Beta-carotene hydroxylase mutant and application thereof

Abstract

The invention is applicable to the technical field of microorganisms, and relates to a beta-carotene hydroxylase mutant and application thereof, in particular to application of beta-carotene hydroxylase CrtZ and related variants thereof in synthesis of zeaxanthin by recombining yarrowia lipolytica. According to the present invention, the new beta-carotene hydroxylase CrtZ is excavated, and the biological conversion from the beta-carotene to the zeaxanthin can be achieved in the recombinant yarrowia lipolytica; and the activity of CrtZ is further enhanced by utilizing an enzyme engineering technology, so that the zeaxanthin synthesis capability of the recombinant yarrowia lipolytica strain is enhanced.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to the application of β-carotene hydroxylase CrtZ and its related variants in the synthesis of zeaxanthin by recombinant Yersinia lipolytica. Background Technology

[0002] Zeaxanthin (3,3'-dihydroxy-β-carotene) is a multifunctional compound that acts as a potent antioxidant, reducing oxidative stress damage to cells and tissues. Furthermore, zeaxanthin possesses anti-inflammatory properties, alleviating inflammatory responses and symptoms of related diseases. As a key component of the macular region of the retina, zeaxanthin, along with lutein, plays a vital protective role in the visual system. It absorbs blue light, reducing light damage and protecting the retina from ultraviolet and high-energy light, helping to prevent eye diseases such as macular degeneration and cataracts. In addition, zeaxanthin can be used as a nutritional supplement, providing the body with essential antioxidants and nutrients to maintain overall health. Therefore, there is a significant market demand for zeaxanthin, with global demand estimated at approximately 10-15 tons (100% zeaxanthin) annually.

[0003] The main methods for producing zeaxanthin include chemical synthesis, plant extraction, and microbial fermentation. Considering the scarcity of natural resources, environmental pollution, and economic issues, biological methods have received widespread attention due to their advantages such as short cultivation cycles, simple procedures, environmental friendliness, and the potential for large-scale industrial production. Among these, *Yarrowia lipolytica* is a generally regarded as safe (GRAS) microorganism, rich in lipids and acetyl-CoA, and can achieve high levels of carotene accumulation. By introducing the β-carotene hydroxylase CrtZ into β-carotene-producing *Yarrowia lipolytica* strains, the conversion from β-carotene to zeaxanthin can be achieved. However, existing CrtZ technologies suffer from low activity; therefore, it is necessary to develop a CrtZ with higher activity to more efficiently synthesize zeaxanthin in *Yarrowia lipolytica*. Summary of the Invention

[0004] This invention discovers a novel β-carotene hydroxylase, CrtZ, which enables the biotransformation of β-carotene into zeaxanthin in recombinant Yersinia lipolytica. Enzyme engineering techniques are used to further enhance the activity of CrtZ, thereby increasing the ability of the recombinant Yersinia lipolytica strain to synthesize zeaxanthin.

[0005] In a first aspect, the present invention provides a β-carotene hydroxylase mutant, wherein the mutation is based on the amino acid sequence of wild-type CrtZ_9BACT, which involves the deletion, addition, and / or substitution of one or more amino acids.

[0006] In some embodiments, the wild-type CrtZ_9BACT contains the amino acid sequence shown in SEQ ID NO.2.

[0007] In some implementations, the mutation is generated by point saturation mutation and / or combination mutation.

[0008] In some embodiments, the mutant comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO.2.

[0009] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 95% identity with the amino acid sequence shown in SEQ ID NO.2.

[0010] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 96% identity with the amino acid sequence shown in SEQ ID NO.2.

[0011] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 97% identity with the amino acid sequence shown in SEQ ID NO.2.

[0012] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 98% identity with the amino acid sequence shown in SEQ ID NO.2.

[0013] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 99% identity with the amino acid sequence shown in SEQ ID NO.2.

[0014] In some preferred embodiments, the mutant has 7 mutations, including an amino acid sequence with 95.5% identity to the amino acid sequence shown in SEQ ID NO.2.

[0015] In some preferred embodiments, the mutant has six mutations, including an amino acid sequence with 96.2% identity to the amino acid sequence shown in SEQ ID NO.2.

[0016] In some preferred embodiments, the mutant has 5 mutations, including an amino acid sequence with 96.8% identity to the amino acid sequence shown in SEQ ID NO.2.

[0017] In some preferred embodiments, the mutant has four mutations, including an amino acid sequence that is 97.5% identical to the amino acid sequence shown in SEQ ID NO.2.

[0018] In some preferred embodiments, the mutant has three mutations, including an amino acid sequence that is 98.1% identical to the amino acid sequence shown in SEQ ID NO.2.

[0019] In some preferred embodiments, the mutant has two mutations, including an amino acid sequence that is 98.7% identical to the amino acid sequence shown in SEQ ID NO.2.

[0020] In some preferred embodiments, the mutant has one mutation comprising an amino acid sequence that is 99.4% identical to the amino acid sequence shown in SEQ ID NO.2.

[0021] In some embodiments, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2, the positions of which are selected from:

[0022] L9, C10, F27, F36, W40, R42, K47, A59, Y72, T77, Y81, L97, K114, A152.

[0023] In some embodiments, the mutant contains one or more substitutions at one or more of the following positions in the amino acid sequence shown in SEQ ID NO.2:

[0024] (1) L9H or L9M;

[0025] (2)C10M;

[0026] (3) F27A;

[0027] (4)F36W;

[0028] (5) W40V;

[0029] (6) R42V;

[0030] (7) K47M or K47S;

[0031] (8)A59F;

[0032] (9)Y72W;

[0033] (10)T77V;

[0034] (11) Y81R or Y81N;

[0035] (12)L97M;

[0036] (13) K114S; or

[0037] (14)A152S.

[0038] In some embodiments, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2:

[0039] (1) R42V, the mutant comprising an amino acid sequence as shown in SEQ ID NO.14 or a nucleotide sequence as shown in SEQ ID NO.13;

[0040] (2) A59F, the mutant comprising an amino acid sequence as shown in SEQ ID NO. 6 or a nucleotide sequence as shown in SEQ ID NO. 5;

[0041] (3) T77V, the mutant comprising an amino acid sequence as shown in SEQ ID NO.12 or a nucleotide sequence as shown in SEQ ID NO.11;

[0042] (4) Y81R, the mutant comprising an amino acid sequence as shown in SEQ ID NO.10 or a nucleotide sequence as shown in SEQ ID NO.9;

[0043] (5) K114S, the mutant comprising an amino acid sequence as shown in SEQ ID NO.4 or a nucleotide sequence as shown in SEQ ID NO.3;

[0044] (6) A152S, the mutant comprising an amino acid sequence as shown in SEQ ID NO.8 or a nucleotide sequence as shown in SEQ ID NO.7.

[0045] In some embodiments, the mutant contains a K114S substitution in the amino acid sequence shown in SEQ ID NO.2.

[0046] In some preferred embodiments, the mutant comprises an amino acid sequence as shown in SEQ ID NO.4.

[0047] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, the positions of which are selected from:

[0048] L9, C10, F27, F36, W40, K47, A59, Y72, T77, Y81, L97, A152.

[0049] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, the amino acid substitutions being selected from:

[0050] (1) L9H or L9M;

[0051] (2)C10M;

[0052] (3) F27A;

[0053] (4)F36W;

[0054] (5) W40V;

[0055] (6) K47M or K47S;

[0056] (7)A59F;

[0057] (8)Y72W;

[0058] (9)T77V;

[0059] (10) Y81R or Y81N;

[0060] (11)L97M; or

[0061] (12)A152S.

