of SEQ ID NOs: 28, 33, 38, 43, 50, 53, 58, or 63 in a plant genome; the method comprising: a. amplifying genomic DNA containing the SNP allele at position 201 of one or more of SEQ ID NOs: 28, 33, 38, 43, 50, 53, 58, or 63; to thereby generate an amplicon; b. contacting the amplicon with one or more probes comprising one or more of SEQ ID NOs: 29, 32, 34, 37, 39, 42, 44, 47, 48, 49, 54, 57, 59, 62, 64, or 67; and c. detecting whether the one or more probes bind to the amplicon to thereby determine the presence or absence of the one or more SNP allele.

26. The method of claim 25, wherein the method comprises detecting the zygosity of the SNP allele at position 201 of one or more of SEQ ID NOs: 28, 33, 38, 43, 50, 53, 58, or 63 in a plant genome; the method comprising: a. amplifying genomic DNA containing the SNP allele at position 201 of one or more of SEQ ID NOs: 28, 33, 38, 43, 50, 53, 58, or 63; to thereby generate an amplicon; b. contacting the amplicon with one or more of the following sets of probes:(i) a first probe comprising SEQ ID NO: 29 and a second probe comprising SEQ ID NO: 32;(ii) a first probe comprising SEQ ID NO: 34 and a second probe comprising SEQ ID NO: 37;(iii) a first probe comprising SEQ ID NO: 39 and a second probe comprising SEQ ID NO: 42;(iv) a first probe comprising SEQ ID NO: 44 and a second probe comprising SEQ ID NO: 47;Docket # 212089-WO-SEC-l(v) a first probe comprising SEQ ID NO: 48 and a second probe comprising SEQ ID NO: 49;(vi) a first probe comprising SEQ ID NO: 54 and a second probe comprising SEQ ID NO: 57;(vii) a first probe comprising SEQ ID NO: 59 and a second probe comprising SEQ ID NO: 62; and / or(viii) a first probe comprising SEQ ID NO: 64 and a second probe comprising SEQ ID NO: 67; and c. detecting whether one or both probes from each set of the contacted probes bind to the amplicon to thereby determine the zygosity of the one or more SNP allele.

27. The method of claim 25 or 26, wherein the amplicon is amplified using one or more of the following sets of primers:(i) a first primer comprising SEQ ID NO: 30 and a second primer comprising SEQ ID NO: 31;(ii) a first primer comprising SEQ ID NO: 35 and a second primer comprising SEQ ID NO: 36;(iii) a first primer comprising SEQ ID NO: 40 and a second primer comprising SEQ ID NO: 41;(iv) a first primer comprising SEQ ID NO: 45 and a second primer comprising SEQ ID NO: 46;(v) a first primer comprising SEQ ID NO: 51 and a second primer comprising SEQ ID NO: 52;(vi) a first primer comprising SEQ ID NO: 55 and a second primer comprising SEQ ID NO: 56;(vii) a first primer comprising SEQ ID NO: 60 and a second primer comprising SEQ ID NO: 61; andDocket # 212089-WO-SEC-l(viii) a first primer comprising SEQ ID NO: 64 and a second primer comprising SEQ ID NO: 66.

28. A method of detecting the presence or absence of an insertion at position 100 of SEQ ID NO: 68 in a plant genome; the method comprising: a. amplifying genomic DNA containing the insertion at position 100 of SEQ ID NO: 68; to thereby generate an amplicon; b. contacting the amplicon with one or more probes comprising one or more of SEQ ID NOs: 69 or 73; and c. detecting whether the one or more probes bind to the amplicon to thereby determine the presence or absence of the one or more SNP allele.

29. The method of claim 28, wherein the method comprises detecting the zygosity of the insertion at position 100 of SEQ ID NO: 68 in a plant genome; the method comprising: a. amplifying genomic DNA containing the insertion at position 100 of SEQ ID NO: 68; to thereby generate an amplicon; b. contacting the amplicon with a first probe comprising SEQ ID NO: 69 and a second probe comprising SEQ ID NO: 73; and c. detecting whether one or both probes from each set of the contacted probes bind to the amplicon to thereby determine the zygosity of the insertion allele.

30. The method of claim 28 or 29, wherein the amplicon is amplified using a first primer comprising SEQ ID NO: 70 and a second primer comprising SEQ ID NO: 71.

