Saccharomyces cerevisiae strain with African swine fever virus protein displayed on surface as well as construction method and application thereof
By constructing and transforming δ-site homologous arm fragments with TRP1, Aga2, African swine fever virus proteins, T2A peptide, and mCherry in Saccharomyces cerevisiae, the problem of difficult expression verification of target proteins in Saccharomyces cerevisiae surface display systems was solved. This enabled rapid screening and stable expression of African swine fever virus proteins in Saccharomyces cerevisiae strains, which are suitable for the preparation of African swine fever virus vaccines.
Patent Information
- Application Number
- CN202511671552.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-14
- Publication Date
- 2026-03-24
AI Technical Summary
In existing technologies, it is difficult to verify the expression of target proteins in the Saccharomyces cerevisiae surface display system, and it is difficult to quickly and efficiently screen out strains with high display efficiency and good functionality.
By linking the δ-site homologous arm fragment to the pET23a plasmid, the TRP1, Aga2, African swine fever virus protein, T2A peptide, and mCherry genes were sequentially linked. After digestion with restriction endonucleases, the protein was transformed into the Saccharomyces cerevisiae genome, and positive clones were screened using red fluorescence to achieve stable expression of African swine fever virus protein.
This method enables rapid screening of positive clones that express African swine fever virus (ASFV) proteins, and constructs a Saccharomyces cerevisiae strain that stably expresses ASFV proteins. This simplifies the protein expression verification process and is suitable for preparing oral ASFV vaccines.
Smart Images

Figure CN121718565A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of vaccine preparation technology, and in particular to a Saccharomyces cerevisiae strain that displays African swine fever virus proteins on its surface, its construction method, and its application. Background Technology
[0002] Saccharomyces cerevisiae, with its strong tolerance, excellent gene manipulation efficiency, and widely recognized as a safe and reliable organism (GRAS), has become a highly representative model organism in eukaryotic systems and has been widely adopted in scientific research and industrial fermentation. Constructing efficient cell factories typically follows an iterative metabolic engineering process of "design, build, test, and learn." In Saccharomyces cerevisiae, the single-copy integration of heterologous genes has been successfully applied to genome modification. However, this approach may be limited by gene copy number in terms of expression levels and metabolite production. With further research, the strategy of using Saccharomyces cerevisiae to express viral proteins to construct vaccines and induce host antiviral immunity has received widespread attention. For example, an oral Zika virus vaccine prepared using Saccharomyces cerevisiae surface display technology has been shown to elicit an effective immune response. Simultaneously, related studies have also successfully displayed the major glycoprotein antigens of carp spring viremia virus and rabies virus in this system, providing important support for their application in oral vaccine development.
[0003] African swine fever (ASF) is a highly contagious and deadly animal disease caused by the African swine fever virus (ASFV). Since 2018, ASF has broken out in China and several Southeast Asian countries, profoundly impacting the global pig industry chain. While ASFV has not yet been found to directly cause disease in humans, its extremely high mortality rate in pigs seriously threatens national pork supply security and market stability. Currently, there is still a lack of marketable vaccines globally, making the prevention and control situation extremely severe. Vaccine development has become a key scientific challenge and a hot topic of industry demand.
[0004] In the Saccharomyces cerevisiae surface display system, exogenous proteins are introduced into host cells after fusing with the C-terminus, N-terminus, or insertion site of a vector gene. Yeast cells utilize their protein transport system to deliver the fusion protein to the cell membrane surface and then firmly attach it to the cell wall using the GPI anchoring mechanism. Compared to other surface display platforms, Saccharomyces cerevisiae can perform glycosylation modification on target proteins, enhancing their functional performance.
[0005] However, the expression of the target protein in Saccharomyces cerevisiae still faces some limiting factors, such as the difficulty in verifying the expression of the target protein, and how to quickly and efficiently screen out strains with high display efficiency and good functionality from thousands of transformants is a huge challenge. Summary of the Invention
[0006] The purpose of this invention is to overcome the difficulty in expressing and verifying the target protein in the construction of surface-displaying strains in the prior art, and to provide a Saccharomyces cerevisiae strain that displays African swine fever virus protein on its surface, as well as its construction method and application.