[0062] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, the amino acid substitutions being selected from:

[0063] (1) L9H, the mutant comprising the amino acid sequence shown in SEQ ID NO. 16 or the nucleotide sequence shown in SEQ ID NO. 15; or L9M, the mutant comprising the amino acid sequence shown in SEQ ID NO. 18 or the nucleotide sequence shown in SEQ ID NO. 17; or

[0064] (2)W40V, the mutant contains an amino acid sequence as shown in SEQ ID NO.20 or a nucleotide sequence as shown in SEQ ID NO.19.

[0065] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, the amino acid substitutions being selected from:

[0066] (1) C10M, the mutant comprising an amino acid sequence as shown in SEQ ID NO.22 or a nucleotide sequence as shown in SEQ ID NO.21;

[0067] (2) F36W, the mutant comprising an amino acid sequence as shown in SEQ ID NO.24 or a nucleotide sequence as shown in SEQ ID NO.23;

[0068] (3) K47M, the mutant comprising the amino acid sequence shown in SEQ ID NO.26 or the nucleotide sequence shown in SEQ ID NO.25; or K47S, the mutant comprising the amino acid sequence shown in SEQ ID NO.28 or the nucleotide sequence shown in SEQ ID NO.27;

[0069] (4) Y72W, the mutant comprising an amino acid sequence as shown in SEQ ID NO.30 or a nucleotide sequence as shown in SEQ ID NO.29;

[0070] (5) T77V, the mutant comprising the amino acid sequence shown in SEQ ID NO. 32 or the nucleotide sequence shown in SEQ ID NO. 31; or

[0071] (6)Y81N, the mutant comprising an amino acid sequence as shown in SEQ ID NO.34 or a nucleotide sequence as shown in SEQ ID NO.33.

[0072] In some embodiments, the mutant further includes an L9H substitution in the amino acid sequence shown in SEQ ID NO.4.

[0073] In some preferred embodiments, the mutant comprises an amino acid sequence as shown in SEQ ID NO.16.

[0074] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.16, the positions of which are selected from:

[0075] H9, C10, F27, F36, W40, K47, A59, Y72, T77, Y81, L97, A152.

[0076] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.16, the amino acid substitutions being selected from:

[0077] (1)H9M;

[0078] (2)C10M;

[0079] (3) F27A;

[0080] (4)F36W;

[0081] (5) W40V;

[0082] (6) K47S;

[0083] (7)A59F;

[0084] (8)Y72W;

[0085] (9)T77V;

[0086] (10) Y81R or Y81N;

[0087] (11)L97M; or

[0088] (12)A152S.

[0089] In some embodiments, the mutant further comprises substitutions selected from any of the following at amino acid sequence positions as shown in SEQ ID NO. 16:

[0090] (1) H9M+F27A+A152S, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.36 or a nucleotide sequence as shown in SEQ ID NO.35;

[0091] (2) T77V, the mutant comprising an amino acid sequence as shown in SEQ ID NO.38 or a nucleotide sequence as shown in SEQ ID NO.37;

[0092] (3) F36W+W40V+T77V, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.40 or a nucleotide sequence as shown in SEQ ID NO.39;

[0093] (4) F36W+W40V+Y72W+T77V, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.42 or a nucleotide sequence as shown in SEQ ID NO.41;

[0094] (5) F36W+W40V, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.44 or a nucleotide sequence as shown in SEQ ID NO.43;

[0095] (6) W40V, the mutant comprising an amino acid sequence as shown in SEQ ID NO.46 or a nucleotide sequence as shown in SEQ ID NO.45;

[0096] (7) F36W+W40V+K47S, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.48 or a nucleotide sequence as shown in SEQ ID NO.47;

[0097] (8) Y81N, the mutant comprising an amino acid sequence as shown in SEQ ID NO.50 or a nucleotide sequence as shown in SEQ ID NO.49;

[0098] (9) Y81R+A152S, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.52 or a nucleotide sequence as shown in SEQ ID NO.51;

[0099] (10)C10M+F36W+W40V+T77V, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.54 or a nucleotide sequence as shown in SEQ ID NO.53;

[0100] (11) H9M+F27A+A59F+Y81R+L97M+A152S, wherein the mutant comprises an amino acid sequence as shown in SEQ ID NO.56 or a nucleotide sequence as shown in SEQ ID NO.55; or

[0101] (12)W40V+K47S, the mutant comprising an amino acid sequence as shown in SEQ ID NO.58 or a nucleotide sequence as shown in SEQ ID NO.57.

[0102] In some preferred embodiments, the mutant contains an H9M+F27A+A152S substitution in the amino acid sequence shown in SEQ ID NO.16;

[0103] In some preferred embodiments, the mutant comprises an amino acid sequence as shown in SEQ ID NO.36.

[0104] Secondly, the present invention provides a nucleic acid, wherein the nucleic acid encodes the aforementioned mutant.

[0105] Thirdly, the present invention provides an expression vector, wherein the expression vector comprises the aforementioned nucleic acid.

[0106] Fourthly, the present invention provides a host cell, wherein the host cell contains the aforementioned nucleic acid or the aforementioned expression vector.

[0107] In some implementations, the host cell is Yersinia lipolytica.

[0108] In some implementations, the host cell is recombinant Yersinia lipolytica.

[0109] In some embodiments, the host cell is a recombinant Yersinia lipophila strain BOTA01017.

[0110] In some implementations, the recombinant Yersinia lipolytica also produces β-carotene.

[0111] Fifthly, the present invention provides a method for preparing zeaxanthin, wherein the method produces zeaxanthin using engineered Yersinia lipolytica, wherein the engineered Yersinia lipolytica comprises CrtZ_9BACT or a mutant thereof.

[0112] In some implementations, the CrtZ_9BACT is derived from Fulvivirga imtechensis AK7.

[0113] In some embodiments, the method includes the step of introducing CrtZ_9BACT into a β-carotene-producing Yersinia lipolytica strain.

[0114] In some implementations, the method further includes the step of: mutating wild-type CrtZ_9BACT using enzyme engineering techniques.

[0115] In some implementations, the mutation is generated by point saturation mutation and / or combination mutation.

[0116] In some embodiments, the wild-type CrtZ_9BACT contains the amino acid sequence shown in SEQ ID NO.2.

[0117] In some implementations, the mutation is the deletion, addition, and / or substitution of one or more amino acids based on the amino acid sequence of wild-type CrtZ_9BACT.

[0118] In some embodiments, the mutant comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO.2.

[0119] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 95% identity with the amino acid sequence shown in SEQ ID NO.2.

[0120] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 96% identity with the amino acid sequence shown in SEQ ID NO.2.

[0121] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 97% identity with the amino acid sequence shown in SEQ ID NO.2.

[0122] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 98% identity with the amino acid sequence shown in SEQ ID NO.2.

[0123] In some preferred embodiments, the mutant comprises an amino acid sequence having more than 99% identity with the amino acid sequence shown in SEQ ID NO.2.

[0124] In some preferred embodiments, the mutant has 7 mutations, including an amino acid sequence with 95.5% identity to the amino acid sequence shown in SEQ ID NO.2.

[0125] In some preferred embodiments, the mutant has six mutations, including an amino acid sequence with 96.2% identity to the amino acid sequence shown in SEQ ID NO.2.

[0126] In some preferred embodiments, the mutant has 5 mutations, including an amino acid sequence with 96.8% identity to the amino acid sequence shown in SEQ ID NO.2.

[0127] In some preferred embodiments, the mutant has four mutations, including an amino acid sequence that is 97.5% identical to the amino acid sequence shown in SEQ ID NO.2.

[0128] In some preferred embodiments, the mutant has three mutations, including an amino acid sequence that is 98.1% identical to the amino acid sequence shown in SEQ ID NO.2.

[0129] In some preferred embodiments, the mutant has two mutations, including an amino acid sequence that is 98.7% identical to the amino acid sequence shown in SEQ ID NO.2.

