Amide compound, pharmaceutical composition comprising same and use thereof

Abstract

The present invention relates to compounds of formula (I), pharmaceutical compositions comprising the same, and their use for the prevention or treatment of diseases.

Description

Technical Field

[0001] This invention relates to amide compounds, pharmaceutical compositions comprising them, and their use for the prevention or treatment of diseases. Background of the Invention

[0002] DHX9 (also known as RNA helicase A (RHA) or nuclear DNA helicase II (NDH II)) is a DExH box RNA helicase. DHX9 can utilize four nucleoside triphosphates (NTPs) to drive its directional movement from the 3' to 5' direction. Functionally, DHX9 can bind to and unwind or separate double-stranded DNA / RNA, single-stranded DNA / RNA, DNA:RNA hybrids (such as R-loops), circular RNA, and DNA / RNA G-quadruplexes. Due to its regulatory role in various RNA and DNA-related cellular processes, DHX9 participates in important biological processes such as transcription, translation, RNA splicing, editing, RNA transport and processing, microRNA generation, and maintenance of genome stability (Pan et al., 2021, Current Protein & Peptide Science (22), 29-40).

[0003] Studies have shown that DHX9 is involved in regulating genes associated with cancer characteristics such as persistent proliferation signaling, evasion of growth inhibition, evasion of apoptosis, angiogenesis, and metastasis. Microsatellite instability cancers (such as microsatellite instability (MSI) colorectal cancer) and tumors with mismatch repair (MMR) defects exhibit a strong dependence on DHX9. Furthermore, research has shown that BRCA1 / 2-mutated tumors also depend on DHX9 (Jennifer B. Castro et al., Cancer Res (2024) 84(6_Supplement):3908). Targeted inhibition of DHX9 could also be used to treat these types of tumors.

[0004] Furthermore, DHX9 is also associated with other diseases involving gene replication, translation, or regulation. These diseases include viral infections and autoimmune diseases. Therefore, developing DHX9 inhibitors as potential therapeutic agents is of great significance for treating diseases or disease states that respond to DHX9 inhibition. Invention Overview

[0005] This application provides amide compounds that can be used to prevent or treat DHX9-mediated diseases or conditions. Furthermore, the compounds of this invention possess superior properties such as better physicochemical properties (e.g., solubility, physical and / or chemical stability), improved pharmacokinetic properties (e.g., improved bioavailability, improved metabolic stability, suitable half-life and duration of action), improved safety (lower toxicity (e.g., reduced cardiotoxicity) and / or fewer side effects), and less likelihood of developing drug resistance.

[0006] One aspect of the present invention provides a compound or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug thereof, wherein the compound has the structure of formula (I):

[0007]

[0008] in:

[0009] Ring A is selected from C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic rings and 5-14 heterocyclic aromatic rings;

[0010] Ring B is a 3-10 membered heterocyclic ring or a 5-14 membered heteroaromatic ring; preferably, Selected from in Indicates a single or double bond; Y is selected from CH2, CHR 0 C(R) 0 2. NH, NR 0 O, S, and S(O)2; and when W is connected to a double bond, W is independently selected from CH, CR each time it appears. 0 And N, when W is not connected to a double bond, W is independently selected from CH2 and CHR each time it appears. 0 C(R) 0 2. NH, NR 0 O, S and S(O)2;

[0011] When X is connected to a double bond, X is N; when X is not connected to a double bond, X is -NR. a -;

[0012] R and R 1 Each occurrence is independently selected from D, halogen, -CN, and C. 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups and -OC1-6 alkyl;

[0013] R 0 and R 2 Each occurrence is independently selected from D, halogen, -OH, -NH2, -CN, -NO2, -SF5, and C. 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R a -OC(=O)R a -C(=O)OR a -OR a -SR a -S(=O)R a -S(=O)2R a -S(=O)2NR a R b -S(=O)(=NR) a )R b -NR a R b -C(=O)NR a R b -NR a -C(=O)R b -NR a -C(=O)OR b -NR a -S(=O)2-R b -NR a -C(=O)-NR a R b -N = S(=O)R a R b -P(=O)R a R b -C 1-6 Alkylene-R a -C 1-6 Alkylene-OR a -C 1-6 Alkylene-NR a R b -OC 1-6 Alkylene-NR a R b 、(-C 3-6 (-CN and (-C)3-6 (Hydrocyclic hydrocarbon group)-C 1-6 alkyl;

[0014] Or two Rs 0 Together they form = O or = CR a R b Or two Rs 0 Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings or 3-10 membered heterocyclic rings;

[0015] Or two Rs 2 Together they form = O or = CR a R b Or two Rs 2 Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings or 3-10 membered heterocyclic rings;

[0016] Z independently represents a direct bond, -CH2-, -O-, or -OC each time it appears. 1-4 Alkylene-*, -C 1-4 Alkylenes -O-*, -C(=O)-, -C(=O)O-*, -OC(=O)-*, -S(=O)2-, -S(=O)2N(Z) a )-*、-N(Z a )S(=O)2-*、-N(Z a )-、-N(Z a )-C 1-4 Alkylene-*, -C 1-4 Alkylene-N(Z) a )-*、-C(=O)N(Z a )-*、-N(Z a )C(=O)-* or -C(=O)N(Z a )-C 1-4 Alkylene-*, where * indicates resemblance to R 3 The connection point;

[0017] Z a Is it H or C? 1-4 alkyl;

[0018] R 3 Each time it appears, it is independently selected from C. 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl and 5-14 membered heteroaryl groups; each of the cyclic hydrocarbon group, heterocyclic group, aryl group, and heteroaryl group is optionally substituted by one or more substituents independently selected from the following: D, halogen, -OH, =O, -NH2, -CN, -NO2, -SF5, =CH2, C 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R a -OC(=O)R a -C(=O)OR a -OR a -SR a -S(=O)R a -S(=O)2R a -S(=O)2NR a R b -S(=O)(=NR) a )R b -NR a R b -C(=O)NR a R b -NR a -C(=O)R b -NR a -C(=O)OR b -NR a -S(=O)2-R b -NR a -C(=O)-NR a R b -N = S(=O)R a R b -P(=O)R a R b -C 1-6 Alkylene-R a -C 1-6 Alkylene-OR a -C 1-6 Alkylene-NR a R b -OC 1-6 Alkylene-NR a R b 、(-C 3-6 (-CN and (-C) 3-6 (Hydrocyclic hydrocarbon group)-C 1-6 alkyl;

[0019] When Z is a direct bond, R 3 The substituents on R are optionally with R 2 Connection constitutes C 3-10 Hydrocarbon rings or 3-10 membered heterocyclic rings;

[0020] R a and R b Each time it appears, it is independently selected from H and C. 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl alkyl; or R a and R b Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic rings or 5-14 heterocyclic aromatic rings;

[0021] The aforementioned alkylene, alkyl, alkenyl, alkynyl, cyclic alkylene, cyclic alkylene, alkyl ring, heterocyclic, heterocyclic, aryl, aromatic ring, heteroaryl, heteroaromatic ring, and aralkyl groups are each optionally substituted by one or more substituents independently selected from the following: deuterium atom, halogen, -OH, =O, -NH2, -CN, -NO2, =CH2, =CF2, -CH=CR c R d C 1-6 Alkyl, deuterated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R c -OC(=O)R c -C(=O)OR c -OR c -SR c -S(=O)R c -S(=O)2R c -S(=O)2NR c R d -NR c R d -C(=O)NR c R d -NR c -C(=O)R d -NR c -C(=O)OR d -NR c -S(=O)2-R d -NR c -C(=O)-NR c R d -N = S(=O)R c R d-P(=O)R c R d -C 1-6 Alkylene-OR c -C 1-6 Alkylene-NR c R d and -OC 1-6 Alkylene-NR c R d The alkylene, alkyl, alkenyl, =CH2, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, and aralkyl groups are each optionally further substituted by one or more substituents independently selected from the following: halogen, -OH, =O, -C(=O)O-tert-butyl, -NH2, -CN, -NO2, =CH2, =CF2, C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 1-6 Haloalkyl, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl group, -C 1-6 Alkylene-C 3-6 Cyclic hydrocarbon groups, -OC 1-6 Alkyl, -OC 1-6 Halogenated alkyl groups and -C 1-6 Alkylene-OC 1-6 alkyl;

[0022] R c and R d Each time it appears, it is independently selected from H and C. 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl group, or R c and R d Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic ring or 5-14 membered heteroaromatic ring, wherein the alkyl, cycloalkyl, hydrocarbon ring, heterocyclic group, heterocyclic group, aryl, aromatic ring, heteroaryl, heteroaromatic ring and aralkyl group are further optionally substituted by one or more substituents independently selected from the following: halogen, -OH, =O, -C(=O)O-tert-butyl, -NH2, -CN, -NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl groups and -C1-6 Alkylene-OC 1-6 alkyl;

[0023] m is an integer selected from 0, 1, 2 or 3;

[0024] n is an integer selected from 0, 1, or 2;

[0025] p is an integer selected from 0, 1, 2, 3, 4, 5 or 6;

[0026] q is an integer selected from 0, 1, or 2;

[0027] The condition is when for When p is not 0, and when p = 1, R 0 no

[0028] Another aspect of the invention provides a pharmaceutical composition comprising the compound of the invention or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug, and one or more pharmaceutically acceptable carriers.

[0029] Another aspect of the invention provides the use of the compounds of the invention or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs, or pharmaceutical compositions of the invention, in the preparation of medicaments for the prevention or treatment of DHX9-mediated diseases or conditions.

[0030] Another aspect of the present invention provides compounds of the present invention or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs of the present invention, or pharmaceutical compositions of the present invention, for the prevention or treatment of DHX9-mediated diseases or conditions.

[0031] Another aspect of the present invention provides a method for preventing or treating DHX9-mediated diseases or conditions, the method comprising administering to an individual in need an effective amount of a compound of the present invention or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug or pharmaceutical composition of the present invention. Detailed Implementation

[0032] definition

[0033] Unless otherwise defined below, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art. References to technical terms herein refer to techniques commonly understood in the art, including variations or equivalent substitutions of techniques that are obvious to one of ordinary skill in the art. While it is believed that the following terms will be well understood by one of ordinary skill in the art, the following definitions are set forth to better explain the invention.