[0007] To achieve the above objectives, the present invention provides a method for constructing a Saccharomyces cerevisiae strain displaying African swine fever virus proteins on its surface, the method comprising the following steps: (1) The homologous arm fragment at the δ site was ligated into the pET23a plasmid by seamless cloning, and then the gene fragments of TRP1, Aga2, African swine fever virus protein, T2A peptide and mCherry were sequentially ligated to the 3' end of the upstream homologous arm sequence at the δ site to obtain the recombinant plasmid. (2) The recombinant plasmid was digested with restriction endonuclease in the upstream and downstream regions of the δ site, and then separated with agarose gel. The obtained target DNA fragment was transformed into the genome of Saccharomyces cerevisiae. The transformed product was cultured to obtain transformed colonies. The single colony with red fluorescence observed was the Saccharomyces cerevisiae strain displaying African swine fever virus protein on its surface. The nucleotide sequence of the TRP1 gene is shown in SEQ ID NO: 1, the nucleotide sequence of the Aga2 gene is shown in SEQ ID NO: 2, the nucleotide sequence of the T2A peptide is shown in SEQ ID NO: 3, and the nucleotide sequence of the mCherry gene is shown in SEQ ID NO: 4. The African swine fever virus protein is either the p54 protein or the j18L protein. The nucleotide sequence of the gene encoding the p54 protein is shown in SEQ ID NO: 5, and the nucleotide sequence of the gene encoding the j18L protein is shown in SEQ ID NO: 6.
[0008] Preferably, in step (1), the gene sequence of the upstream homologous arm in the δ site homologous arm fragment is shown in SEQ ID NO: 7, and the gene sequence of the downstream homologous arm is shown in SEQ ID NO: 8.
[0009] Preferably, in step (1), the process of ligating the δ-site homologous arm fragment into the pET23a plasmid via seamless cloning includes: The δ site homologous arm gene fragment was mixed with the PCR product of vector pET23a, then T5 exonuclease and buffer were added, and the mixture was treated on ice for 5-10 minutes before being transformed into DH5α competent cells.
[0010] Preferably, in step (2), the restriction endonuclease is SalI enzyme.
[0011] Preferably, in step (2), the enzymatic digestion uses the following system: Add 1-10 μL of SalI enzyme and 1-1.5 μL of rCutsmart buffer to 10 μL of plasmid solution, and react at 35-40℃ for 3-6 hours.
[0012] Preferably, in step (2), the Saccharomyces cerevisiae strain is EBY100.
[0013] Preferably, in step (2), the target DNA fragment is transformed into the Saccharomyces cerevisiae genome using the PEG-Acli method.
[0014] A second aspect of the present invention provides a Saccharomyces cerevisiae strain whose surface displays African swine fever virus proteins, constructed by the construction method described above.
[0015] A third aspect of the present invention provides the use of a Saccharomyces cerevisiae strain exhibiting African swine fever virus proteins on its surface as described above in the preparation of an African swine fever virus vaccine.
[0016] In the technical solution provided by this invention, the protein-coding gene of African swine fever virus (ASFV) is integrated into the δ locus of the chromosome of Saccharomyces cerevisiae using an integrative vector. An Aga2 anchoring sequence is linked upstream of the ASFV protein-coding gene sequence, and a T2A peptide and a fluorescently labeled gene mCherry are linked downstream. The constructed plasmid is first treated with restriction enzymes and purified, and then the target sequence is stably transformed into the Saccharomyces cerevisiae genome, enabling stable expression of the target sequence (p54 protein or j18L protein). Because the vector driving element is a constitutive promoter, and the T2A linker design allows for co-expression of mCherry and the target protein, visible red fluorescence appears in the transformed colonies, facilitating direct screening of positive clones. The selected positive colonies are validated at the molecular and protein levels (e.g., PCR, Western blot, immunofluorescence, RT-qPCR). The results show that a surface-display yeast engineered strain capable of expressing ASFV proteins (ASFV p54 or ASFV j18L) is finally obtained, demonstrating the feasibility of selecting positive clones using red fluorescence and the simplicity of the protein expression validation method.