[0130] In some preferred embodiments, the mutant has one mutation comprising an amino acid sequence that is 99.4% identical to the amino acid sequence shown in SEQ ID NO.2.

[0131] In some embodiments, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2, the positions of which are selected from:

[0132] L9, C10, F27, F36, W40, R42, K47, A59, Y72, T77, Y81, L97, K114, A152.

[0133] In some embodiments, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2, the amino acid substitutions being selected from [selected from].

[0134] (1) L9H or L9M;

[0135] (2)C10M;

[0136] (3) F27A;

[0137] (4)F36W;

[0138] (5) W40V;

[0139] (6) R42V;

[0140] (7) K47M or K47S;

[0141] (8)A59F;

[0142] (9)Y72W;

[0143] (10)T77V;

[0144] (11) Y81R or Y81N;

[0145] (12)L97M;

[0146] (13) K114S; or

[0147] (14)A152S.

[0148] In some embodiments, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2:

[0149] (1) R42V, the mutant comprising an amino acid sequence as shown in SEQ ID NO.14 or a nucleotide sequence as shown in SEQ ID NO.13;

[0150] (2) A59F, the mutant comprising an amino acid sequence as shown in SEQ ID NO. 6 or a nucleotide sequence as shown in SEQ ID NO. 5;

[0151] (3) T77V, the mutant comprising an amino acid sequence as shown in SEQ ID NO.12 or a nucleotide sequence as shown in SEQ ID NO.11;

[0152] (4) Y81R, the mutant comprising an amino acid sequence as shown in SEQ ID NO.10 or a nucleotide sequence as shown in SEQ ID NO.9;

[0153] (5) K114S, the mutant comprising an amino acid sequence as shown in SEQ ID NO.4 or a nucleotide sequence as shown in SEQ ID NO.3;

[0154] (6) A152S, the mutant comprising an amino acid sequence as shown in SEQ ID NO.8 or a nucleotide sequence as shown in SEQ ID NO.7.

[0155] In some preferred embodiments, the mutant contains a K114S substitution in the amino acid sequence shown in SEQ ID NO.2.

[0156] In some preferred embodiments, the mutant comprises an amino acid sequence as shown in SEQ ID NO.4.

[0157] In some embodiments, the method further includes mutating the CrtZ_9BACT mutant using enzyme engineering techniques.

[0158] In some implementations, the mutation can be performed in one or more rounds (e.g., two rounds, three rounds, etc.).

[0159] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, the positions of which are selected from [specific locations].

[0160] L9, C10, F27, F36, W40, K47, A59, Y72, T77, Y81, L97, A152.

[0161] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, the amino acid substitutions being selected from:

[0162] (1) L9H or L9M;

[0163] (2)C10M;

[0164] (3) F27A;

[0165] (4)F36W;

[0166] (5) W40V;

[0167] (6) K47M or K47S;

[0168] (7)A59F;

[0169] (8)Y72W;

[0170] (9)T77V;

[0171] (10) Y81R or Y81N;

[0172] (11)L97M; or

[0173] (12)A152S.

[0174] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, the amino acid substitutions being selected from:

[0175] (1) L9H, the mutant comprising the amino acid sequence shown in SEQ ID NO. 16 or the nucleotide sequence shown in SEQ ID NO. 15; or L9M, the mutant comprising the amino acid sequence shown in SEQ ID NO. 18 or the nucleotide sequence shown in SEQ ID NO. 17; or

[0176] (2)W40V, the mutant contains an amino acid sequence as shown in SEQ ID NO.20 or a nucleotide sequence as shown in SEQ ID NO.19.

[0177] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, the amino acid substitutions being selected from:

[0178] (1) C10M, the mutant comprising an amino acid sequence as shown in SEQ ID NO.22 or a nucleotide sequence as shown in SEQ ID NO.21;

[0179] (2) F36W, the mutant comprising an amino acid sequence as shown in SEQ ID NO.24 or a nucleotide sequence as shown in SEQ ID NO.23;

[0180] (3) K47M, the mutant comprising the amino acid sequence shown in SEQ ID NO.26 or the nucleotide sequence shown in SEQ ID NO.25; or K47S, the mutant comprising the amino acid sequence shown in SEQ ID NO.28 or the nucleotide sequence shown in SEQ ID NO.27;

[0181] (4) Y72W, the mutant comprising an amino acid sequence as shown in SEQ ID NO.30 or a nucleotide sequence as shown in SEQ ID NO.29;

[0182] (5) T77V, the mutant comprising the amino acid sequence shown in SEQ ID NO. 32 or the nucleotide sequence shown in SEQ ID NO. 31; or

[0183] (6)Y81N, the mutant comprising an amino acid sequence as shown in SEQ ID NO.34 or a nucleotide sequence as shown in SEQ ID NO.33.

[0184] In some preferred embodiments, the mutant further includes an L9H substitution in the amino acid sequence shown in SEQ ID NO.4.

[0185] In some preferred embodiments, the mutant comprises an amino acid sequence as shown in SEQ ID NO.16.

[0186] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.16, the positions of which are selected from:

[0187] H9, C10, F27, F36, W40, K47, A59, Y72, T77, Y81, L97, A152.

[0188] In some embodiments, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.16, the amino acid substitutions being selected from:

[0189] (1)H9M;

[0190] (2)C10M;

[0191] (3) F27A;

[0192] (4)F36W;

[0193] (5) W40V;

[0194] (6) K47S;

[0195] (7)A59F;

[0196] (8)Y72W;

[0197] (9)T77V;

[0198] (10) Y81R or Y81N;

[0199] (11)L97M; or

[0200] (12)A152S.

[0201] In some embodiments, the mutant further comprises substitutions selected from any of the following at amino acid sequence positions as shown in SEQ ID NO. 16:

[0202] (1) H9M+F27A+A152S, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.36 or a nucleotide sequence as shown in SEQ ID NO.35;

[0203] (2) T77V, the mutant comprising an amino acid sequence as shown in SEQ ID NO.38 or a nucleotide sequence as shown in SEQ ID NO.37;

[0204] (3) F36W+W40V+T77V, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.40 or a nucleotide sequence as shown in SEQ ID NO.39;

[0205] (4) F36W+W40V+Y72W+T77V, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.42 or a nucleotide sequence as shown in SEQ ID NO.41;

[0206] (5) F36W+W40V, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.44 or a nucleotide sequence as shown in SEQ ID NO.43;

[0207] (6) W40V, the mutant comprising an amino acid sequence as shown in SEQ ID NO.46 or a nucleotide sequence as shown in SEQ ID NO.45;

[0208] (7) F36W+W40V+K47S, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.48 or a nucleotide sequence as shown in SEQ ID NO.47;

[0209] (8) Y81N, the mutant comprising an amino acid sequence as shown in SEQ ID NO.50 or a nucleotide sequence as shown in SEQ ID NO.49;

[0210] (9) Y81R+A152S, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.52 or a nucleotide sequence as shown in SEQ ID NO.51;

[0211] (10)C10M+F36W+W40V+T77V, wherein the mutant contains an amino acid sequence as shown in SEQ ID NO.54 or a nucleotide sequence as shown in SEQ ID NO.53;

[0212] (11) H9M+F27A+A59F+Y81R+L97M+A152S, wherein the mutant comprises an amino acid sequence as shown in SEQ ID NO.56 or a nucleotide sequence as shown in SEQ ID NO.55; or

[0213] (12)W40V+K47S, the mutant comprising an amino acid sequence as shown in SEQ ID NO.58 or a nucleotide sequence as shown in SEQ ID NO.57.

[0214] In some preferred embodiments, the mutant contains an H9M+F27A+A152S substitution in the amino acid sequence shown in SEQ ID NO.16.