[0034] The terms “including,” “comprising,” “having,” “containing,” or “involving,” and their other variations herein, are inclusive or open-ended and do not exclude other unlisted elements or method steps.

[0035] As used herein, the term "alkylene" means a saturated divalent hydrocarbon group, preferably a saturated divalent hydrocarbon group having 1, 2, 3, 4, 5 or 6 carbon atoms, such as methylene, ethylene, propylene or butylene.

[0036] As used herein, the term "alkyl" is defined as a straight-chain or branched saturated aliphatic hydrocarbon. In some embodiments, the alkyl group has 1 to 12, for example, 1 to 6 carbon atoms. For example, as used herein, the term "C" is used to refer to... 1-6 "Alkyl" refers to a linear or branched group with 1 to 6 carbon atoms (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, or n-hexyl), optionally substituted with one or more (e.g., 1 to 3) suitable substituents such as halogens (in which case the group is called "haloalkyl") (e.g., CF3, C2F5, CHF2, CH2F, CH2CF3, CH2Cl, or -CH2CH2CF3, etc.). The term "C 1-4 "Alkyl" refers to a linear or branched aliphatic hydrocarbon chain with 1 to 4 carbon atoms (i.e., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, or tert-butyl).

[0037] As used herein, the term "alkenyl" refers to a linear or branched monovalent hydrocarbon group containing one or more double bonds and having 2–6 carbon atoms ("C"). 2-6 The alkenyl group is, for example, -CH=CH2, -CH2CH=CH2, -C(CH3)=CH2, -CH2-CH=CH-CH3, 2-pentenyl, 3-pentenyl, 4-pentenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexenyl, 2-methyl-2-propenyl, and 4-methyl-3-pentenyl. When the compounds of the present invention contain an alkenyl group, the compounds may exist in pure E (iso-side), pure Z (iso-side), or any mixture thereof. The term "alkenyl" refers to the corresponding divalent group, including, for example, "C..."2-6 "Ideinyl", "C" 2-4 "Alkenyl", etc., specific examples of which include, but are not limited to: -CH=CH-, -CH2CH=CH-, -C(CH3)=CH-, buteneyl, pentenyl, hexeneyl, etc.

[0038] As used herein, the term "alkynyl" refers to a monovalent hydrocarbon group comprising one or more triple bonds, preferably having 2, 3, 4, 5, or 6 carbon atoms, such as ethynyl, 2-propynyl, 2-butynyl, 1,3-butadiynyl, etc. The alkynyl group is optionally substituted by one or more (such as 1 to 3) identical or different substituents. The term "ynynyl" refers to a corresponding divalent group, including, for example, "C..." 2-8 "Immyne", "C" 2-6 "Immyne", "C" 2-4 Examples include, but are not limited to, "ethynyl groups". The alkyne group is optionally substituted by one or more (such as 1 to 3) identical or different substituents.

[0039] As used herein, the term “fused ring” or “dense ring” refers to a ring system formed by two or more ring structures sharing two adjacent atoms.

[0040] As used herein, the term "spiroring" refers to a ring system consisting of two or more ring structures that share a single ring atom.

[0041] As used in this article, the term "bridged ring" refers to a ring system formed by two or more ring structures sharing two atoms that are not directly connected to each other.

[0042] As used herein, the terms “cycloalkylene group,” “cycloalkylene group,” and “hydrocarbon ring” refer to a saturated (i.e., “cycloalkylene group” and “cycloalkylene group”) or partially unsaturated (i.e., having one or more double and / or triple bonds within the ring) monocyclic or polycyclic hydrocarbon ring (including spirocyclic, fused (fused) ring, or bridged ring systems) having, for example, 3 to 10 (suitably 3 to 8, more preferably 3 to 6) cyclic carbon atoms, including but not limited to (cycloalkylene group) propyl(ring), (cycloalkylene group) butyl(ring), (cycloalkylene group) pentyl(ring), (cycloalkylene group) hexyl(ring), (cycloalkylene group) heptyl(ring), (cycloalkylene group) octyl(ring), (cycloalkylene group) nonyl(ring), (cycloalkylene group) hexenyl(ring), etc.

[0043] As used herein, the term "cycloalkyl" refers to a saturated monocyclic or polycyclic (such as bicyclic) hydrocarbon ring (e.g., monocyclic, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, or bicyclic, including spirocyclic, fused, or bridged systems (such as bicyclic [1.1.1]pentyl, bicyclic [2.2.1]heptyl, bicyclic [3.2.1]octyl, or bicyclic [5.2.0]nonyl, decahydronaphthyl, etc.), optionally substituted with one or more (such as one to three) suitable substituents. The cycloalkyl group has 3 to 15 carbon atoms. For example, the term "C 3-6 "Cycloalkyl" refers to a saturated monocyclic or polycyclic (such as bicyclic) hydrocarbon ring (e.g., cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl) with 3 to 6 cyclic carbon atoms, which is optionally substituted by one or more (e.g., 1 to 3) suitable substituents, such as methyl-substituted cyclopropyl.

[0044] As used herein, the term "heterocyclic group" (or "heterocycle") refers to a saturated or partially unsaturated monocyclic or bicyclic group having 2, 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms and one or more (e.g., one, two, three, or four) heteroatoms selected from O, S, N, and P, and the "heterocyclic group" (or "heterocycle") may contain -C (=O)- as a ring member. The heterocyclic group may be attached to the remainder of the molecule via the carbon atoms and / or heteroatoms (if present). Specifically, 3-10 membered heterocyclic groups are groups having 3-10 carbon atoms and heteroatoms in the ring, such as, but not limited to, ethylene oxide, aziridinyl, azetidinyl, oxetanyl, tetrahydrofuranyl, dioxolinyl, pyrrolyl, pyrrolidone, imidazoalkyl, pyrazolyl, pyrrolinyl, tetrahydropyranyl, piperidinyl, morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, or trithianyl.

[0045] As used herein, the term "heterocyclic group" (or "heterocycle") encompasses fused ring structures, wherein the connection point between the fused ring structure and other groups can be on any ring within the fused ring structure. Therefore, the heterocyclic groups of the present invention also include, but are not limited to, heterocyclic fused heterocyclic groups, heterocyclic fused cycloalkyl groups, monoheterocyclic fused monoheterocyclic groups, monoheterocyclic fused monocycloalkyl groups, aryl fused heterocyclic groups, and heteroaryl fused heterocyclic groups, such as 3-7 membered (mono)heterocyclic fused 3-7 membered (mono)heterocyclic groups, 3-7 membered (mono)heterocyclic fused (mono)cycloalkyl groups, and 3-7 membered (mono)heterocyclic fused C 4-6 (Mono)cycloalkyl, C 6-10Aryl 3-7 membered heterocyclic groups and 5-6 membered heteroaryl 3-7 membered heterocyclic groups, examples of which include, but are not limited to, pyrrolidinyl cyclopropyl, cyclopentyl aziridine propyl, pyrrolidinyl cyclobutyl, pyrrolidinyl pyrrolidinyl, pyrrolidinyl piperidinyl, pyrrolidinyl piperazine, and piperidinyl morpholinyl.

[0046] As used herein, the term "heterocyclic group" (or "heterocycle") encompasses both bridged heterocyclic groups (bridged heterocycles) and spirocyclic groups (spirocyclic heterocycles).

[0047] As used herein, the term "bridged heterocycle" refers to a ring structure containing one or more (e.g., 1, 2, 3, or 4) heteroatoms (e.g., oxygen, nitrogen, and / or sulfur atoms) formed by two rings sharing two non-directly connected ring atoms. This includes, but is not limited to, 7-10 membered bridged heterocycles, 8-10 membered bridged heterocycles, 7-10 membered nitrogen-containing bridged heterocycles, 7-10 membered oxygen-containing bridged heterocycles, 7-10 membered sulfur-containing bridged heterocycles, etc., for example... The "nitrogen-bridged heterocycle", "oxygen-bridged heterocycle", and "sulfur-bridged heterocycle" may optionally also contain one or more other heteroatoms selected from oxygen, nitrogen, and sulfur.

[0048] As used herein, the term "spiroheterocycle" refers to a ring structure consisting of two or more rings sharing a single ring atom and containing one or more heteroatoms (e.g., oxygen, nitrogen, sulfur), including but not limited to 5-10 membered spiroheterocycles, 6-10 membered spiroheterocycles, 6-10 membered nitrogen-containing spiroheterocycles, 6-10 membered oxygen-containing spiroheterocycles, 6-10 membered sulfur-containing spiroheterocycles, etc. The "nitrogen-containing spiroheterocycle", "oxygen-containing spiroheterocycle", and "sulfur-containing spiroheterocycle" may optionally also contain one or more other heteroatoms selected from oxygen, nitrogen, and sulfur. The term "6-10-membered nitrogen-containing spiroheterocycle group" refers to a spiroheterocycle group containing a total of 6-10 ring atoms, of which at least one ring atom is a nitrogen atom.

[0049] As used herein, the terms “(aryl)aryl” and “aromatic ring” refer to all-carbon monocyclic or fused-ring polycyclic aromatic groups having a conjugated π-electron system. For example, as used herein, the term “C…” 6-10 (Asyl) aryl" and "C 6-10 "Aromatic ring" refers to an aromatic group containing 6 to 10 carbon atoms, such as ()phenylene (benzene ring) or ()naphthyl (naphthalene ring). The ()aryl and aromatic rings are optionally substituented with one or more (such as 1 to 3) suitable substituents (e.g., halogen, -OH, -CN, -NO2, C). 1-6 Alkyl groups, etc., are substituted.

[0050] The term "aralkyl" means an aryl-substituted alkyl group, wherein the aryl group and the alkyl group are as defined herein. Typically, the aryl group may have 6-14 carbon atoms, and the alkyl group may have 1-6 carbon atoms. Exemplary aralkyl groups include, but are not limited to, benzyl, phenylethyl, phenylpropyl, and phenylbutyl.