[0017] The construction method described in this invention can rapidly screen positive clones that can express the target protein, and the constructed Saccharomyces cerevisiae strain with ASFV surface can stably express African swine fever protein. Therefore, applying this Saccharomyces cerevisiae strain with ASFV surface to prepare an oral vaccine for African swine fever virus has a significant competitive advantage. Attached Figure Description
[0018] Figure 1 This is a plate image of the target gene fragment transformed into Saccharomyces cerevisiae in Example 1 of the present invention; Figure 2This is a PCR agarose gel electrophoresis image of the recombinant Saccharomyces cerevisiae colonies obtained in Example 1 of this invention; Figure 3 The recombinant Saccharomyces cerevisiae cells prepared in Example 1 of this invention are shown in the Western Blot result of the test sample. Figure 4 The recombinant Saccharomyces cerevisiae cells prepared in Example 1 of this invention are shown as an indirect immunofluorescence image of the test sample. Figure 5 is a plate diagram of the recombinant brewer's yeast transformation in Example 2 of the present invention; Figure 6 is a colony PCR agarose gel electrophoresis image of the recombinant Saccharomyces cerevisiae strain obtained in Example 2 of the present invention; Figure 7 shows the Western Blot results of the recombinant Saccharomyces cerevisiae strain obtained in Example 2 of the present invention; Figure 8 shows the indirect immunofluorescence results of the recombinant Saccharomyces cerevisiae strain obtained in Example 2 of the present invention; Figure 9 shows the passage fluorescence results of the recombinant Saccharomyces cerevisiae strain obtained in Example 1 of the present invention; Figure 10 shows the passage fluorescence results of the recombinant Saccharomyces cerevisiae strain obtained in Example 2 of the present invention. Detailed Implementation
[0019] The specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0020] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0021] This invention provides a method for constructing a Saccharomyces cerevisiae strain displaying African swine fever virus proteins on its surface, the method comprising the following steps: (1) The homologous arm fragment at the δ site was ligated into the pET23a plasmid by seamless cloning, and then the gene fragments of TRP1, Aga2, African swine fever virus protein, T2A peptide and mCherry were sequentially ligated to the 3' end of the upstream homologous arm sequence at the δ site to obtain the recombinant plasmid. (2) The recombinant plasmid was digested with restriction endonuclease in the upstream and downstream regions of the δ site, and then separated with agarose gel. The obtained target DNA fragment was transformed into the genome of Saccharomyces cerevisiae. The transformed product was cultured to obtain transformed colonies. The single colony with red fluorescence observed was the Saccharomyces cerevisiae strain displaying African swine fever virus protein on its surface. The nucleotide sequence of the TRP1 gene is shown in SEQ ID NO: 1, the nucleotide sequence of the Aga2 gene is shown in SEQ ID NO: 2, the nucleotide sequence of the T2A peptide is shown in SEQ ID NO: 3, and the nucleotide sequence of the mCherry gene is shown in SEQ ID NO: 4. The African swine fever virus protein is either the p54 protein or the j18L protein. The nucleotide sequence of the gene encoding the p54 protein is shown in SEQ ID NO: 5, and the nucleotide sequence of the gene encoding the j18L protein is shown in SEQ ID NO: 6.
[0022] The E183L gene of African swine fever virus (ASFV) encodes the p54 protein, a key structural protein on the viral inner membrane that is crucial for the viral life cycle. The p54 protein plays a central role in virion assembly, recruiting and modifying the host endoplasmic reticulum (ER) membrane as a precursor to the viral inner membrane. Furthermore, p54 interacts with host molecular motor dynein to efficiently transport the viral core to the "viral factory" near the cell nucleus for replication. Besides its role in viral morphogenesis, the p54 protein is also involved in viral attachment to host cells and can induce apoptosis, thus helping the virus evade the host immune response. Due to its stable presence within the virion, the p54 protein is an ideal target for serological diagnosis; infected pigs typically develop antibodies against p54, making it a useful marker for tracking viral transmission. In vaccine development, p54 is one of the main candidate antigens for subunit vaccines. Therefore, constructing a Saccharomyces cerevisiae strain capable of expressing the p54 protein is of great significance for research on African swine fever virus vaccines.