[0215] In some preferred embodiments, the mutant comprises an amino acid sequence as shown in SEQ ID NO.36.

[0216] In a sixth aspect, the present invention provides a genetically engineered bacterium for producing zeaxanthin, wherein the genetically engineered bacterium comprises β-carotene hydroxylase CrtZ_9BACT, the above-mentioned mutant, or the above-mentioned expression vector.

[0217] In some implementations, the genetically engineered bacteria is Yersinia lipophila.

[0218] In some implementations, the genetically engineered bacteria is recombinant Yersinia lipolytica.

[0219] In some embodiments, the genetically engineered bacteria is a recombinant Yersinia lipophila strain BOTA01017.

[0220] In some embodiments, the β-carotene hydroxylase CrtZ_9BACT is derived from Fulvivirgaimtechensis AK7.

[0221] In a seventh aspect, the present invention provides the application of the above-mentioned genetically engineered bacteria, the above-mentioned mutants, the above-mentioned nucleic acids, the above-mentioned expression vectors, the above-mentioned host cells, or the above-mentioned methods in the preparation of zeaxanthin.

[0222] The sequence list used in this article is as follows:

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235] Note: * represents a stop codon; N represents any one of the bases A, T, C, or G; K represents any one of the bases A, T, or G.

[0236] Advantages of this invention

[0237] This invention provides a genetically engineered bacterium that synthesizes zeaxanthin more efficiently. By using enzyme engineering technology to mutate the wild-type CrtZ_9BACT, the CrtZ_9BACT mutant can further increase the activity of β-carotene hydroxylase. Ultimately, compared with the wild type, the activity of β-carotene hydroxylase is increased by ~4 times. Attached Figure Description

[0238] Figure 1 The image of the DNA6336T plasmid in Example 1 is shown.

[0239] Figure 2 The plasmid vector map in Example 2 is shown.

[0240] Figure 3 The performance of CrtZ_9BACT in producing zeaxanthin in a high-β-carotene-producing strain is shown in Example 2.

[0241] Figure 4 The results of the point saturation mutant library screening based on wild-type CrtZ_9BACT in Example 4 are shown.

[0242] Figure 5 The results of point saturation mutation library screening based on CrtZ_9BACT_2.0 in Example 5 are shown.

[0243] Figure 6 The results of screening the combined mutant library based on CrtZ_9BACT_3.0 in Example 6 are shown. Detailed Implementation

[0244] For the purpose of clarity and concise description, features are described herein as part of a number of identical or separate embodiments. However, it will be understood that the scope of this disclosure may include embodiments having combinations of all or some of the described features. The technical solutions of the present invention will now be described clearly and completely. Obviously, based on the specific embodiments of the present invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of the present invention.

[0245] I. Definition

[0246] In this disclosure, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, chemistry-related terms and laboratory procedures used herein are all widely used terms and routine procedures in their respective fields. To better understand this disclosure, definitions and explanations of relevant terms are provided below.

[0247] As used herein, the terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., meaning “including but not limited to”). “Multiple” as used in this disclosure refers to two or more. “And / or” describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A alone, A and B simultaneously, or B alone. The character “ / ” generally indicates an “or” relationship between the preceding and following related objects, while the character “+” generally indicates an “and” relationship.

[0248] As used herein, references to “some embodiments,” “some implementations,” or “some implementation schemes” describe a subset of all possible embodiments, but it is understood that “some embodiments” may be the same subset or different subsets of all possible embodiments and may be combined with each other without conflict.

[0249] As used herein, the terms “optional,” “any,” “arbitrary,” or “any one” mean that the event or situation described below may, but does not have to, occur, including the circumstances in which the event or situation occurs or does not occur. As used herein, “a” and “an” are used in this disclosure to refer to one or more grammatical objects.

[0250] As used in this article, the term "zeaxanthin," also known as "zeaxanthin," "zeaxanthin," or "3,3'-dihydroxy-β-carotene," is a fat-soluble pigment component of the xanthophyll class and a dihydroxy derivative of β-carotene. Zeaxanthin is abundant in plant tissues such as green vegetables, corn seeds, goji berries, and tartary berries, as well as in some non-photosynthetic bacteria.

[0251] The term "Yarrowia lipolytica" as used in this article refers to an unconventional yeast belonging to the class Hemiascomycetes. Yarrowia lipolytica is widely used in the production of food additives. Its applications in the biosynthesis of natural products include the fermentation production of fatty acids and lipids, terpenoids, flavonoids, and other bioactive products such as succinic acid, pyruvic acid, α-ketoglutarate, adipic acid, erythritol, and cordycepin.

[0252] As used in this article, β-carotene hydroxylase (CrtZ) is a non-heme ferrous hydroxylase encoded by the β-carotene hydroxylase gene (BCH), which is widely found in organisms such as plants, cyanobacteria, and bacteria. This gene has been isolated from Arabidopsis thaliana, citrus, bell pepper, cyanobacteria, and bacteria. The substrate preference and catalytic efficiency of CrtZ may vary in different organisms, making it a promising candidate for heterologous synthesis of carotenoids.

[0253] As used herein, the term "mutant" or "variant" refers to a molecule whose base or amino acid sequence differs from that of a reference polynucleotide or polypeptide (naturally occurring), whether artificially synthesized or naturally generated. These differences include any desired combination of substitutions, insertions, deletions, or such variations in the natural polynucleotide encoding the amino acid sequence.

[0254] As used herein, the terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleotide sequence,” and “polynucleotide” are used interchangeably and refer to a polymer of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, the term includes, but is not limited to, single-stranded or double-stranded DNA or RNA, genomic DNA, cDNA, DNA / RNA hybrids, or polymers comprising, consisting of, or substantially consisting of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases.

[0255] As used herein, the terms “protein,” “peptide,” “polypeptide,” and “amino acid sequence” are used interchangeably and, in their broadest sense, refer to a polymer of two or more amino acid subunits, amino acid analogs, or peptide mimics. “Protein,” “peptide,” “polypeptide,” and “amino acid sequence” contain at least two amino acids, and there is no limit to the maximum number of amino acids. The term “amino acid” as used herein refers to natural and / or non-natural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0256] Equivalents having one or more amino acid modifications compared to the protein or amino acid sequence described herein are also covered within the scope of this invention, provided that such one or more amino acid modifications do not affect or substantially do not affect the activity of the protein or amino acid sequence. In this document, amino acid modifications can be amino acid substitutions, amino acid deletions, or amino acid insertions. Amino acid substitutions can be conserved or non-conserved. A conserved substitution (also called a conserved mutation, conserved replacement, or conserved variation) is an amino acid substitution in a protein that changes a given amino acid to a different amino acid having similar biochemical properties (e.g., charge, hydrophobicity, or size). In this document, "conserved substitution" means that an amino acid residue is replaced by another biologically similar residue. Examples of conserved substitutions include one hydrophobic residue such as isoleucine, valine, leucine, or methionine replacing another; or one charged or polar residue replacing another, such as arginine replacing lysine, glutamic acid replacing aspartic acid, glutamine replacing asparagine, etc. Other exemplary examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine, or glutamic acid; diphenylalanine to tyrosine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine, etc.

[0257] As used herein, the term "substitution" variant is a variant in which at least one amino acid residue in the natural sequence is removed and replaced by a different amino acid at the same position. The substitution can be single, where only one amino acid is replaced in the molecule; or it can be multiple, where two or more amino acids are replaced in the same molecule. Multiple substitutions can be located at consecutive sites. Similarly, an amino acid can be replaced by multiple residues, and such variants include both substitution and insertion. An "insertion" variant is a variant in which one or more amino acids are inserted into an amino acid immediately adjacent to a specific position in the natural sequence. An adjacent amino acid is defined as one attached to the α-carboxyl or α-amino functional group of that amino acid. A "deletion" variant is a variant in which one or more amino acids are removed from the natural amino acid sequence. Typically, deletion variants have one or two amino acids missing from a specific region of their molecule.