[0051] As used herein, the terms “(sub)heteroaryl” and “heteroary ring” refer to monocyclic, bicyclic, or tricyclic aromatic ring systems having 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 ring atoms, particularly 1, 2, 3, 4, 5, 6, 9, or 10 carbon atoms, and containing at least one heteroatom that may be the same or different (the heteroatom being, for example, oxygen, nitrogen, or sulfur), and additionally, in each case, may be benzofused. Specifically, "(hybrid)aryl" or "heteroary ring" is selected from (thienyl)thiophene (ring), (furanyl) (ring), (pyrrolyl) (ring), (oxazolyl) (ring), (thiazolyl) (ring), (imidazolyl) (ring), (pyrazolyl) (ring), (isooxazolyl) (ring), (isothiazolyl) (ring), (oxadiazolyl) (ring), (triazolyl) (ring), (thiadiazolyl) (ring), and their benzo[a] derivatives; or (pyridyl)pyridinyl (ring), (pyridazinyl)pyrimidinyl (ring), (pyrazinyl)pyrazinyl (ring), (triazinyl)pyrazinyl (ring), and their benzo[a] derivatives.

[0052] As used herein, the term “halogenated” or “halogenated” is defined as including F, Cl, Br, or I.

[0053] As used herein, the term "alkylthio" refers to an alkyl group as defined above, which is attached to a portion of the parent molecule via a sulfur atom. C 1-6 Representative examples of alkyl thio groups include, but are not limited to, methyl thio, ethyl thio, tert-butyl thio, and hexyl thio.

[0054] As used herein, the term "nitrogen-containing heterocycle" refers to a saturated or partially unsaturated monocyclic or bicyclic group having 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 carbon atoms and at least one nitrogen atom in the ring, and optionally may also contain one or more (e.g., one, two, three, or four) ring members selected from N, O, S, S=O, and S(=O)2; the nitrogen-containing heterocycle is connected to the remainder of the molecule through any one of the ring members. The nitrogen-containing heterocycle is preferably a saturated nitrogen-containing monocyclic ring. Specifically, 3- to 14-membered nitrogen-containing heterocycles are groups having 3 to 14 carbon atoms and heteroatoms (at least one of which is a nitrogen atom) in the ring, including but not limited to ternary nitrogen-containing heterocycles (such as aziridinyl), quaternary nitrogen-containing heterocycles (such as aziridine), pentazolidinyl, pyrrolinyl, pyrrolidone, imidazolyl, imidazolyl, imidazolinyl, pyrazolyl, pyrazolin ...

[0055] The term "substitution" refers to the selective replacement of one or more (e.g., one, two, three, or four) hydrogen atoms on a specified atom by a designated group, provided that the substitution does not exceed the normal valence of the specified atom in the present case and that the substitution forms a stable compound. Combinations of substituents and / or variables are permitted only if such combinations form a stable compound.

[0056] If a substituent is described as “optionally substituted,” then the substituent may be (1) unsubstituted or (2) substituted. If the carbon of the substituent is described as being optionally substituted with one or more of the substituents in the list, then one or more hydrogens on the carbon (to the extent that any hydrogens are present) may be substituted individually and / or together with independently selected optional substituents. If the nitrogen of the substituent is described as being optionally substituted with one or more of the substituents in the list, then one or more hydrogens on the nitrogen (to the extent that any hydrogens are present) may each be substituted with independently selected optional substituents.

[0057] If a substituent is described as being “independently selected” from a group, then each substituent is selected independently of the others. Therefore, each substituent may be the same as or different from another (other) substituent.

[0058] As used herein, the term "one or more" means one or more under reasonable conditions, such as two, three, four, five, or ten.

[0059] Unless otherwise specified, as used herein, the connection point of a substituent may be located at any suitable position of the substituent.

[0060] When the bond of a substituent is such that it passes through the ring and connects two atoms, then such a substituent can be bonded to any cyclic atom in the substituted ring.

[0061] This invention also includes all pharmaceutically acceptable isotopically labeled compounds that are identical to the compounds of this invention, except that one or more atoms are replaced by atoms having the same atomic number but with an atomic mass or mass number different from the dominant atomic mass or mass number in nature. Examples of isotopes suitable for inclusion in the compounds of this invention include (but are not limited to) isotopes of hydrogen (e.g., deuterium (D, ...). 2 H), tritium (T), 3 H); nitrogen isotopes (e.g., H); 13 N and 15 N); isotopes of oxygen (e.g., N); 15 O、 17 O and 18 O); isotopes of phosphorus (e.g., O); phosphorus isotopes ... 32 P); and isotopes of sulfur (e.g. 35 S). The isotopically labeled compounds of the present invention can be prepared by methods similar to those described in the accompanying routes and / or examples and preparations, by using a suitable isotopically labeled reagent instead of the previously used unlabeled reagent. Pharmaceutically acceptable solvates of the present invention include those in which the crystallization solvent can be isotopically substituted, for example, D2O, acetone-d6, or DMSO-d6.

[0062] The term "stereoisomer" refers to an isomer formed due to at least one asymmetric center. In compounds having one or more (e.g., one, two, three, or four) asymmetric centers, racemic mixtures, single enantiomers, diastereomer mixtures, and individual diastereomers can be produced. Specific individual molecules can also exist as geometric isomers (cis / trans). Similarly, the compounds of the present invention can exist as mixtures of two or more structurally different forms in rapid equilibrium (commonly referred to as tautomers). Representative examples of tautomers include keto-enol tautomers, phenol-keto tautomers, nitroso-oxime tautomers, imine-enamine tautomers, etc. It is to be understood that the scope of this application covers all such isomers or mixtures thereof in any proportion (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%).

[0063] Solid lines may be used in this article. solid wedge Or virtual wedge The carbon-carbon bonds of the compounds of the present invention are depicted. Solid lines are used to depict bonds to asymmetric carbon atoms to indicate all possible stereoisomers (e.g., specific enantiomers, racemic mixtures, etc.) at that carbon atom. Solid or imaginary wedges are used to depict bonds to asymmetric carbon atoms to indicate the presence of the indicated stereoisomers. When present in racemic mixtures, solid and imaginary wedges are used to define relative stereochemistry, not absolute stereochemistry. Unless otherwise specified, the compounds of the present invention are intended to exist as stereoisomers (including cis and trans isomers, optical isomers (e.g., R and S enantiomers), diastereomers, geometric isomers, rotational isomers, conformational isomers, trans-blocking isomers, and mixtures thereof). The compounds of the present invention may exhibit more than one type of isomerism and may consist of mixtures thereof (e.g., racemic mixtures and diastereomer pairs).

[0064] Rotation-restricted isomers are compounds that can be isolated into rotation-restricted isomers.

[0065] It should also be understood that certain compounds of the present invention may exist in their free form for therapeutic purposes, or, where appropriate, in their pharmaceutically acceptable derivative forms. In the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable salts, esters, solvates, metabolites, or prodrugs, which, upon administration to a patient in need, can directly or indirectly provide the compounds of the present invention or their metabolites or residues. Therefore, when referring to "compounds of the present invention" herein, it is also intended to encompass the various derivative forms of the compounds described above.

[0066] Pharmaceutically acceptable salts of the compounds of the present invention include their acid addition salts and base addition salts.

[0067] For a review of suitable salts, see Stahl and Wermuth's "Handbook of Pharmaceutical Salts: Properties, Selection, and Use" (Wiley-VCH, 2002). Methods for preparing pharmaceutically acceptable salts for the compounds of the present invention are known to those skilled in the art.

[0068] As used herein, the term "ester" means an ester derived from the various general formula compounds of this application, including physiologically hydrolyzable esters (the compounds of the present invention that can be hydrolyzed under physiological conditions to release free acids or alcohols). The compounds of the present invention may themselves also be esters.

[0069] The compounds of the present invention can exist as solvates (preferably hydrates), wherein the compounds of the present invention contain a polar solvent, particularly, for example, water, methanol, or ethanol, as a structural element of the lattice of the compound. The amount of the polar solvent, particularly water, can be stoichiometric or non-stoichiometric.

[0070] The scope of this invention also includes metabolites of the compounds of this invention, i.e., substances formed in the body when the compounds of this invention are administered. Such products can be generated, for example, by oxidation, reduction, hydrolysis, amidation, deamidation, esterification, defatting, enzymatic hydrolysis, etc., of the administered compound. Therefore, this invention includes metabolites of the compounds of this invention, including compounds obtained by methods that expose the compounds of this invention to mammals for a time sufficient to produce their metabolites.

[0071] This invention further includes, within its scope, prodrugs of the compounds of the invention, which are certain derivatives of the compounds of the invention that may themselves have little or no pharmacological activity, which, when administered to or onto the body, can be converted, for example, by hydrolysis and cleavage into the compounds of the invention having the desired activity. Typically, such prodrugs are functional group derivatives of the compounds that readily convert in vivo into the compounds with the desired therapeutic activity. Further information regarding the use of prodrugs can be found in “Pro-drugs as Novel Delivery Systems,” Vol. 14, ACS Symposium Series (T. Higuchi and V. Stella) and “Bioreversible Carriers in Drug Design,” Pergamon Press, 1987 (EB Roche, editor, American Pharmaceutical Association). The prodrugs of the invention can be prepared, for example, by replacing suitable functional groups present in the compounds of the invention with certain portions known to those skilled in the art as “pro-moiety” (e.g., as described in “Design of Prodrugs,” H. Bundgaard (Elsevier, 1985)).

[0072] This invention also covers compounds of the invention containing protecting groups. In any process of preparing the compounds of the invention, protection of sensitive or reactive groups on any relevant molecule may be necessary and / or desired, thereby forming a form of chemical protection for the compounds of the invention. This can be achieved by conventional protecting groups, for example, those described in *Protective Groups in Organic Chemistry*, ed. J.F.W. McOmie, Plenum Press, 1973; and T.W. Greene & P. ​​G.W. Uts, *Protective Groups in Organic Synthesis*, John Wiley & Sons, 1991, which are incorporated herein by reference. Protecting groups can be removed at appropriate subsequent stages using methods known in the art.

[0073] As used herein, the term “about” means within ±10% of the stated value, preferably within ±5%, and more preferably within ±2%.