[0023] African swine fever virus (ASFV) protein pE199L, also known as j18L, is a key late-stage protein located on the viral inner membrane. It plays an indispensable role in the viral life cycle, its primary function being to mediate the release of the viral core from the late endosome into the cytoplasm. This process is the initiation step of viral replication, and studies have shown that the interaction of E199L with host proteins such as NPC1 and lysosomal membrane proteins (Lamp-1 and -2) is essential for this crucial membrane fusion event. Furthermore, E199L has the ability to manipulate the host cell's autophagy pathway. By interacting with and downregulating the expression of the host protein PYCR2, E199L can specifically induce autophagy; this proviral function contributes to viral replication and spread. Evidence from conditional lethal gene studies indicates that E199L expression is essential for efficient viral replication. Therefore, E199L is not only a core regulator in viral pathogenesis, but its crucial role in viral entry and replication also makes it an ideal target for developing novel antiviral drugs and attenuated live vaccines with rational gene deletions.
[0024] In the construction method described in this invention, the encoding gene used in step (1) is obtained by optimizing the nucleotide sequence without affecting its amino acid sequence, so that it is more suitable for expression in the host cell of Saccharomyces cerevisiae.
[0025] In the construction method described in this invention, in step (1), except for the T2A peptide sequence which is assembled by primer-bridged PCR, the other sequences are assembled into complete recombinant plasmids using T5 exonuclease-assisted cloning.
[0026] In the construction method described in this invention, in step (1), the recombinant plasmid is connected in the following order: upstream homologous arm of the δ site, TRP1, Aga2, African swine fever virus protein, T2A peptide, mCherry, and downstream homologous arm of the δ site.
[0027] In the construction method described in this invention, in step (1), the gene sequence of the upstream homologous arm in the δ site homologous arm fragment is shown as SEQ ID NO: 7, and the gene sequence of the downstream homologous arm is shown as SEQ ID NO: 8.
[0028] In some embodiments, step (1) involves ligating the δ site homologous arm fragment into the pET23a plasmid via seamless cloning, which includes mixing the δ site homologous arm gene fragment with the PCR product of the vector pET23a, then adding T5 exonuclease and buffer, treating with ice for 5-10 minutes, and then transforming into DH5α competent cells.
[0029] In some embodiments, in step (2), the restriction endonuclease is SalI enzyme.
[0030] In a preferred embodiment, the enzyme digestion operation in step (3) is performed using the following system: 1~10 μL of SalI enzyme and 1~1.5 μL of rCutsmart buffer are added to 10 μL of plasmid solution, and the reaction is carried out at 35~40℃ for 3~6 hours.
[0031] In some implementations, in step (2), the Saccharomyces cerevisiae strain is EBY100, which is readily available and inexpensive.
[0032] In a preferred embodiment, in step (2), the target DNA fragment is transformed into the Saccharomyces cerevisiae genome using the PEG-Acli method. By using the PEG-Acli method for transformation, the stable transformation of the target sequence can be achieved more effectively.
[0033] The present invention also provides a Saccharomyces cerevisiae strain with surface display of African swine fever virus protein, constructed by the construction method described above.
[0034] Furthermore, the present invention also provides the application of the Saccharomyces cerevisiae strain with surface-displaying African swine fever virus proteins as described above in the preparation of African swine fever virus vaccines.
[0035] The present invention will be described in detail below through embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods in the art. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.
[0036] In the following examples, the YPD medium formulation used was: 1% yeast extract, 2% peptone, and 2% glucose.