[0258] Enzymes are identified herein by the reactions they catalyze, and unless otherwise stated, an enzyme refers to any polypeptide capable of catalyzing the identified reaction. Unless otherwise stated, enzymes can originate from any organism and can have native or mutated amino acid sequences. It is well known that enzymes may sometimes have multiple functions and / or multiple names due to differences in the organism from which they originate. The enzyme names used herein encompass orthologs, including enzymes that may have one or more additional functions or different names.

[0259] As used herein, the term "host cell" is a cell used to receive, maintain, replicate, and amplify a vector. Host cells can also be used to express the polypeptide encoded by the vector. When the host cell divides, the nucleic acids contained in the vector replicate, thereby amplifying the nucleic acids. Host cells can be eukaryotic or prokaryotic cells. Suitable host cells include, but are not limited to, yeast cells.

[0260] As used herein, the term "vector" is a reproducible nucleic acid from which one or more heterologous proteins can be expressed when the vector is transformed into a suitable host cell. Vectors include those into which nucleic acids encoding polypeptides or fragments thereof can be introduced, typically through restriction enzyme digestion and ligation. Vectors also include those containing nucleic acids encoding polypeptides. Vectors are used to introduce nucleic acids encoding polypeptides into host cells for amplification of nucleic acids or for expression / display of the polypeptide encoded by the nucleic acid. Vectors are typically kept free but can be designed to integrate genes or portions thereof into the chromosome of the genome. Vectors for artificial chromosomes, such as yeast artificial vectors and mammalian artificial chromosomes, are also considered. The selection and use of such vectors are well known to those skilled in the art.

[0261] As used herein, the term "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the transcribed mRNA is subsequently translated into peptides, polypeptides, amino acid sequences, or proteins. If the nucleic acid sequence originates from genomic DNA, expression may include the splicing of mRNA in eukaryotic cells.

[0262] As used herein, the term "expression vector" includes a vector capable of expressing DNA operatively linked to regulatory sequences, such as promoter regions, that influence the expression of such DNA fragments. These additional fragments may include promoter and terminator sequences and optionally include one or more origins of replication, one or more selection markers, enhancers, polyadenylation signals, etc. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, bacteriophage, recombinant virus, or other vector, which, when introduced into a suitable host cell, results in the expression of clonal DNA. Suitable expression vectors are well known to those skilled in the art and include reproducible expression vectors in eukaryotic and / or prokaryotic cells, as well as expression vectors that remain free or are integrated into the host cell genome.

[0263] When the term "coding" is applied to a nucleic acid sequence, it refers to a nucleic acid sequence that, if in its natural state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and / or translated to produce a polypeptide, is called a "coding" polypeptide sequence. Therefore, a "coding sequence" is a nucleic acid sequence that has the aforementioned function, and it can be DNA or RNA (e.g., mRNA).

[0264] As used herein, the term "coding gene" includes "coding sequence" and may optionally include other nucleotide sequence elements used to regulate gene expression, such as promoters and terminators. In a "coding gene," the coding sequence and other nucleotide sequence elements are arranged in a suitable order to promote the proper expression of the encoded protein.

[0265] As used herein, the term "homology" or "identity" refers to the sequence similarity between two polypeptides or two nucleic acid sequences. The percentage of identity can be determined by comparing positions in each sequence, which can be aligned for comparison purposes. When a position in a compared sequence is occupied by the same base or amino acid, the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. Tools for comparing sequence similarity are well known to those skilled in the art; for example, the alignment and percentage of sequence identity of the nucleic acid or amino acid sequences provided herein can be obtained by importing the nucleic acid or amino acid sequence into ClustalW (available from https: / / genome.jp / toolsbin / clustalw / ) and using ClustalW.

[0266] As used herein, the term "promoter" refers to an expression control sequence that controls the initiation and efficiency of gene or transgene transcription. Promoters can be, for example, constitutive, inducible, repressive, or tissue-specific. Promoters may contain genetic elements that regulate proteins and molecules such as RNA polymerases and transcription factors to which they can bind. The promoters used in this article include pTEFin.

[0267] As used herein, the term "recombination" refers to the process of re-covalent recombination of genetic information within or between DNA molecules. When applied to specific microorganisms, such as *Yarrowia lipolytica* as described in this invention, the term "recombination" means that, through artificial intervention, *Yarrowia lipolytica* acquires certain different characteristics compared to the starting strain, such as increased zeaxanthin production. Those skilled in the art will understand that "genetically engineered bacteria" is not limited to strains modified through genetic engineering; strains containing the gene-damaging processes described in this invention, obtained through UV mutagenesis or chemical mutagenesis, should also be included within the scope of "genetically engineered bacteria" as described in this invention.

[0268] Microbial cells can be cultured in any suitable culture medium, including but not limited to basal media, which contain the minimum nutrients possibly required for cell growth. A basal medium typically contains: (1) a carbon source for microbial growth; (2) salts, which may depend on the specific microbial cell and growth conditions; and (3) water. Suitable culture media may also include any combination of the following: nitrogen sources required for growth and product formation; sulfur sources required for growth; phosphate sources required for growth; metal salts required for growth; vitamins required for growth; and other cofactors required for growth.

[0269] As used herein, the term "Gibson assembly" is a recombination-based molecular cloning method for the in vitro assembly of DNA fragments. The core principle of Gibson assembly relies on three enzymes: a DNA exonuclease, a high-fidelity DNA polymerase, and a thermostable DNA ligase. First, the T5 exonuclease digests the DNA fragments from the 5' to the 3' direction, with each fragment forming a single-stranded overhang. Because these adjacent overhangs share some homology, they undergo complementary annealing. Then, the high-fidelity DNA polymerase fills the gaps in the annealed fragments, and the thermostable DNA ligase finally seals the gaps in the assembled DNA, generating a completely sealed double-stranded DNA molecule.

[0270] As used in this article, site-saturation mutagenesis is a protein engineering technique that modifies the coding gene of a target protein to obtain a target site amino acid that is replaced by 19 other natural amino acids. Common methods of site-saturation mutagenesis include: (1) Oligonucleotide directed mutagenesis: The target gene is cloned into a single-stranded expression vector of bacteriophage M13, a primer containing a mutant oligonucleotide at the target site is synthesized, and it is paired with the target gene. Then, four deoxyribonucleoside triphosphates (dNTPs) and Clento polymerase are added to extend the oligonucleotide primer into a full-length gene. The resulting recombinant double-stranded DNA molecule is transfected into bacteria and replicated in large quantities, and then positive mutants are screened out; (2) Cassette mutagenesis: A codon box containing a mutant target site and a special enzyme cleavage site sequence is used to introduce a mutant sequence; (3) Site-saturation mutagenesis based on polymerase chain reaction (PCR): Degenerative primers are designed at the target site to amplify the target gene to obtain mutants, which is further divided into mutant primer mutagenesis and overlap extension mutagenesis.

[0271] II. Examples

[0272] The present invention will be described in detail below through specific embodiments. It should be understood that the following embodiments are for explanation and illustration only and do not limit the scope of the present invention in any way.

[0273] In the following embodiments, unless otherwise specified, all biochemical reagents are conventional reagents in the art, which can be prepared according to conventional methods in the art or obtained commercially, and the specification is laboratory grade.

[0274] Example 1: Materials and Methods

[0275] 1. Starting strain

[0276] For a more detailed construction process of the embodiments of the present invention, please refer to Embodiments 1 and 2 of CN119799531A.