[0074] compound

[0075] In some embodiments, this disclosure provides a compound or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug thereof, wherein said compound has the structure of formula (I):

[0076]

[0077] in:

[0078] Ring A is selected from C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic rings and 5-14 heterocyclic aromatic rings;

[0079] Ring B is a 3-10 membered heterocyclic ring or a 5-14 membered heteroaromatic ring; preferably, Selected from in Indicates a single or double bond; Y is selected from CH2, CHR 0 C(R) 0 2. NH, NR 0 O, S, and S(O)2; and when W is connected to a double bond, W is independently selected from CH, CR each time it appears. 0 And N, when W is not connected to a double bond, W is independently selected from CH2 and CHR each time it appears. 0 C(R) 0 2. NH, NR 0O, S and S(O)2;

[0080] When X is connected to a double bond, X is N; when X is not connected to a double bond, X is -NR. a -;

[0081] R and R 1 Each occurrence is independently selected from D, halogen, -CN, and C. 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups and -OC 1-6 alkyl;

[0082] R 0 and R 2 Each occurrence is independently selected from D, halogen, -OH, -NH2, -CN, -NO2, -SF5, and C. 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R a -OC(=O)R a -C(=O)OR a -OR a -SR a -S(=O)R a -S(=O)2R a -S(=O)2NR a R b -S(=O)(=NR) a )R b -NR a R b -C(=O)NR a R b -NR a -C(=O)R b -NR a -C(=O)OR b -NR a -S(=O)2-R b -NR a -C(=O)-NR a R b -N = S(=O)R aR b -P(=O)R a R b -C 1-6 Alkylene-R a -C 1-6 Alkylene-OR a -C 1-6 Alkylene-NR a R b -OC 1-6 Alkylene-NR a R b 、(-C 3-6 (-CN and (-C) 3-6 (Hydrocyclic hydrocarbon group)-C 1-6 alkyl;

[0083] Or two Rs 0 Together they form = O or = CR a R b Or two Rs 0 Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings or 3-10 membered heterocyclic rings;

[0084] Or two Rs 2 Together they form = O or = CR a R b Or two Rs 2 Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings or 3-10 membered heterocyclic rings;

[0085] Z independently represents a direct bond, -CH2-, -O-, or -OC each time it appears. 1-4 Alkylene-*, -C 1-4 Alkylenes -O-*, -C(=O)-, -C(=O)O-*, -OC(=O)-*, -S(=O)2-, -S(=O)2N(Z) a )-*、-N(Z a )S(=O)2-*、-N(Z a )-、-N(Z a )-C 1-4 Alkylene-*, -C 1-4 Alkylene-N(Z) a )-*、-C(=O)N(Z a )-*、-N(Z a )C(=O)-* or -C(=O)N(Z a )-C 1-4 Alkylene-*, where * indicates resemblance to R 3 The connection point;

[0086] Za Is it H or C? 1-4 alkyl;

[0087] R 3 Each time it appears, it is independently selected from C. 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl and 5-14 membered heteroaryl groups; each of the cyclic hydrocarbon group, heterocyclic group, aryl group, and heteroaryl group is optionally substituted by one or more substituents independently selected from the following: D, halogen, -OH, =O, -NH2, -CN, -NO2, -SF5, =CH2, C 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R a -OC(=O)R a -C(=O)OR a -OR a -SR a -S(=O)R a -S(=O)2R a -S(=O)2NR a R b -S(=O)(=NR) a )R b -NR a R b -C(=O)NR a R b -NR a -C(=O)R b -NR a -C(=O)OR b -NR a -S(=O)2-R b -NR a -C(=O)-NR a R b -N = S(=O)R a R b -P(=O)R a R b -C 1-6 Alkylene-R a -C 1-6 Alkylene-OR a -C 1-6 Alkylene-NR aR b -OC 1-6 Alkylene-NR a R b 、(-C 3-6 (-CN and (-C) 3-6 (Hydrocyclic hydrocarbon group)-C 1-6 alkyl;

[0088] When Z is a direct bond, R 3 The substituents on R are optionally with R 2 Connection constitutes C 3-10 Hydrocarbon rings or 3-10 membered heterocyclic rings;

[0089] R a and R b Each time it appears, it is independently selected from H and C. 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl alkyl; or R a and R b Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic rings or 5-14 heterocyclic aromatic rings;

[0090] The aforementioned alkylene, alkyl, alkenyl, alkynyl, cyclic alkylene, cyclic alkylene, alkyl ring, heterocyclic, heterocyclic, aryl, aromatic ring, heteroaryl, heteroaromatic ring, and aralkyl groups are each optionally substituted by one or more substituents independently selected from the following: deuterium atom, halogen, -OH, =O, -NH2, -CN, -NO2, =CH2, =CF2, -CH=CR c R d C 1-6 Alkyl, deuterated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R c -OC(=O)R c -C(=O)OR c -OR c -SR c -S(=O)R c -S(=O)2R c -S(=O)2NR c R d -NR c Rd -C(=O)NR c R d -NR c -C(=O)R d -NR c -C(=O)OR d -NR c -S(=O)2-R d -NR c -C(=O)-NR c R d -N = S(=O)R c R d -P(=O)R c R d -C 1-6 Alkylene-OR c -C 1-6 Alkylene-NR c R d and -OC 1-6 Alkylene-NR c R d The alkylene, alkyl, alkenyl, =CH2, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, and aralkyl groups are each optionally further substituted by one or more substituents independently selected from the following: halogen, -OH, =O, -C(=O)O-tert-butyl, -NH2, -CN, -NO2, =CH2, =CF2, C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 1-6 Haloalkyl, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl group, -C 1-6 Alkylene-C 3-6 Cyclic hydrocarbon groups, -OC 1-6 Alkyl, -OC 1-6 Halogenated alkyl groups and -C 1-6 Alkylene-OC 1-6 alkyl;

[0091] R c and R d Each time it appears, it is independently selected from H and C. 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl group, or R c and R d Together with the groups it is attached to, they constitute C3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic ring or 5-14 membered heteroaromatic ring, wherein the alkyl, cycloalkyl, hydrocarbon ring, heterocyclic group, heterocyclic group, aryl, aromatic ring, heteroaryl, heteroaromatic ring and aralkyl group are further optionally substituted by one or more substituents independently selected from the following: halogen, -OH, =O, -C(=O)O-tert-butyl, -NH2, -CN, -NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl groups and -C 1-6 Alkylene-OC 1-6 alkyl;

[0092] m is an integer selected from 0, 1, 2 or 3;

[0093] n is an integer selected from 0, 1, or 2;

[0094] p is an integer selected from 0, 1, 2, 3, 4, 5 or 6;

[0095] q is an integer selected from 0, 1, or 2;

[0096] The condition is when for When p is not 0, and when p = 1, R 0 no

[0097] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds, or prodrugs thereof, wherein ring A is selected from:

[0098]

[0099] Each of the above groups is marked with 0, 1, or 2 R groups. 2 and 0 or 1 ZR 3 replace.

[0100] In a preferred embodiment, ring A is selected from...

[0101] Each of the above groups is marked with 0, 1, or 2 R groups. 2 and 0 or 1 ZR 3 replace.

[0102] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds, or prodrugs thereof, wherein

[0103] Selected from:

[0104]

[0105]

[0106] In a preferred embodiment, Selected from

[0107] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs thereof, wherein R 2 Each time it appears, it is independently halogen or C. 1-6 Alkyl, C 3-6 Cyclic hydrocarbon group or 3-10 membered heterocyclic group, preferably fluorine, chlorine, methyl or cyclopropyl.

[0108] In some implementations, m is an integer of 0 or 1.

[0109] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs thereof, wherein Z is a direct bond, -OC 1-4 Alkylene-*, -C 1-4 Alkylene -O-*, -C(=O)N(Z) a )-*、-N(Z a )C(=O)-* or -C(=O)N(Z a )-C 1-4 Alkylene-*, where * indicates resemblance to R 3 The connection point.

[0110] In some implementations, n is 1.

[0111] In some implementations, Z represents a direct key.

[0112] In some implementations, when Z is a direct bond, R 3 The substituents on R are optionally with R 2The links form a 6-8 membered heterocycle, preferably a 7-membered heterocycle, wherein the heterocycle contains one or two heteroatoms selected from O and N.

[0113] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs thereof, wherein R 3 Each time it appears, it is independently for

[0114]

[0115] Each of the above groups may be optionally substituted by one or more substituents independently selected from the following: D, halogen, -OH, =O, -NH2, -CN, -NO2, -SF5, =CH2, =CF2, C 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R a -OC(=O)R a -C(=O)OR a -OR a -SR a -S(=O)R a -S(=O)2R a -S(=O)2NR a R b -S(=O)(=NR) a )R b -NR a R b -C(=O)NR a R b -NR a -C(=O)R b -NR a -C(=O)OR b -NR a -S(=O)2-R b -NR a -C(=O)-NR a R b -N = S(=O)R a R b -P(=O)R a R b-C 1-6 Alkylene-R a -C 1-6 Alkylene-OR a -C 1-6 Alkylene-NR a R b -OC 1-6 Alkylene-NR a R b 、(-C 3-6 (-CN and (-C) 3-6 (Hydrocyclic hydrocarbon group)-C 1-6 alkyl;

[0116] R a and R b Each time it appears, it is independently selected from H and C. 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl alkyl; or R a and R b Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic rings or 5-14 heterocyclic aromatic rings;

[0117] The aforementioned alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, and aralkyl groups are each optionally substituted by one or more substituents independently selected from the following: halogen, -OH, C. 1-6 Alkyl, deuterated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl, -O(C 1-6 Alkyl), -C(=O)O-tert-butyl, -S(=O)2(C 1-6 Alkyl) and -P(=O)(C 1-6 Alkyl)2, wherein the above-mentioned alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, and aralkyl groups are each optionally further selected independently by one or more elements selected from halogen, -OH, -NH2, -CN, and C. 1-6 Alkyl substituents.

[0118] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs thereof, wherein R3 Each time it appears, it is independently for

[0119] Each of the above groups may be optionally substituted by one or more substituents independently selected from the following: halogen, -CN, C. 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 aryl, 5-14 heteroaryl and -OR a ;

[0120] R a Selected from H, C 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl alkyl groups;

[0121] The aforementioned alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, and aralkyl groups are each optionally substituted by one or more substituents independently selected from the following: halogen, -OH, C. 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, -O(C 1-6 Alkyl), -C(=O)O-tert-butyl, -S(=O)2(C 1-6 Alkyl) and -P(=O)(C 1-6 Alkyl)2, wherein the above-mentioned alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups are each optionally further selected independently by one or more elements selected from halogen, -OH, -NH2, -CN, and C. 1-6 Alkyl substituents.