[0037] In the following embodiments, the gene sequences involved are shown below: TRP1 gene (SEQ ID NO: 1): ATGTCTGTTATTAATTTCACAGGTAGTTCTGGTCCATTGGTGAAAGTTTGCGGCTTGCAGAGCACAGAGGCCGCAGAATGTGCACTAGATTCCGATGCTGACTTGCTGGGTATTATATGTGTGCCCAATAGAAAGAGAACAATTGACCCGGTTATTGCAAGGAAAATTTCAAGTCTTGTAAAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAACCTAAGGAGGATGTTTTGGCTCTGGTCAATGATTACGGCATTGATATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGAATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTTCACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATTTCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAGAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGATGCGCTTAGATTAAATGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACAAAATAGCAAATTTCGTCAAAAATGCTAAGAAATAG。
[0038] Aga2 gene (SEQ ID NO: 2): ATGCAGTTACTTCGCTGTTTTTCAATATTTTCTGTTATTGCTTCAGTTTTTAGCACAGGAACTGACAACTATATGCGAGCAAATCCCCTCACCAACTTTAGAATCGACGCCGTACTCTTTGTCAACGACTACTATTTTG GCCAACGGGAAGGCAATGCAAGGAGTTTTTGAATATTACAAATCAGTAACGTTTGTCAGTAATTGCGGTTCTCACCCCTCAACGACTAGCAAAGGCAGCCCCATAAACACACAGTATGTTTTTAAGCTTCTGCAGGCT。
[0039] T2A(SEQ ID NO:3): GAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT。
[0040] mCherry(SEQ ID NO:4): atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtag。
[0041] Coding gene E183L of p54 protein (SEQ ID NO: 5): GCTATTGAAGAAGAAGATATCCAATTCATTAACCCATATCAAGATCAACAATGGGTTGAAGTTACTCCACAACCAGGTACTTCTAAACCAGCTGGAGCTACTACTGCTTCTGTTGGTAAGCCAGTTACTGGTAGACCAGCTACTAACAGACCAGCTACCAACAAGCCAGTTACCGATAATCCAGTTACTGATAGATTGGTTATGGCTACTGGTGGTCCAGCTGCTGCTCCAGCTGCTGCTTCTGCTCCAGCTCATCCAGCTGAACCATACACTACAGTTACCACCCAAAACACTGCTTCTCAGACCATGTCCGCTATTGAAAATTTGAGACAAAGAAATACCTACACCCATAAAGATTTGGAAAACTCTTTG。
[0042] The coding gene E199L of the j18L protein (SEQ ID NO: 6): ATGTCCTGTATGCCAGTTTCCACCAAGTGTAACGACATTTGGGTTGACTTTTCTTGTACCGGTCCATCTATTTCTGAATTGCAAAAGAAGGAGCCAAAGGCTTGGGCTGCTATTTTGAGATCCCATACCAATCAGCAAACCGCTGAGGATGATAACATTATTGGATCTATTTGTGACAAGCAAGGTTTGTGTTCTAAGGATGAATACGCTTACTCCCAATATTGTGCTTGTGTTAACTCCGGTACTTTGTGGGCTGAATGTGCTTTTGCTCCATGTAACGGTAACAAGAACGCTTACAAAACTACTGAACAGAGAAACATTTTGACTAACAAGCAATGTCCTTCTGGTTTGACCATTTGTCAGAACATTGCTGAATACGGTGGATCTGGTAACATCTCTGACTTGTACCAAAACTTCAACTGTAACTCCGTTATCAACACTTTCTTGATCAACGTTATGAACCAT。
[0043] The upstream homologous arm of the δ site (SEQ ID NO: 7): TGTTGGAATAAAAATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATA TTAACATATAAAATGATGATAATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTGGAGGAGAACTTCTAGTACTTTCTACATACCTAATATTATAGCCTTAATCACAATGGAATCCCAACAATTACATCAAAAT.
[0044] Downstream homologous arm of the δ site (SEQ ID NO: 8): CCACATTCTCTTTAAGATACTGGTGAATTTTGAGATAATTGGTGGGATTCTATTGTTGGTAAAGGCTATAATATCAGGTATACAGAATATACTAGAAGTTCTCCTCGAGGATATAGGAATCCTCAAAATGGAATCTTTATCTCTATATACTAATATTACG ATTATTCCTCATTCCGTTTTATATGTTTCATTATCCTATTACATTATCAATCCTTGCATTTCAGCTTCCTCTAACTTCGATGACAGTTCCTCGTATCTTATGTCATCGTCTAACACCGTATATGATAATATATTGGTAGTGTCCCTATTAGTTGCCAGC.
[0045] Example 1 This embodiment illustrates a Saccharomyces cerevisiae strain that displays African swine fever virus protein (ASFV p54) on its surface and its construction method.