[0277] Using *Yarrowia lipolytica* as the starting strain, the wild-type strain Po1f (purchased from ATCC, MAY-2613, genotype MATAura3-302leu2-270xpr-322axp2-deltaNU49 XPR2::SUC2) was transformed into plasmid DNA6336, which expresses the complete β-carotene pathway genes (CarB / CarRP / CrtE), to obtain the β-carotene-producing strain BOTA01023. The plasmid map of DNA6336 is shown below. Figure 1 As shown, DNA6336 is a circular plasmid containing only the pBR322 sequence used for replication in E. coli. After whole-genome sequencing of BOTA01023, it was found that the plasmid was successfully integrated into the Locus 1 site within 500 bp upstream and downstream.

[0278] Subsequently, based on strain BOTA01023, CarB gene expression was introduced into the genome. The linear donor DNA ADD5278 carrying the CarB gene was transformed into strain BOTA01023 to obtain strain BOTA01025. ADD5278 was amplified using SOE (Genesplicing by overlap extension PCR, https: / / doi.org / 10.1038 / nprot.2007.132). First, the LEU2 expression cassette was amplified using primers 18211-F and 18211-R, then the CarB expression cassette was amplified using primers 17881-F and 17881-R. Subsequently, using these two fragments as templates, the two fragments were overlapped and spliced ​​together using primers 18211-F and 17881-R. After whole-genome sequencing verification, the integration site of the linear donor DNA ADD5278 was Locus 2.

[0279] Subsequently, based on strain BOTA01025, DGA1 gene expression was introduced into the genome. First, using the aforementioned tag gene recovery method, strains with recovered tag genes were obtained. Then, the linear donor DNA ADD6303 carrying the DGA1 gene was transformed into strain BOTA01025, overexpressing DGA1 to obtain strain BOTA01027. The amplification primers for ADD6306 were ADD_LEUF and GSY_R. After whole-genome sequencing verification, the integration site of the linear donor DNA ADD6306 was Locus 3.

[0280] Subsequently, based on strain BOTA01027, tHMGR gene expression was introduced into the genome. First, using the aforementioned tag gene recovery method, strains with recovered tag genes were obtained. Then, the linear donor DNAADD5976 was transformed into strain BOTA01027, and tHMGR was overexpressed to obtain the starting strain BOTA01017 disclosed herein.

[0281] 2. Culture medium formulation

[0282] Escherichia coli culture medium: LB-Amp medium, with the following formula: 10g peptone, 5g yeast extract, 10g NaCl, 1L deionized water, and 100mg / L ampicillin (Amp) added after sterilization; if it is a solid culture medium, an additional 2% (20g / L) concentration of agar powder needs to be added.

[0283] YPD (Yeast Extract) medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L; if it is a solid medium, an additional 2% (20 g / L) concentration of agar powder is required.

[0284] YPD-Hph lipophilic yeast medium: 500 mg / L hygromycin (Hph) is added to sterile YPD medium.

[0285] 3.1 PCR reaction system and procedure:

[0286] DNA fragment amplification system:

[0287] The 50 μL reaction mixture contained 25 μL of Q5 DNA polymerase mix, 2.5 μL each of upstream and downstream primers, 1 μL of template, and 19 μL of ddH2O. The PCR cycling program was as follows: pre-denaturation at 98 °C for 2 min, denaturation at 98 °C for 10 s, annealing at 55 °C for 10 s, extension at 72 °C for 30 s / kb, for 31 cycles; extension at 72 °C for 3 min, and storage at 4 °C. The PCR product was purified using magnetic beads.

[0288] PCR reaction system and procedure for constructing point-saturated mutant libraries:

[0289] The 20 μl reaction mixture contained 0.6 μL KOD-Plus-Neo (1.0 U / μL), 2 μL 10X KOD-Plus-Neo buffer, 0.2 μL DMSO, 1.2 μL MgSO4 (25 mM), 2 μL 2 mM dNTP, 0.04 μL upstream primer (10 μM), 4 μL downstream primer (100 nM), 2 μL template (10 ng / μL), and ddH2O to make up to 20 μL. The PCR cycling program was as follows: pre-denaturation at 94℃ for 2 min, denaturation at 98℃ for 10 s, annealing at 60℃ for 20 s, extension at 68℃ for 20 s, for 10 cycles (this step generates large primers); denaturation at 98℃ for 10 s, annealing at 60℃ for 20 s, extension at 68℃ for 3 min, for 20 cycles; extension at 68℃ for 7 min, and storage at 4℃ (this step is for whole plasmid PCR).

[0290] Combinatorial mutation involves the two steps mentioned above.

[0291] 3.2 Gibson Reaction System and Procedure:

[0292] First, the backbone and the fragment to be inserted are amplified using PCR. Primers are designed to ensure that the two DNA fragments to be ligated have a 30-40 bp homologous region at their interface. Then, the purified PCR product is mixed with Gibson... Mix with Master Mix (NEB) and incubate at 50°C for 60 minutes to assemble the plasmid backbone and DNA fragments. The Gibson assembly reaction volume is 20 μL. The specific reaction system is as follows: Gibson... Add 15 μL of Master Mix, 0.03 pmol of plasmid backbone, 0.03 pmol of DNA fragment, and ddH2O to a final volume of 20 μL.

[0293] 3.3 Methods for detecting carotenoids:

[0294] Both zeaxanthin and β-carotene can be detected using this method. Take 20 μl of bacterial culture, add 750 μl of extraction buffer (dimethyl sulfoxide: ethyl acetate: methanol = 1:0.5:1), shake at 2000 rpm for 20 minutes, sonicate at 25°C for 10 minutes, shake on a shaker at 1500 rpm for 60 minutes at 30°C, and then centrifuge at 4000 rpm for 20 minutes at 25°C. Collect the supernatant for ultra-high performance liquid chromatography (HPLC) analysis. For preliminary screening, RapidFire analysis of the extract was used to determine carotenoid production. For repeated screening, at least three technical replicates were performed for each best-performing library member, and HPLC analysis of the extract was used for more accurate quantification of carotenoid production.

[0295] Example 2: Verification of CrtZ_9BACT and β-carotene hydroxylase activity in recombinant Yersinia lipolytica

[0296] The codon-optimized β-carotene hydroxylase gene CrtZ_9BACT (SEQ ID NO.1) was cloned into a suitable plasmid vector for expression in *Yersinia lipolytica*, and expressed in recombinant *Yersinia lipolytica* BOTA01017 under the constitutive promoter pTEFin. CrtZ_9BACT is derived from *Fulvivirga imtechensis* AK7. The plasmid vector map is shown below. Figure 2 As shown, it contains the pBR322 sequence for replication in *E. coli*, the ARS1 sequence for replication in *Yersinia lipolytica*, the ampicillin sequence for selection in *E. coli*, and the hygromycin sequence for selection in *Yersinia lipolytica*. *E. coli* DH5α is used for cloning and DNA amplification.

[0297] The constructed plasmid expressing the β-carotene hydroxylase CrtZ_9BACT (SEQ ID NO.2) was transformed into a recombinant *Yersinia lipolytica* strain that produces high levels of β-carotene. The activity of this β-carotene hydroxylase was verified by detecting the zeaxanthin yield using HPLC. The results showed that CrtZ_9BACT (SEQ ID NO.2) possesses β-carotene hydroxylase activity and can convert β-carotene to zeaxanthin in *Yersinia lipolytica*, with a final zeaxanthin yield of 42 mg / L. Figure 3 ).