[0122] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs thereof, wherein R is selected from D, halogens, -CN, C. 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups and -OC 1-6alkyl.

[0123] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds, or prodrugs thereof, wherein R is independently D, halogen, -CN, or C each time it appears. 1-6 Alkyl, Halogenated C 1-6 Alkyl or -OC 1-6 alkyl.

[0124] In a preferred embodiment, R is independently F, Cl, Br, -CN, methyl, ethyl, trifluoromethyl, or -O-methyl each time it appears.

[0125] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs thereof, wherein R 1 Each time it appears, it is independently a halogen, -CN, or C. 1-6 Alkyl, Halogenated C 1-6 Alkyl or -OC 1-6 Alkyl groups, preferably each of which is independently F, Cl, Br, methyl, ethyl, trifluoromethyl or -O-methyl, each time they appear.

[0126] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs thereof, wherein R 0 Each time it appears, it is independently selected from halogen, -OH, -NH2, -CN, C. 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)-C 1-6 Alkyl, -OC 1-6 Alkyl, -C 1-6 Alkylene-OC 1-6 Alkyl and -C 1-6 Alkylene-OC 3-10 Cycloalkyl group, wherein the alkylene group, alkyl group, alkenyl group, alkynyl group, cycloalkyl group, heterocyclic group, aryl group, heteroaryl group, and aralkyl group are each optionally selected independently by one or more halogens or C. 1-6 Alkyl substituents;

[0127] Or two Rs0 Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings (e.g., cyclopropyl rings).

[0128] In the preferred embodiment, R 0 Each of these groups is independently selected from F, Cl, Br, -OH, -NH2, -CN, methyl, -CHF2, -CF3, ethyl, n-propyl, isopropyl, vinyl, propenyl, allyl, ethynyl, cyclopropyl, cyclopentyl, cyclohexyl Phenyl, benzyl, -C(=O)CH3, -O-CH3, -O-CHF2, -O-CF3, -CH2-O-CH3.

[0129] In a more preferred embodiment, Selected from

[0130]

[0131]

[0132] In some embodiments, this disclosure provides compounds of formula (I) above, or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs thereof, wherein R 0 Each time it appears, it is independently selected from halogen, -OH, -NH2, -CN, C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, -OC 1-6 Alkyl and -C 1-6 Alkylene-OC 1-6 alkyl.

[0133] In the preferred embodiment, R 0 Each of these groups is independently selected from F, Cl, Br, -OH, -NH2, -CN, methyl, ethyl, ethynyl, cyclopropyl, -O-methyl, and -CH2-O-CH3 each time it appears.

[0134] In some embodiments, this disclosure provides the above-described compounds or their pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs, wherein said compounds have a structure of formula (II), (III), (IV), (V) or (VI):

[0135]

[0136]

[0137] in:

[0138] p' is an integer selected from 0, 1, 2, or 3; and

[0139] The remaining groups are as defined above.

[0140] In some embodiments, this disclosure provides the above-described compounds or their pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs, wherein said compounds have the structure of formula (VII):

[0141]

[0142] in:

[0143] p' is an integer selected from 0, 1, 2, or 3; and

[0144] The remaining groups are as defined above.

[0145] This invention covers technical solutions / compounds obtained by arbitrarily combining any two or more of the above embodiments.

[0146] In a preferred embodiment, this disclosure provides a compound or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug thereof, wherein the compound is selected from:

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158] Pharmaceutical compositions and treatment methods

[0159] In some embodiments, the present invention provides pharmaceutical compositions comprising a preventive or therapeutically effective amount of the compound of the present invention or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug, and one or more pharmaceutically acceptable carriers, wherein the pharmaceutical composition is preferably a solid dosage form, a liquid dosage form, or a transdermal dosage form.

[0160] In some embodiments, the present invention provides the use of the compounds of the present invention or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs, or pharmaceutical compositions of the present invention, in the preparation of a medicament for the prevention or treatment of DHX9-mediated diseases or conditions.

[0161] In some embodiments, the present invention provides compounds of the present invention or pharmaceutically acceptable salts, esters, stereoisomers, tautomers, polymorphs, solvates, metabolites, isotopically labeled compounds or prodrugs of the present invention, or pharmaceutical compositions of the present invention, for the prevention or treatment of DHX9-mediated diseases or conditions.

[0162] In some embodiments, the present invention provides a method for preventing or treating DHX9-mediated diseases or conditions, the method comprising administering to an individual in need an effective amount of a compound of the present invention or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug, or a pharmaceutical composition of the present invention.

[0163] In some implementations, the DHX9-mediated disease or condition is cancer, viral infection, or autoimmune disease.

[0164] In a preferred embodiment, the cancer is selected from colorectal cancer, endometrial cancer, ovarian cancer, gastric cancer, breast cancer, brain cancer, skin cancer, lung cancer, leukemia, prostate cancer, head and neck cancer, pancreatic cancer, bladder cancer, bone cancer, soft tissue cancer, kidney cancer, and liver cancer.

[0165] In a preferred embodiment, the cancer is a microsatellite instability (MSI) cancer.

[0166] In a preferred embodiment, the cancer has a mutation or defect in DNA mismatch repair (MMR), and / or a mutation or defect in RNA splicing and kinetochore complex.

[0167] In a preferred embodiment, the cancer is a BRCA1 / 2 mutated cancer.

[0168] In this invention, "pharmaceutically acceptable carrier" refers to a diluent, excipient, vehicle, or medium that is administered co-administered with a therapeutic agent and is suitable, to the extent of reasonable medical judgment, for contact with human and / or other animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0169] Unless otherwise stated, as used herein, the term “treatment” means to reverse, alleviate, or inhibit the progression of a disease or condition or one or more symptoms of such a disease or condition to which such term is applied, or to prevent such a disease or condition or one or more symptoms of such a disease or condition.

[0170] As used herein, “individual” includes both human and non-human animals. Exemplary human individuals include human individuals suffering from a disease (such as the disease described herein) (referred to as patients) or normal individuals. In this invention, “non-human animals” includes all vertebrates, such as non-mammals (e.g., birds, amphibians, reptiles) and mammals, such as non-human primates, livestock, and / or domesticated animals (e.g., sheep, dogs, cats, cows, pigs, etc.).

[0171] In another embodiment, the pharmaceutical composition of the present invention may also contain one or more additional therapeutic or preventative agents.

[0172] Example

[0173] The present invention is further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.

[0174] The abbreviations used in this invention have the following meanings:

[0175]

[0176]

[0177] Example 1. Synthesis of compound A1

[0178]

[0179] 1) Step One

[0180] Copper chloride (25.7 g, 259.8 mmol, 2.5 eq) and tert-butyl nitrite (26.8 g, 259.8 mmol, 2.5 eq) were added to a solution of compound A1-1 (24.0 g, 103.9 mmol, 1.0 eq) in ACN (200 mL). The reaction mixture was stirred overnight at 30 °C. After the reaction was complete, the reaction mixture was diluted with water (150 mL) and extracted with ethyl acetate (150 mL x 4). The combined organic phases were washed with water (100 mL) and saturated brine (100 mL), dried over Na2SO4, concentrated, and given as a crude product. The crude product was purified by silica gel column chromatography (petroleum ether / EtOAc = 10:1) to give compound A1-2 (18.8 g, 72.3%) as a white solid. 1 HNMR (300MHz, DMSO-d6): δ

[0181] 8.20–8.10 (m, 2H), 2.38 (s, 3H).

[0182] 2) Step Two

[0183] Under N2 atmosphere, DMF-DMA (30.1 g, 319.5 mmol, 5.0 eq) was added to a DMF (160 mL) solution of compound A1-2 (16.0 g, 63.9 mmol, 1.0 eq). The reaction mixture was stirred overnight at 120 °C. After the reaction was complete, the reaction mixture was cooled and concentrated to give a brown solid compound A1-3 (20.9 g, crude). No further purification was required, and it was used directly in the next step.

[0184] 3) Step Three

[0185] To a solution of compound A1-3 (20.9 g, 63.9 mmol, 1.0 eq) in THF (190 mL) and water (90 mL), NaIO4 (41.4 g, 191.7 mmol, 3.0 eq) was added. The reaction mixture was stirred overnight at 40 °C. After the reaction was complete, the reaction mixture was cooled, diluted with water (50 mL), and extracted with EtOAc (150 mL x 4). The combined organic phases were washed with saturated sodium thiosulfate aqueous solution (60 mL x 3) and brine (80 mL), dried over Na2SO4, and concentrated to give a crude product, which was purified by silica gel column chromatography (petroleum ether / EtOAc = 20:1) to give a white solid compound A1-4 (7.0 g, 41.4% yield in two steps). 1 H NMR (400MHz, CDCl3): δ10.30 (brs, 1H), 8.07 (d, J = 1.6Hz, 1H), 7.91 (d, J = 1.6Hz, 1H).

[0186] 4) Step Four

[0187] Under N2, LiHMDS (199 mL, 199.0 mmol, 2.5 eq) was added dropwise to a solution of (triphenylphosphine)acetonitrile (24.0 g, 79.6 mmol, 1.0 eq) cooled to 0 °C in 240 mL of THF. The reaction mixture was stirred at 0 °C for 1 h, and MeI (22.6 g, 159.2 mmol, 2.0 eq) was added dropwise while stirring at room temperature for 30 min. After the reaction was complete, the reaction mixture was diluted with saturated NH4Cl aqueous solution (200 mL) and extracted with EtOAc (120 mL x 3). The combined organic layers were washed with brine (90 mL), dried over anhydrous sodium sulfate, and concentrated to give compound A1-5 (26.2 g, crude, HPLC = 54%), a brown oil, which was used directly in subsequent reactions.

[0188] Under N2, compound A1-5 (26.2 g, crude product) was added to a toluene (66 mL) solution of compound A1-4 (6.6 g, 25.0 mmol, 1.0 eq). The reaction mixture was stirred at 70 °C for 2 hours. After the reaction was complete, the reaction mixture was cooled and concentrated to give a crude product, which was purified by silica gel column chromatography (petroleum ether / EtOAc = 20:1) to give compound A1-6 (4.7 g, 62.7%) as a grayish-white solid.