[0046] (1) Preparation of recombinant plasmids containing the target sequence: The δ site homologous arm sequence, gene E183L (encoding ASFV p54 protein), and mCherry gene sequence were synthesized by Jinkairui Company and then amplified by PCR. The synthesized δ site homologous arm fragment was seamlessly cloned into the pET23a plasmid. The δ site homologous arm fragment and the pET23a plasmid were mixed at a molar ratio of 3:1 to 4 μL. 1 μL of T5 exonuclease and 0.5 μL of rCutsmart buffer were added to the mixture, and the mixture was incubated on ice for 7 minutes (homological arm length 21 bp). Subsequently, the mixture was transformed into DH5α competent cells. Following the sequence of upstream sequence of the δ homologous arm, tryptophan synthesis marker gene TRP1, E183L, T2A peptide, mCherry gene, and downstream sequence of the δ homologous arm, the plasmids were sequentially ligated from the 5' end to the 3' end. After culturing for 12-16 hours, single colonies were picked for PCR detection, and the plasmids were sent to Sangon Biotech (Shanghai) Co., Ltd. for full-sequence sequencing to confirm their accuracy. The T2A peptide gene fragment was synthesized by primer-bridging PCR and ligated to the V5Tag posterior end of E183L. Except for the T2A peptide, all other fragments were cloned using a T5 exonuclease-mediated seamless cloning method. (2) Take 100 μL of recombinant plasmid, add 0.1 μL of SalI endonuclease and 1 μL of rCutsmart buffer for every 10 μL of plasmid, and digest at 37°C for 3 hours; the DNA fragment after enzyme digestion is recovered by agarose gel to remove impurities and metal ions, and a recombinant fragment with a concentration ≥200 ng / μL is obtained for homologous recombination of Saccharomyces cerevisiae.
[0047] (3) Construction method of competent strain of Saccharomyces cerevisiae EBY100: The strain was activated in YPD medium plates and cultured upside down at 28°C. After colony formation, it was picked and amplified to OD in 2 ml of YPD liquid medium. 600 Approximately 0.5, then transferred to 100 ml YPD, adjusted the initial OD600 to 0.2, and cultured on a shaker at 28°C and 220 rpm for approximately 12 hours until the OD600 increased to approximately 0.8. After incubating the culture medium on ice for at least 30 minutes, centrifuged in 50 ml centrifuge tubes at 4°C and 3500 rpm to collect the cells, removed the supernatant, and resuspended the cells in 100 mM Acli solution, repeated twice; finally, resuspended the cells in 1 ml of 10 mM Acli buffer containing 10% glycerol, aliquoted, and stored sequentially at -20°C and -80°C.
[0048] Transformation of EBY100 strain with exogenous DNA: After removing competent cells from a -80°C freezer, thaw them completely at 28°C and prepare the transformation mixture in an EP tube: add 240 μL of 50% PEG4000, 31 μL of 1M Acli buffer, 10 μL of salmon sperm DNA, and 1 μL of the target DNA fragment; after pre-incubating the mixture at 28°C for a short time, heat it in a 42°C hot water bath for 20 minutes; then remove the supernatant by centrifugation, add 600 μL of YPD culture medium, and incubate on a shaker at 28°C and 220 rpm for 2 hours. After incubation, centrifuge again and discard the liquid, add 100 μL of sterile water to resuspend the bacterial culture, and then evenly spread it on MD tryptophan-deficient culture plates (composed of 2% glucose, 0.67% YNB, 0.1% leucine, and 2% agar); invert the plates and incubate them in a 28°C incubator for 2 to 3 days until single colonies are visible (e.g., ...). Figure 1 As shown in the figure, the single colony with red fluorescence is the recombinant Saccharomyces cerevisiae strain with ASFV p54 on its surface.
[0049] Example 2 The method described in Example 1 was implemented, except that the gene encoding ASFV p54 protein E183L was replaced with the gene encoding ASFV j18L protein E199L.
[0050] In this embodiment, single colonies cultured in the plate are as follows: Figure 5 As shown, by Figure 5 As can be seen, single colonies with red fluorescence can be observed.
[0051] Test Example 1 This test case is used to identify and verify the Saccharomyces cerevisiae strains with surface-displaying African swine fever virus proteins obtained in Examples 1-2.
[0052] 1. Testing method: (1) Detection of single clones of Saccharomyces cerevisiae using PCR method Samples were picked from single colonies producing red fluorescence and inoculated into 2 ml of YPD medium, incubated at 28°C and 220 rpm for 48 hours. 1 μL of the bacterial culture was then subjected to three freeze-thaw cycles between -80°C and room temperature to lyse the cells. After dilution with 100 μL of sterile deionized water, 1 μL of the diluted solution was used as a PCR template. Primers were designed on both sides of the start site of the target gene (E183L or E199L). The amplified 372 bp fragment can be used to determine the integration status of the target gene.