[0298] Example 3: Construction of the CrtZ_9BACT library

[0299] Enzyme libraries (including site-saturated mutant libraries and combinatorial libraries) were constructed using the MegaWHOP and SOE methods, then cloned into the vector described in Example 2 and transformed into *E. coli* DH5α. For the construction of site-saturated mutant libraries, degenerate primers were designed using NNK to introduce saturation mutations at each desired position. For example, for the mutation at the M21 site, the upstream primer CGCTACGTTTCTGTTCNNKGAGTTCGTCGCATGGTT (SEQ ID NO. 59) was designed to introduce the target site mutation, containing a three-nucleotide sequence randomly generated by NNK. The downstream primers for all sites were fixed as GCCATGATCCAACTACGTACG (SEQ ID NO. 60). Each degenerate primer was used to obtain a large primer by conventional PCR with the downstream primer, and large primer PCR (MegaWHOP) was used to generate a complete plasmid with a single-site saturation mutation. All MegaWHOP products were then mixed and transformed to generate a merged site-saturated library. Sequence-defined primers were designed to introduce programmed mutations into the combinatorial mutant library. Each primer contained one, multiple, or no mutation in each region where a mutation was to be introduced. Multiple primers for each mutated region were mixed in equimolar amounts for initial PCR. Further PCR was performed to fuse all initial PCR products, resulting in a combined library with all desired mutations. The SOE products were then assembled into a suitable *Yarrowia lipolytica* expression vector using the Gibson assembly method, and subsequently transformed into *E. coli* DH5α to obtain single colonies. All transformants were collected and used for small-scale preparation to isolate the DNA library. The DNA library was then transformed into a high-β-carotene-producing recombinant *Yarrowia lipolytica* strain to assess the activity of the enzyme library.

[0300] Example 4: Identification of the second-generation CrtZ_9BACT variant

[0301] A point-saturated mutant library based on CrtZ_9BACT (SEQ ID NO.2) was transformed into a recombinant *Yersinia lipolytica* strain that produces high levels of β-carotene using a chemical transformation method. After transformation, single clones were picked and cultured in 96-well plates containing pre-medium (*Yersinia lipolytica* YPD-Hph medium) at 30°C for one day in a shaker. The resulting culture was then transferred to new 96-well plates containing fresh *Yersinia lipolytica* YPD-Hph medium and cultured in a shaker at 30°C for three days. The products were detected and analyzed using RapidFire or HPLC after culturing. The activity of the improved enzyme relative to the wild-type sequence CrtZ_9BACT (SEQ ID NO.2) was evaluated using zeaxanthin titer. The results are shown in Table 1 and... Figure 4 middle.

[0302] Table 1. Results of the first round of screening of point saturation mutant libraries

[0303]

[0304]

[0305] From Table 1 and Figure 4 It can be seen that the mutant K114S has the best effect compared with the wild-type CrtZ_9BACT (SEQ ID NO.2). SEQ ID NO.4 is designated as the second-generation CrtZ_9BACT (CrtZ_9BACT_2.0) and used as the parent enzyme for the next round of modification.

[0306] Example 5: Identification of the third-generation CrtZ_9BACT variant

[0307] A point-saturated mutant library based on CrtZ_9BACT_2.0 (SEQ ID NO.4) was transformed into a recombinant lipophilic yeast strain producing high levels of β-carotene using a chemical transformation method. After transformation, single clones were picked and cultured in 96-well plates containing pre-culture medium at 30°C for one day. The resulting culture was then transferred to new 96-well plates containing fresh culture medium and cultured in 30°C for three days. The products were detected and analyzed using RapidFire or HPLC, and the activity of the improved enzyme relative to CrtZ_9BACT_2.0 (SEQ ID NO.4) was evaluated using zeaxanthin titer. The results are shown in Table 2 and... Figure 5 As shown, the L9H mutation exhibited superior titer enhancement in this round of library screening, with a 20% increase in activity compared to CrtZ_9BACT_2.0. SEQ ID NO.16 was designated as the third-generation CrtZ_9BACT (CrtZ_9BACT_3.0) and used as the parent enzyme for the next round of modification.

[0308] Table 2. Results of the second round of screening of point saturation mutant libraries

[0309]

[0310] In addition to improved potency, this round of screening also noted that some mutants could increase the proportion of zeaxanthin in carotenoid products (the proportion of zeaxanthin in carotenoid products of the control strain expressing CrtZ_9BACT_2.0 (SEQ ID NO.4) was 22%). These sites will also be used in the design of combinatorial mutant libraries, and specific information is listed in Table 3.

[0311] Table 3. Detailed information on each mutant

[0312]

[0313] Example 6: Identification of the fourth-generation CrtZ_9BACT variant

[0314] A combined mutant library based on CrtZ_9BACT_3.0 (SEQ ID NO.16) (constructed based on sites selected from the first two rounds of single-point saturated mutant library screening and reported sites F27A and L97M) was transformed into a high-β-carotene-producing recombinant Yersinia lipolytica strain using chemical transformation. After transformation, single clones were picked and cultured in 96-well plates containing pre-cultured medium for one day at 30°C using a shaker. The resulting culture was then transferred to new 96-well plates containing fresh cultured medium and cultured in 30°C using a shaker for three days. The products were then detected and analyzed using RapidFire or HPLC. The activity of the improved enzyme relative to CrtZ_9BACT_3.0 (SEQ ID NO.16) was evaluated using zeaxanthin titer. The results are shown in Table 4 and [Table 5]. Figure 6 In this round of library screening, the combined mutations of H9M, F27A, and A152S showed the best titer enhancement, with an activity increase of 39% compared to CrtZ_9BACT_3.0. SEQ ID NO.36 was designated as the fourth-generation CrtZ_9BACT (CrtZ_9BACT_4.0), and ultimately, compared to wild-type CrtZ_9BACT, CrtZ_9BACT_4.0 showed a ~4-fold increase in β-carotene hydroxylase activity.

[0315] Table 4. Results of screening combined mutant libraries

[0316]

[0317] The specific embodiments of the present invention have been described in detail above, but they are merely examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention are covered within the scope of the present invention.

Claims

1. A β-carotene hydroxylase mutant, wherein, The mutation is the deletion, addition, and / or substitution of one or more amino acids based on the amino acid sequence of wild-type CrtZ_9BACT.

2. The mutant according to claim 1, wherein the wild-type CrtZ_9BACT comprises the amino acid sequence shown in SEQ ID NO. 2; Preferably, the mutation is generated through point saturation mutation and / or combined mutation; Preferably, the mutant comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 95% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 96% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 97% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 98% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 99% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 95.5% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 96.2% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 96.8% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 97.5% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 98.1% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 98.7% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that is 99.4% identical to the amino acid sequence shown in SEQ ID NO.

2.

3. The mutant according to claim 2, wherein, The mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2, wherein the positions of the amino acid substitutions are selected from: L9, C10, F27, F36, W40, R42, K47, A59, Y72, T77, Y81, L97, K114, A152; Preferably, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2, wherein the amino acid substitutions are selected from: (1) L9H or L9M; (2)C10M; (3)F27A; (4)F36W; (5) W40V; (6) R42V; (7) K47M or K47S; (8)A59F; (9)Y72W; (10)T77V; (11) Y81R or Y81N; (12)L97M; (13) K114S; or (14)A152S; More preferably, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2, wherein the amino acid substitutions are selected from: (1) R42V; (2)A59F; (3)T77V; (4)Y81R; (5) K114S; or (6)A152S.

4. The mutant according to claim 3, wherein, The mutant contains a K114S substitution in the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence as shown in SEQ ID NO.

4.

5. The mutant according to claim 4, wherein, The mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, wherein the positions of the amino acid substitutions are selected from: L9, C10, F27, F36, W40, K47, A59, Y72, T77, Y81, L97, A152; Preferably, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, wherein the amino acid substitutions are selected from: (1) L9H or L9M; (2)C10M; (3)F27A; (4)F36W; (5) W40V; (6) K47M or K47S; (7)A59F; (8)Y72W; (9)T77V; (10) Y81R or Y81N; (11)L97M; or (12)A152S; More preferably, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, wherein the amino acid substitutions are selected from: (1) L9H or L9M; or (2) W40V; More preferably, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, wherein the amino acid substitutions are selected from: (1)C10M; (2)F36W; (3) K47M or K47S; (4)Y72W; (5) T77V; or (6)Y81N.