[0189] 1 H NMR (300MHz, CDCl3): δ8.15(d,J=1.8Hz,1H),7.92(d,J=1.8Hz,1H),7.16(d,J=1.5Hz,1H),1.75(s,3H).

[0190] 5) Step Five

[0191] Under N2 atmosphere, SnCl2-2H2O (17.9 g, 79.2 mmol, 5.7 eq) was added to a solution of compound A1-6 (4.2 g, 13.9 mmol, 1.0 eq) in EtOH (84 mL). The reaction mixture was stirred at 78 °C for 30 min. Then, the reaction mixture was cooled to room temperature, and NaBH4 (1.3 g, 33.4 mmol, 2.4 eq) was added in portions, followed by stirring at 78 °C for 1 h. After the reaction was complete, the reaction mixture was cooled and concentrated to give a crude product. Purification by silica gel column chromatography (petroleum ether / EtOAc = 10:1) gave a white solid compound A1-7 (3.7 g, 97.9%). 1H NMR (300MHz, CDCl3): δ7.02–6.90(m,2H),6.79(d,J=1.8Hz,1H),3.87(brs,2H),1.86(d,J=1.5Hz,3H).LCMS ESI m / z[M+H] + 271.0.

[0192] 6) Step Six

[0193] Boc₂O (9.4 g, 43.2 mmol, 3.0 eq) was added to a DCM (60 mL) solution of compound A1-7 (3.9 g, 14.4 mmol, 1.0 eq), TEA (2.9 g, 28.8 mmol, 2.0 eq), and DMAP (171 mg, 1.4 mmol, 0.1 eq). The reaction mixture was stirred at room temperature for 3 hours. After the reaction was complete, the mixture was concentrated to give a crude product. Purification by silica gel column chromatography (petroleum ether / EtOAc = 50:1) gave a white solid compound A1-8 (5.2 g, 76.8%). 1 H NMR (400MHz, CDCl3): δ7.59(d,J=2.0Hz,1H),7.29(d,J=2.0Hz,1H),6.83(d,J=0.8Hz,1H),1.80(d,J=1.2Hz,3H),1.48(s,18H).LCMS ESI m / z[M+Na] + 493.0.

[0194] 7) Step Seven

[0195] Xantphos (55 mg, 0.09 mmol, 0.15 eq) and Pd2(dba)3 (37 mg, 0.04 mmol, 0.06 eq) were added to a solution of compound A1-8 (300 mg, 0.6 mmol, 1.0 eq), benzophenone imine (174 mg, 0.9 mmol, 1.5 eq), and t-BuONa (185 mg, 1.9 mmol, 3.0 eq) in 1,4-dioxane (3 mL). After the reaction was complete, the mixture was cooled, diluted with water (3 mL), and extracted with EtOAc (5 mL x 4). The combined organic phases were washed with brine (8 mL), dried over Na2SO4, and concentrated to give a brown solid compound A1-9 (350 mg, crude).

[0196] 8) Step Eight

[0197] Hydroxylamine hydrochloride (222 mg, 3.2 mmol, 5.0 eq) was added to a MeOH solution of compound A1-9 (350 mg, 0.6 mmol, 1.0 eq) in 6 mL of water. After the reaction was complete, the reaction mixture was diluted with water (5 mL) and extracted with EtOAc (6 mL x 3). The combined organic phases were washed with brine (8 mL), dried over Na2SO4, and concentrated to give the crude product. The crude product was purified by silica gel column chromatography (petroleum ether / EtOAc = 5:1) to give a brown solid compound A1-10 (83 mg, 42.1% yield in two steps). 1 H NMR (400MHz, CDCl3): δ7.38(d,J=2.0Hz,1H),7.00(d,J=1.2Hz,1H),6.46(d,J=2.0Hz,1H),6.12(brs,1H),1.83(d,J=1.2Hz,3H),1.52(s,9H).LCMS ESI m / z[M+H] + 308.2.

[0198] 9) Step Nine

[0199] Compounds A1-11 (65 mg, 0.3 mmol, 1.1 eq, prepared according to the synthetic method of WO2023 / 154519), TCFH (152 mg, 0.5 mmol, 2.0 eq), and NMI (111 mg, 1.4 mmol, 5.0 eq) were added to a solution of compound A1-10 (83 mg, 0.3 mmol, 1.0 eq) in ACN (2 mL). After the reaction was complete, the reaction mixture was diluted with water (4 mL) and extracted with EtOAc (4 mL x 3). The combined organic phases were washed with brine (6 mL), dried over Na2SO4, and concentrated to give a crude product. The crude product was purified by silica gel column chromatography (petroleum ether / EtOAc = 3:1) to give a white solid compound A1-12 (110 mg, 80.3%). 1 H NMR (300MHz, CD3OD): δ

[0200] 8.43(d,J=3.9Hz,1H),8.20(d,J=1.2Hz,1H),7.98(d,J=1.2Hz,1H),7.89(d,J=1.8Hz,1H),7.83(d,J=2.1Hz,1H),7.79(d ,J=7.5Hz,1H),7.34(dd,J=7.8,4.8Hz,1H),7.11(d,J=1.5Hz,1H),2.49(s,3H),1.78(d,J=1.2Hz,3H),1.52(s,9H).LCMS ESI m / z[M+H] + 509.2.

[0201] 10) Step Ten

[0202] Compound A1-12 (90 mg, 0.2 mmol, 1.0 eq) was dissolved in ethyl hydrochloride solution (2 mL, 4 N) and stirred at room temperature for 2 hours. The residue was added to saturated Na2CO3 aqueous solution (3 mL), stirred at room temperature for 30 minutes, and then filtered to give the crude product. Purification by preparative thin-layer chromatography (petroleum ether / EtOAc = 1:1) yielded A1 (29 mg, 40.1%). 1 H NMR (400MHz, CDCl3): δ8.50(d,J=4.4Hz,1H),8.15–8.00(m,2H),7.77(d,J=0.8Hz,1H),7.64(d,J=7.6Hz,1H ),7.27–7.19(m,2H),7.02(d,J=1.2Hz,1H),6.97(d,J=1.6Hz,1H),2.51(s,3H),1.88(d,J=1.2Hz,3H).LCMS ESI m / z[M+H] + 409.0.

[0203] Example 2. Synthesis of compound B2

[0204]

[0205] 1) Step One

[0206] Under N2, t-BuOK (10.2 g, 91.1 mmol, 2.0 eq) was added to a THF (100 mL) solution of methoxymethyltriphenylphosphonium chloride (31.2 g, 91.1 mmol, 2.0 eq). After stirring the mixture at room temperature for 1 hour, compound B2-1 (10.0 g, 45.6 mmol, 1.0 eq) was added and stirred at room temperature for 6 hours. After stirring, MTBE (10 mL) was added and the mixture was filtered. The filtrate was concentrated to obtain the residue. Purification by silica gel column chromatography (petroleum ether) yielded a yellow oily compound B2-2 (7.2 g, 63.8%). 1 H NMR (400MHz, CDCl3): δ7.94(d,J=8.4Hz,1H),7.49(d,J=2.0Hz,1H),7.31(dd, J=8.4,2.0Hz,1H),6.28(d,J=7.2Hz,1H),5.56(d,J=7.2Hz,1H),3.80(s,3H).

[0207] 2) Step Two

[0208] Compound B2-2 (4.8 g, 19.6 mmol, 1.0 eq) was dissolved in dioxane hydrochloride solution (49.0 mL, 4 N, 196.3 mmol, 10.0 eq) under N2 conditions and stirred at room temperature for 2 hours. After the reaction was completed, the reaction mixture was concentrated to give compound B2-3 (4.7 g, crude product), which is a yellow oil.

[0209] 3) Step Three

[0210] Under nitrogen atmosphere, compound B2-3 (3.5 g, 15.0 mmol, 1.0 eq) and ethyl (triphenylphosphine)acetate (5.7 g, 16.5 mmol, 1.1 eq) were dissolved in toluene (35 mL) and stirred overnight at 70 °C. The reaction mixture was cooled and concentrated. The residue was purified by silica gel column chromatography (petroleum ether / EtOAc = 100:1) to give a yellow oily compound B2-4 (3.1 g, 70.7% yield in two steps).

[0211] 4) Step Four

[0212] A solution of compound B2-4 (3.0 g, 9.9 mmol, 1.0 eq) and PtO2 (606 mg, 2.7 mmol, 0.27 eq) in MeOH (30 mL) was stirred overnight at room temperature under a H2 atmosphere. The reaction mixture was filtered and concentrated. The residue was purified by silica gel column chromatography (petroleum ether / EtOAc = 200:1) to give compound B2-5 (2.5 g, 82.8%) as a yellow oil. 1 H NMR (400MHz, DMSO-d6): δ

[0213] 7.65(d,J=2.0Hz,1H),7.47(dd,J=8.0,2.0Hz,1H),7.28(d,J=8.0Hz,1H),3. 57(s,3H),2.73–2.62(m,2H),2.33(d,J=7.2Hz,2H),1.87–1.75(m,2H).LCMS ESI m / z[M+H] + 291.0,293.0

[0214] 5) Step Five

[0215] To a stirred solution of compound B2-5 (2.5 g, 8.2 mmol, 1.0 eq) in THF (12.5 mL) and water (12.5 mL), NaOH (980 mg, 24.6 mmol, 3.0 eq) was added, and the mixture was stirred overnight at room temperature. The mixture was diluted with water (10 mL), acidified to pH 6 with aqueous HCl (1 N), and extracted with EtOAc (20 mL x 2). The combined organic layers were washed with brine (50 mL x 2), dried over Na2SO4, and concentrated under reduced pressure to give a yellow oily compound B2-6 (2.1 g, 92.4%), which was used directly in the next step. 1 H NMR (400MHz, DMSO-d6): δ12.10(brs,1H),7.67(d,J=2.0Hz,1H),7.49(dd,J=8.0,2.0H z,1H),7.31–7.27(m,1H),2.76–2.63(m,2H),2.24(t,J=7.2Hz,2H),1.88–1.70(m,2H).