[0053] When the gene is E183L, the primer sequences are as follows: Upstream: GCTATTGAAGAAGAAGATATCCAAT; Downstream: TACACCCATAAAGATTTGGAAAACTCTTTG.
[0054] When the gene is E199L, the primer sequences are as follows: Upstream: ATGTCCTGTATGCCAGTTTCCACCA; Downstream: ACACTTTCTTGATCAACGTTATGAACCAT.
[0055] (2) The expression of the target protein was analyzed using Western blotting. Given that the exogenous protein is located on the surface of *Saccharomyces cerevisiae* cells, Western blotting analysis used cell samples instead of supernatant. Recombinant cells equivalent to 1 OD600 were centrifuged to remove the supernatant, resuspended in 100 μL of sterile PBS buffer, and then 25 μL of 5-fold concentrated SDS loading buffer was added. After denaturation in a 100°C metal bath for 10 minutes, SDS-PAGE electrophoresis was performed, loading 10 μL per well at 20 mA. After electrophoresis, the membrane was transferred at 90 V for 1 hour and 30 minutes. After transfer, the membrane was blocked with 5% skim milk powder at room temperature and 80 rpm for 1 hour. The primary antibody (Mouse anti V5-Tag mAb, Wuhan Aibote) was diluted 1:5000 with TBST and incubated overnight at 4°C. The membrane was washed three times for 10 minutes each time. The secondary antibody (HRP Goat Anti-Mouse IgG, Wuhan Aibotek) was diluted 1:2000 and incubated at 220 rpm for 1 hour at room temperature. The membrane was then washed three times, 10 minutes each time. Finally, it was developed using the ultrasensitive ECL chemiluminescence buffer from Acinetobacter, and imaged using an imaging system.
[0056] (3) Indirect immunofluorescence analysis of surface-displaying Saccharomyces cerevisiae To identify whether the exogenous protein was displayed on the surface of *Saccharomyces cerevisiae* cells, a mouse antibody targeting the C-terminal V5 tag of the target protein was used as the primary antibody, and a fluorescently labeled rabbit anti-mouse secondary antibody (AF488) was used as the secondary antibody for immunofluorescence detection. 200 μL of bacterial culture with an OD600 of 1 was centrifuged, the supernatant was discarded, and the suspension was resuspended in 100 μL of sterile PBS. A 1:100 dilution of the primary antibody was added, and the mixture was incubated overnight at 4°C. After centrifugation, the cells were washed three times with 500 μL of PBS to remove free primary antibody. Then, a 1:100 dilution of the secondary antibody was added, and the washing was repeated three times with PBS. Finally, the bacterial cells were stained with 10 μL of DAPI, dropped onto a coverslip, covered with a glass slide, and observed using a laser confocal microscope.
[0057] 2. Test Results: The PCR agarose gel electrophoresis, Western blotting, and indirect immunofluorescence assay results of the recombinant Saccharomyces cerevisiae strain with ASFV p54 surface prepared in Example 1 are as follows: Figure 2-4 As shown, the PCR agarose gel electrophoresis, Western blotting, and indirect immunofluorescence assay results of the recombinant Saccharomyces cerevisiae strain with surface display of ASFVj18L prepared in Example 2 are as follows: Figure 6-8 As shown.
[0058] Depend on Figure 2 It can be seen that the exogenous gene sequence carrying E183L was successfully transformed into the Saccharomyces cerevisiae genome; Figure 3 The results show that *Saccharomyces cerevisiae* successfully expressed the African swine fever p54 protein; Figure 4 The results show that the p54 protein was successfully displayed on the surface of Saccharomyces cerevisiae.
[0059] Depend on Figure 6 It can be seen that the exogenous gene sequence carrying E199L was successfully transformed into the Saccharomyces cerevisiae genome; Figure 7 The results show that *Saccharomyces cerevisiae* successfully expressed the African swine fever J18L protein; Figure 8 The results show that the J18L protein was successfully displayed on the surface of Saccharomyces cerevisiae.
[0060] Based on the above results, it can be seen that a single colony emitting red fluorescence is a positive clone, and a surface-displaying Saccharomyces cerevisiae strain capable of expressing African swine fever virus protein can be obtained through a simple protein expression verification method.