31. A method of introgressing a soybean cyst nematode (SCN) resistance gene into a soybean plant, the SCN resistance gene comprising a polynucleotide encoding a polypeptide having at least 95% sequence identity to SEQ ID NO: 24, 19, 20, 21, 22, 23, 25, 26, or 27, the method comprising:Docket # 212089-WO-SEC-l i) crossing an SCN resistant soybean plant comprising a polynucleotide encoding a polypeptide having at least 95% sequence identity to SEQ ID NO: 24, 19, 20, 21, 22, 23, 25, 26, or 27 with a second soybean plant to produce progeny; ii) screening the progeny with a nucleic acid marker to detect progeny comprising a polymorphism genetically linked to the SCN resistance gene; and iii) selecting progeny that comprise the polymorphism to obtain soybean plants that contain the SCN resistance gene.

32. The method of claim 31, wherein the polymorphism is within 10 centimorgans of the nucleic acid encoding a polypeptide having at least 95% sequence identity to SEQ ID NO: 24, 19, 20, 21, 22, 23, 25, 26, or 27.

33. The method of claim 31 or 32, wherein the polymorphism comprises a single nucleotide polymorphism (SNP).

34. The method of claim 33, wherein the SNP comprises a C at S101B38, T at S20009Y, a T at S2000B0, a T at S2000CA, an A at S101B39, a G at S101B3B, a C at S20006E, a C at S20006F, or any combination thereof.

35. The method of claim 31 or 32 wherein the polymorphism comprises an insertion at S2000CT.

36. The method of claim 35, wherein the polymorphism comprises the presence of a polynucleotide having at least 95% sequence identity to SEQ ID NO: 68.

37. A method for producing a soybean plant having increased resistance to soybean cyst nematode (SCN), the method comprising: i) genotyping a soybean population comprising a plurality of soybean plants or soybean germplasm for the presence of at least one maker genetically linked to a locus comprising or corresponding to an SCN resistance gene encoding a polypeptide having at least 95% sequence identity to SEQ ID NO: 24, 19, 20, 21, 22, 23, 25, 26, or 27;Docket # 212089-WO-SEC-l ii) selecting from the soybean population one or more soybean plants or soybean germplasm comprising the at least one marker; and iii) crossing the selected soybean plant or soybean germplasm with a second soybean plant or soybean germplasm to produce a progeny population, wherein at least one soybean plant or soybean germplasm of the progeny population comprises the at least one marker and has increased resistance to SCN as compared to a control plant.

38. The method of claim 37, wherein the at least one marker genetically linked to the locus is within 20 centimorgans of the locus comprising or corresponding to an SCN resistance gene encoding a polypeptide having at least 95% sequence identity to SEQ ID NO: 24, 19, 20, 21, 22, 23, 25, 26, or 27.

39. The method of claim 37 or 38, wherein the marker is selected from the group consisting of a C at S101B38, T at S20009Y, a T at S2000B0, a T at S2000CA, an A at S101B39, a G at S101B3B, a C at S20006E, a C at S20006F, the presence of an insertion at S2000CT, and the presence of a polynucleotide having at least 95% sequence identity to SEQ ID NO: 68.

40. The method of any one of claims 37-39, wherein genotyping comprises amplifying a nucleic acid sequence comprising the at least one marker and detecting the resulting amplified nucleic acid comprising the marker.

41. The method of claim 40, wherein the amplification comprising amplification of at least a portion of one or more genomic regions of the soybean genome comprising SEQ ID NO: 28, 33, 38, 43, 50, 53, 58, 63, or 68.

42. The method of claim 40 or 41, wherein the amplification comprises providing one or more nucleic acid primers, wherein the nucleic acid primers comprise the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 30, 31, 35, 36, 40, 41, 45, 46, 51, 52, 55, 56, 60, 61, 64, 66, 70 and 71.

43. The method of any one of claims 40-42, wherein the detecting comprises hybridization with one or more nucleic acid probes, the one or more nucleic acid probes comprising a nucleicDocket # 212089-WO-SEC-l acid sequence selected from the group consisting of SEQ ID NOs: 29, 32, 34, 37, 39, 42, 44, 47, 48, 49, 54, 57, 59, 62, 64, 67 and 69.

Images