[0216] 6) Step Six

[0217] Compound B2-6 (2.1 g, 7.5 mmol, 1.0 eq) was dissolved in SOCl2 (26.5 mL), heated to 80 °C, and stirred for 30 min. The reaction mixture was then cooled to room temperature, and a solution of AlCl3·6H2O (2.3 g, 9.5 mmol, 1.25 eq) in DCM (12.0 mL) was added dropwise, followed by stirring at room temperature for another 2 h. After completion, the reaction mixture was quenched with 10% NaOH aqueous solution (12.0 mL), diluted with brine (10 mL), and extracted with DCM (50 mL x 2). The combined organic extracts were dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (petroleum ether / EtOAc = 10:1–5:1) to give compound B2-7 (1.6 g, 81.5%) as a white solid. 1 H NMR (300MHz, DMSO-d6): δ7.99(d,J=2.1Hz,1H),7.91(d,J=2.1Hz,1H),2.90(t,J=6.0Hz,2H),2.60(t,J=7.2Hz,2H),2.14–2.02(m,2H).LCMS ESI m / z[M+H] + 259.0, 260.0

[0218] 7) Step Seven

[0219] Under nitrogen atmosphere, NH₂OH·HCl (266 mg, 3.8 mmol, 1.1 eq) was added to a pyridine (5 mL) solution of compound B2-7 (900 mg, 3.5 mmol, 1.0 eq), and the mixture was stirred at 50 °C for 2 hours. After cooling, the pH was adjusted to 8 with solid Na₂CO₃, and the mixture was extracted with DCM (50 mL x 4). The combined organic phases were concentrated to give a yellow solid of compound B2-8 (600 mg, 63.0%), which was used directly in the next step.

[0220] 1 H NMR (400MHz, DMSO-d6): δ11.50(s,1H),7.94(d,J=2.0Hz,1H),7.68(d,J=2.0Hz,1H),2.73(t,J=6.0Hz,2H),2.64(t,J=6.4Hz,2H),1.86–1.70(m,2H).

[0221] 8) Step Eight

[0222] Under nitrogen atmosphere, a polyphosphoric acid solution of compound B2-8 (600 mg, 2.2 mmol, 1.0 eq) in 6.0 mL was stirred overnight at 80 °C. After cooling, the solution was quenched with saturated ice-water solution (5.0 mL), diluted with water (5 mL), and extracted with EtOAc (20 mL x 4). The organic layer was dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (petroleum ether / EtOAc = 10:1) to give a yellow solid compound B2-9 (320 mg, 53.4%). 9) Step Nine

[0223] Under N2, t-BuONa (336 mg, 3.5 mmol, 3.0 eq) was added to a solution of compound B2-9 (320 mg, 1.2 mmol, 1.0 eq) and benzophenone imine (318 mg, 1.7 mmol, 1.5 eq) in 1,4-dioxane (3.2 mL). The mixture was purged three times with nitrogen, and then Pd2(dba)3 (64 mg, 0.07 mmol, 0.06 eq) and Xantphos (83 mg, 0.14 mmol, 0.12 eq) were added. The mixture was then purged three times with nitrogen and stirred at 90 °C for 2 hours. The reaction mixture was filtered through a diatomaceous earth mat, and the filtrate was concentrated to give the residue. Purification by silica gel column chromatography (petroleum ether / EtOAc = 5:1) gave compound B2-10 (330 mg, 75.4%) as a yellow solid. LCMS ESI m / z [M+H] + 375.2

[0224] 10) Step Ten

[0225] Under N2 conditions, NH2OH·HCl (398.5 mg, 4.4 mmol, 10.0 eq) was added to a MeOH (1.65 mL) solution of compound B2-10 (165 mg, 0.44 mmol, 1.0 eq), and the mixture was stirred at room temperature for 0.5 h. The mixture was adjusted to pH ~8 with solid Na2CO3 and extracted with EtOAc (40 mL x 4). The combined organic phases were concentrated to give a yellow solid compound B2-11 (75 mg, 80.9%), which was used directly in the next step. 1 H NMR (400MHz, DMSO-d6): δ9.47(brs,1H),6.42(d,J=2.4Hz,1H),6.17(d,J=2.0Hz,1H) ,5.33(brs,2H),2.66(t,J=7.2Hz,2H),2.11(t,J=7.2Hz,2H),2.03–1.90(m,2H).LCMS ESI m / z[M+H] + :211.0

[0226] 11) Step Eleven

[0227] To a solution of compound B2-11 (45 mg, 0.2 mmol, 1.0 eq) in ACN (0.75 mL), Al-11 (47 mg, 0.2 mol, 1.0 eq), TCFH (120 mg, 0.4 mmol, 2.0 eq) and NMI (87.5 mg, 1.05 mmol, 5.0 eq) were added, and the mixture was stirred at room temperature for 1 hour. The filter cake was filtered and dried to obtain B2 (40 mg, 45.4%). 1 H NMR (400MHz, DMSO-d6): δ8.46(d,J=4.4Hz,1H),8.39(s,1H),8.10(s,1H),7.73(d,J=7.6Hz,1H),7.67(d,J=1.6Hz, 1H),7.43(d,J=1.6Hz,1H),7.29(dd,J=7.6,4.8Hz,1H),2.79(t,J=6.8Hz,2H),2.45(s,3H),2.25–1.95(m,4H).LCMS ESIm / z[M+H] + 412.0.

[0228] Example 3. Synthesis of compound A14

[0229]

[0230] 1) Step One

[0231] Under N2 protection, 3-bromo-5-methoxypyridine (616 mg, 3.28 mmol, 1.0 eq), 3,3-difluoroazacyclobutane hydrochloride (510 mg, 3.93 mmol, 1.2 eq), Xantphos (376 mg, 0.65 mmol, 0.2 eq), cesium carbonate (3.2 g, 9.82 mmol, 3.0 eq), and Pd2(dba)3 (300 mg, 0.32 mmol, 0.1 eq) were dissolved in dioxane (25 mL), substituted with N2 three times, and stirred overnight at 110 °C. After the reaction was complete, the reaction solution was diluted with water (150 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was separated and purified by silica gel column chromatography (eluent: dichloromethane: methanol = 30:1) to give brown oily compound A14-1 (350 mg, 53%). 1 HNMR(400MHz,DMSO-d6)δ7.75(d,J=2.4Hz,1H),7.55(d,J=2.3Hz,1H),6.57(t,J=2.4Hz,1H),4.34(t,J=12.4Hz,4H),3.79(s,3H).LCMS ESI m / z[M+H] + :201.1.

[0232] 2) Step Two

[0233] A14-1 (300 mg, 1.49 mmol, 1.0 eq) was dissolved in MeCN (15 mL) and cooled to 0 °C. NBS solution (NBS (213 mg, 1.19 mmol, 0.8 eq) dissolved in MeCN (5 mL)) was added dropwise to the solution at 0 °C. The reaction mixture was stirred at 0 °C for 40 minutes. After the reaction was complete, the reaction mixture was concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (eluent: petroleum ether: ethyl acetate = 8:1) to give a yellow oily compound A14-2 (100 mg, 23%). 1 H NMR (400MHz, DMSO-d6) δ7.32(d,J=2.5Hz,1H),6.71(d,J=2.5Hz,1H),4.37(t,J=12.3Hz,4H),3.91(s,3H).LCMS ESIm / z[M+H] + 279.0 / 281.0

[0234] 3) Step Three

[0235] Under N2 protection, A14-2 (100 mg, 0.35 mmol, 1.0 eq), A14-3 (122 mg, 0.43 mmol, 1.2 eq, prepared according to the synthesis method of patent WO2009 / 14620), potassium carbonate (149 mg, 1.07 mmol, 3.0 eq), and Pd(dppf)Cl2 (30 mg, 0.03 mmol, 0.1 eq) were dissolved in dioxane (4 mL) and H2O (1 mL), and the mixture was substituted with N2 three times and stirred at 105 °C for 3.5 h. After the reaction was complete, the reaction solution was diluted with water (60 mL) and extracted with ethyl acetate (3 × 30 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (eluent: petroleum ether: ethyl acetate = 5:1) to give a brown solid compound A14-4 (80 mg, 63%). 1 LCMS ESIm / z[M+H] + 355.1.

[0236] 4) Step Four

[0237] A14-4 (60 mg, 0.16 mmol, 1.0 eq) was dissolved in THF / MeOH / H2O (1 mL / 1 mL / 1 mL), and LiOH H2O (15 mg, 0.33 mmol, 2.0 eq) was slowly added. The reaction mixture was stirred at room temperature for 2 h. After the reaction was complete, the pH of the reaction mixture was adjusted to 3–4 with 1 N HCl solution, and extracted with DCM (3 × 20 mL). The combined organic phases were washed with saturated brine (40 mL), dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated under reduced pressure to give a white solid compound A14-5 (50 mg, 87%). 1 H NMR (400MHz, DMSO-d6)δ

[0238] 7.63(s,1H),7.60(d,J=2.3Hz,1H),6.73(d,J=2.3Hz,1H),4.41(t,J=12.3Hz,4H),3.82(s,3H),2.39(s,3H).LCMS ESI m / z[M+H] + 341.0

[0239] 5) Step Five

[0240] A14-5 (36 mg, 0.11 mmol, 1.3 eq), A1-10 (25 mg, 0.08 mmol, 1.0 eq), N-methylimidazole (40 mg, 0.48 mmol, 6.0 eq), and TCFH (71 mg, 0.24 mmol, 3.0 eq) were dissolved in anhydrous MeCN (3 mL), and the reaction mixture was stirred at room temperature for 3 hours. After the reaction was complete, the reaction mixture was diluted with water (40 mL) and then extracted with ethyl acetate (3 × 20 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by preparative thin-layer chromatography (developing solvent: DCM:MeOH = 20:1) to give a white solid compound A14-6 (25 mg, 49%). 1 H NMR (400MHz, DMSO-d6) δ10.39(s,1H),8.93(s,1H),8.06(s,1H),7.91–7.83(m,2H),7.62(d,J=2.3Hz,1H),7.11(d,J=1.6 Hz,1H),6.76(d,J=2.3Hz,1H),4.43(t,J=12.3Hz,4H),3.84(s,3H),2.38(s,3H),1.69(d,J=1.5Hz,3H),1.47(s,9H).LCMS ESI m / z[M+H] + 630.1