[0061] Test Example 2 To further demonstrate that the exogenous gene expression generated by the construction strategy of this invention is stable genome integration, rather than plasmid-dependent expression, one recombinant Saccharomyces cerevisiae strain expressing p54 protein obtained in Example 1 and one strain expressing j18L protein obtained in Example 2 were selected and continuously passaged on corresponding defect-selected plates for a total of 10 generations. Whether the expression of the exogenous protein decreased or was lost was observed, and the results are as follows: Figure 9-10 As shown, where, Figure 9 The passage results of the recombinant Saccharomyces cerevisiae strain expressing P54. Figure 10 The passage results of the recombinant Saccharomyces cerevisiae strain expressing the j18L protein.
[0062] Figure 9-10The experimental results showed that the two recombinant strains maintained the same fluorescence intensity as the primary strain throughout all passage cycles, without attenuation, disappearance, or uneven expression, and no fluorescently absent colonies were detected. These results clearly indicate that the p54 and j18L exogenous expression cassettes have been stably integrated into the *Saccharomyces cerevisiae* genome and maintain good genetic stability even without additional resistance or drug selection pressure, without gene fragment loss or expression inactivation. The construction method of this invention can ensure the continuous and stable expression of exogenous proteins under long-term culture and industrial production conditions.
[0063] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
Claims
1. A method for constructing a Saccharomyces cerevisiae strain displaying an African swine fever virus protein on the surface, characterized by, The construction method comprises the following steps: (1) connecting a delta site homologous arm fragment into a pET23a plasmid by means of seamless cloning, then sequentially connecting a TRP1, Aga2, African swine fever virus protein, T2A peptide and mCherry gene fragment at the 3' end of the upstream homologous arm sequence of the delta site to obtain a recombinant plasmid; (2) cutting the upstream and downstream regions of the delta site of the recombinant plasmid by using a restriction endonuclease, then separating the obtained target DNA fragment by using agarose gel, transforming the target DNA fragment into a Saccharomyces cerevisiae genome, and culturing the obtained transformation product to obtain a transformation colony, wherein a single colony with red fluorescence is a Saccharomyces cerevisiae strain for displaying an African swine fever virus protein; wherein the nucleotide sequence of the TRP1 gene is shown as SEQ ID NO: 1, the nucleotide sequence of the Aga2 is shown as SEQ ID NO: 2, the nucleotide sequence of the T2A peptide is shown as SEQ ID NO: 3, and the nucleotide sequence of the mCherry is shown as SEQ ID NO: 4; the African swine fever virus protein is a p54 protein or a j18L protein, the nucleotide sequence of the coding gene of the p54 protein is shown as SEQ ID NO: 5, and the nucleotide sequence of the coding gene of the j18L protein is shown as SEQ ID NO:
6.
2. The construction method according to claim 1, characterized in that, In step (1), the gene sequence of the upstream homologous arm sequence in the delta site homologous arm fragment is shown as SEQ ID NO: 7, and the gene sequence of the downstream homologous arm is shown as SEQ ID NO:
8.
3. The construction method according to claim 1 or 2, characterized in that, In step (1), the process of connecting the delta site homologous arm fragment into the pET23a plasmid by means of seamless cloning comprises the following steps: mixing the delta site homologous arm gene fragment with the PCR product of the vector pET23a, then adding T5 exonuclease and buffer, and then performing ice bath treatment for 5-10 minutes, and then transforming into DH5a competent cells.
4. The construction method according to any one of claims 1 to 3, characterized in that, In step (2), the restriction endonuclease is SalI enzyme.
5. The construction method according to claim 1 or 4, characterized in that, In step (2), the enzyme cutting adopts the following system: adding 1-10 μL of SalI enzyme and 1-1.5 μL of rCutsmart buffer to 10 μL of plasmid solution, and then reacting at 35-40°C for 3-6 hours.
6. The construction method according to any one of claims 1 to 5, wherein, In step (2), the Saccharomyces cerevisiae strain is EBY100.
7. The construction method according to any one of claims 1 to 6, wherein, In step (2), the PEG-Acli method is used to transform the target DNA fragment into the Saccharomyces cerevisiae genome.
8. A Saccharomyces cerevisiae strain for displaying an African swine fever virus protein, which is constructed by the construction method in any one of claims 1-7.
9. Application of the Saccharomyces cerevisiae strain for displaying an African swine fever virus protein in claim 8 in the preparation of an African swine fever virus vaccine.