6. The mutant according to claim 5, wherein, The mutant further includes an L9H substitution in the amino acid sequence shown in SEQ ID NO.4; Preferably, the mutant comprises an amino acid sequence as shown in SEQ ID NO.

16.

7. The mutant according to claim 6, wherein, The mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.16, wherein the positions of the amino acid substitutions are selected from: H9, C10, F27, F36, W40, K47, A59, Y72, T77, Y81, L97, A152; Preferably, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.16, wherein the amino acid substitutions are selected from: (1)H9M; (2)C10M; (3)F27A; (4)F36W; (5) W40V; (6) K47S; (7)A59F; (8)Y72W; (9)T77V; (10) Y81R or Y81N; (11)L97M; or (12)A152S; Preferably, the mutant further comprises substitutions selected from any of the following groups at amino acid sequence positions as shown in SEQ ID NO. 16: (1)H9M+F27A+A152S; (2)T77V; (3)F36W+W40V+T77V; (4)F36W+W40V+Y72W+T77V; (5) F36W+W40V; (6) W40V; (7)F36W+W40V+K47S; (8)Y81N; (9)Y81R+A152S; (10)C10M+F36W+W40V+T77V; (11)H9M+F27A+A59F+Y81R+L97M+A152S; or (12)W40V+K47S; More preferably, the mutant further includes an H9M+F27A+A152S substitution in the amino acid sequence shown in SEQ ID NO.16; More preferably, the mutant comprises an amino acid sequence as shown in SEQ ID NO.

36.

8. Nucleic acids, among which, The nucleic acid encodes the mutant according to any one of claims 1-7.

9. Expression carriers, among which, The expression vector comprises the nucleic acid as described in claim 8.

10. Host cells, among which, The host cell comprises the nucleic acid of claim 8 or the expression vector of claim 9; Preferably, the host cell is *Yarrowia lipolytica*. Preferably, the host cell is recombinant Yersinia lipolytica; Preferably, the host cell is a recombinant Yersinia lipophila strain BOTA01017; Preferably, the recombinant Yersinia lipolytica also produces β-carotene.

11. A method for preparing zeaxanthin, wherein, The method produces zeaxanthin using engineered Yersinia lipolytica, which contains CrtZ_9BACT or a mutant thereof. Preferably, the CrtZ_9BACT is derived from Fulvivirga imtechensis AK7; Preferably, the method comprises the following steps: introducing CrtZ_9BACT into a β-carotene-producing Yersinia lipolytica strain; Preferably, the method further includes the following step: mutating wild-type CrtZ_9BACT using enzyme engineering technology; Preferably, the mutation is generated through point saturation mutation and / or combined mutation; Preferably, the wild-type CrtZ_9BACT contains the amino acid sequence shown in SEQ ID NO.2; Preferably, the mutation is the deletion, addition, and / or substitution of one or more amino acids based on the amino acid sequence of wild-type CrtZ_9BACT; Preferably, the mutant comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 95% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 96% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 97% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 98% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence having more than 99% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 95.5% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 96.2% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 96.8% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 97.5% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 98.1% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 98.7% identity with the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence that has 99.4% identity with the amino acid sequence shown in SEQ ID NO.2; Preferably, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2, wherein the positions of the amino acid substitutions are selected from: L9, C10, F27, F36, W40, R42, K47, A59, Y72, T77, Y81, L97, K114, A152; Preferably, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2, wherein the amino acid substitutions are selected from: (1) L9H or L9M; (2)C10M; (3)F27A; (4)F36W; (5) W40V; (6) R42V; (7) K47M or K47S; (8)A59F; (9)Y72W; (10)T77V; (11) Y81R or Y81N; (12)L97M; (13) K114S; or (14)A152S; Preferably, the mutant contains one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.2, wherein the amino acid substitutions are selected from: (1) R42V; (2)A59F; (3)T77V; (4)Y81R; (5) K114S; or (6)A152S; More preferably, the mutant contains a K114S substitution in the amino acid sequence shown in SEQ ID NO.2; More preferably, the mutant comprises an amino acid sequence as shown in SEQ ID NO.

4.

12. The method according to claim 11, further comprising mutating the CrtZ_9BACT mutant using enzyme engineering technology; Preferably, the mutation can be performed in one or more rounds; Preferably, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, wherein the positions of the amino acid substitutions are selected from: L9, C10, F27, F36, W40, K47, A59, Y72, T77, Y81, L97, A152; Preferably, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, wherein the amino acid substitutions are selected from: (1) L9H or L9M; (2)C10M; (3)F27A; (4)F36W; (5) W40V; (6) K47M or K47S; (7)A59F; (8)Y72W; (9)T77V; (10) Y81R or Y81N; (11)L97M; or (12)A152S; More preferably, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, wherein the amino acid substitutions are selected from: (1) L9H or L9M; or (2) W40V; More preferably, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.4, wherein the amino acid substitutions are selected from: (1)C10M; (2)F36W; (3) K47M or K47S; (4)Y72W; (5) T77V; or (6)Y81N; More preferably, the mutant further includes an L9H substitution in the amino acid sequence shown in SEQ ID NO.4; More preferably, the mutant comprises an amino acid sequence as shown in SEQ ID NO.

16.

13. The method according to claim 12, wherein, The mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.16, wherein the positions of the amino acid substitutions are selected from: H9, C10, F27, F36, W40, K47, A59, Y72, T77, Y81, L97, A152; Preferably, the mutant further comprises one or more amino acid substitutions in the amino acid sequence shown in SEQ ID NO.16, wherein the amino acid substitutions are selected from: (1)H9M; (2)C10M; (3)F27A; (4)F36W; (5) W40V; (6) K47S; (7)A59F; (8)Y72W; (9)T77V; (10) Y81R or Y81N; (11)L97M; or (12)A152S; Preferably, the mutant further comprises substitutions selected from any of the following groups at amino acid sequence positions as shown in SEQ ID NO. 16: (1)H9M+F27A+A152S; (2)T77V; (3)F36W+W40V+T77V; (4)F36W+W40V+Y72W+T77V; (5) F36W+W40V; (6) W40V; (7)F36W+W40V+K47S; (8)Y81N; (9)Y81R+A152S; (10)C10M+F36W+W40V+T77V; (11)H9M+F27A+A59F+Y81R+L97M+A152S; or (12)W40V+K47S; More preferably, the mutant contains an H9M+F27A+A152S substitution in the amino acid sequence shown in SEQ ID NO.16; More preferably, the mutant comprises an amino acid sequence as shown in SEQ ID NO.

36.

14. A genetically engineered bacterium that produces zeaxanthin, wherein, The genetically engineered bacteria contain β-carotene hydroxylase CrtZ_9BACT, the mutant according to any one of claims 1-7, or the expression vector according to claim 9. Preferably, the genetically engineered bacteria is *Yarrowia lipophila*. Preferably, the genetically engineered bacteria is recombinant Yersinia lipolytica; Preferably, the genetically engineered bacteria is a recombinant Yersinia lipophila strain BOTA01017; Preferably, the β-carotene hydroxylase CrtZ_9BACT is derived from Fulvivirga imtechensis AK7.

15. The use of the mutant according to any one of claims 1-7, the nucleic acid according to claim 8, the expression vector according to claim 9, the host cell according to claim 10, or the method according to any one of claims 11-13, or the genetically engineered bacteria according to claim 14 in the preparation of zeaxanthin.

Images