[0241] 6) Step Six

[0242] A14-6 (25 mg, 0.04 mmol, 1.0 eq) was dissolved in DCM (1 mL) and cooled to 0 °C. HCl-dioxane (4 M, 1 mL) was added dropwise to the solution at 0 °C, and the reaction mixture was stirred at room temperature for 1 h. After the reaction was complete, the pH of the reaction mixture was adjusted to 9 with saturated sodium bicarbonate solution, and extracted with DCM (3 × 20 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by preparative thin-layer chromatography (developing solvent: DCM:MeOH = 20:1) to give the final product A14 (14.3 mg, 68%). 1H NMR (400MHz, DMSO-d6) δ10.07(s,1H),8.01(s,1H),7.62(d,J=2.2Hz,1H),7.16(d,J=1.9Hz,1H),7.11(d,J=1.9Hz,1H),7.05(d, J=1.8Hz,1H),6.76(d,J=2.2Hz,1H),5.47(s,2H),4.43(t,J=12.3Hz,4H),3.84(s,3H),2.37(s,3H),1.77(d,J=1.5Hz,3H).LCMS ESI m / z[M+H] + 530.1

[0243] Example 4. Synthesis of compound A20

[0244]

[0245] Referring to the synthesis method of compound A14 in Example 3, 2-chloro-5-fluoropyrimidine was used instead of A14-2 to synthesize compound A20. 1 H NMR (400MHz, methanol-d4) δ8.78(s,2H),8.54(s,1H),7.66(d,J=1.9Hz,1H),7.48(d ,J=2.0Hz,1H),7.11(d,J=1.6Hz,1H),2.88(s,3H),1.87(d,J=1.5Hz,3H).LCMS ESI m / z[M+H] + 427.95.

[0246] Example 5. Synthesis of compound A21

[0247]

[0248] 1) Step One

[0249] A21-1 (500 mg, 3.0 mmol, 1.0 eq.) was dissolved in methanol and tetrahydrofuran (6 mL / 6 mL). The reaction mixture was cooled to 0 °C, and sodium borohydride (112 mg, 3.0 mmol, 1.0 eq.) was slowly added. The reaction mixture was stirred at 0 °C for 1 hour. After the reaction was complete, the reaction mixture was diluted with water (100 mL) and then extracted with ethyl acetate (3 × 40 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to give A21-2 (500 mg, 98% yield). 1H NMR(400MHz,DMSO-d6)δ7.08–6.96(m,2H),5.49(d,J=6.0Hz,1H),5.05(q,J=6.6Hz,1 H),2.95–2.86(m,1H),2.73–2.61(m,1H),2.44–2.35(m,1H),1.89–1.77(m,1H).LCMS ESI m / z[M-H2O+H] + 153.1.

[0250] 2) Step Two

[0251] Under nitrogen protection, A21-2 (300 mg, 1.76 mmol, 1.0 eq.), 2-chloro-3-hydroxy-5-fluoropyridine (260 mg, 1.76 mmol, 1.0 eq.), and triphenylphosphine (1.16 g, 4.41 mmol, 2.5 eq.) were dissolved in tetrahydrofuran (10 mL). DEAD (768 mg, 4.41 mmol, 2.5 eq.) was slowly added dropwise to the reaction mixture at 0 °C. The reaction mixture was then heated to room temperature and stirred overnight. After the reaction was complete, the reaction mixture was concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography (eluent: petroleum ether: ethyl acetate = 40:1) to give A21-3 (450 mg, 85% yield). 1 H NMR (400MHz, CDCl3) δ7.97(d,J=2.5Hz,1H),7.14(dd,J=9.1,2.5Hz,1H),6.96(dd,J=7.8,2.1Hz,1H),6.82(td,J =9.0,2.2Hz,1H),5.75–5.65(m,1H),3.24–3.13(m,1H),3.01–2.91(m,1H),2.74–2.62(m,1H),2.37–2.26(m,1H).

[0252] 3) Step Three

[0253] Referring to the synthesis method of compound A14 in Example 3, A21-3 was used instead of A14-2 to synthesize compound A21. 1HNMR(400MHz, DMSO-d6)δ10.08(s,1H),8.37(d,J=2.3Hz,1H),8.05(s,1H),7.94(dd,J=10.8,2.4Hz,1H),7.23(s,1H),7.20–7.11(m,3H),7 .08(d,J=1.7Hz,1H),6.04–5.96(m,1H),3.00–2.85(m,2H),2.77–2.66(m,1H),2.34(s,3H),2.16–2.04(m,1H),1.80(d,J=1.5Hz,3H).LCMS ESI m / z[M+H] + 594.95.

[0254] Example 6. Synthesis of Compound B1

[0255]

[0256] 1) Step One

[0257] B1-1 (5.0 g, 20.0 mmol, 1.0 eq) was added to DMF (50 mL), followed by dimethylhydroxylamine hydrochloride (2.0 g, 20.0 mmol, 1.0 eq), HATU (9.1 g, 24.0 mmol, 1.2 eq), and DIEA (7.8 g, 60.1 mmol, 3.0 eq). The mixture was stirred at room temperature for 1 hour. The reaction was monitored by LCMS until complete. The mixture was quenched with water (50 mL), extracted with EtOAc (50 mL x 3), and the organic phases were combined, washed with brine (50 mL x 2), dried over Na2SO4, and filtered. The filtrate was concentrated to obtain a crude product, which was purified by silica gel column chromatography (petroleum ether / EtOAc = 3:1) to obtain B1-2 (5.5 g, 93.8%), a yellow oily liquid. 1 H NMR (400MHz, CDCl3): δ7.55(d,J=2.0Hz,1H),7.36(dd,J=8.0,1.6Hz,1H),7.17(d,J=8.4Hz,1H),3.86(s,2H),3.72(s,3H),3.22(s,3H).

[0258] 2) Step Two

[0259] B1-2 (5.0 g, 17.0 mmol, 1.0 eq) was added to THF (50 mL), and the system was cooled to -40 °C. A THF solution of methyl magnesium bromide (17.0 mL, 3 M, 51.2 mmol, 3.0 eq) was added dropwise. After the addition was complete, the system was kept at -40 °C for 2 hours. The reaction was monitored by LCMS until complete. The system was quenched with water (50 mL), extracted with EtOAc (50 mL x 3), and the organic phases were combined, washed with brine (50 mL x 2), dried over Na2SO4, and filtered. The filtrate was concentrated to obtain a crude product, which was purified by silica gel column chromatography (petroleum ether / EtOAc = 5:1) to obtain B1-3 (2.3 g, 54.4%), which was a colorless oily liquid. 1 H NMR (300MHz, CDCl3): δ7.56(d,J=1.8Hz,1H),7.37(dd,J=8.1,1.8Hz,1H),7.17(d,J=8.1Hz,1H),3.81(s,2H),2.22(s,3H).

[0260] 3) Step Three

[0261] B1-3 (1.5 g, 6.1 mmol, 1.0 eq) and triethyl phosphoroacetate (2.0 g, 9.1 mmol, 1.5 eq) were added to toluene (15 mL), and the mixture was refluxed at 120 °C overnight. After the reaction was complete, the mixture was concentrated to obtain a crude product. This crude product was purified by silica gel column chromatography (petroleum ether / EtOAc = 20:1) to obtain B1-4 (1.7 g, 83.1%), which was a colorless oily liquid.

[0262] 4) Step Four

[0263] Referring to the synthesis method of compound B2 in Example 2, compound B1 was synthesized by replacing B2-4 with B1-4. 1 H NMR (400MHz, DMSO-d6): δ10.51(brs,1H),9.85(brs,1H),8.51(s,2H),8.18(d,J=0.8Hz,1H),7.82–7.68(m,2H),7.48(d,J=1.6Hz,1H) ,7.30(dd,J=7.6,4.8Hz,1H),2.98–2.80(m,1H),2.64–2.50(m,5H),2.30–2.20(m,1H),1.92–1.80(m,1H),1.02(d,J=6.4Hz,3H).LCMS ESIm / z[M+H] + 426.0

[0264] Example 7. Synthesis of compound B4

[0265]

[0266] Referring to the synthesis method of compound B1 in Example 6, in step two, ethyl magnesium bromide was used instead of methyl magnesium bromide to synthesize compound B4. 1 H NMR (300MHz, DMSO-d6): δ10.50(brs,1H),9.86(brs,1H),8.56–8.45(m,2H) ,8.18(s,1H),7.80–7.70(m,2H),7.47(d,J=1.8Hz,1H),7.31(dd,J=7.5,4. 8Hz,1H),2.92–2.80(m,1H),2.75–2.60(m,1H),2.56–2.46(m,3H),2.32–2. 17(m,2H),2.00–1.82(m,1H),1.50–1.20(m,2H),0.94(t,J=7.2Hz,3H).LCMS ESI m / z[M+H] + 440.1.

[0267] Example 8. Synthesis of compound B3

[0268]

[0269] 1) Step One

[0270] At -40°C, isopropyl magnesium chloride·lithium chloride (i-PrMgCl·LiCl, 10.8 g, 74.6 mmol) was added dropwise to a tetrahydrofuran (100 mL) solution of B3-1 (10.0 g, 29.8 mmol). The mixture was stirred at -40°C for 1 hour. Then, N,N-dimethylformamide (8.7 g, 119.3 mmol) was added dropwise, and the mixture was stirred at 25°C for 1 hour. After the reaction was complete, the reaction mixture was quenched with a saturated ammonium chloride aqueous solution (50 mL), and then extracted with dichloromethane (50 mL × 3). The organic layer was washed with saturated brine (50 mL × 2), dried over anhydrous sodium sulfate, and then concentrated to give the crude product. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 50:1) to give a colorless oily B3-2 (5.0 g, yield 70.6%). 1 H NMR (300MHz, CDCl3): δppm 10.38 (brs, 1H), 7.48 (d, J = 1.5Hz, 1H), 7.31 (dd, J = 9.6, 1.5Hz, 1H).

[0271] 2) Step Two

[0272] Michaelis-Menten acid (3.6 g, 25.3 mmol) was added dropwise to a solution of B3-2 (5.0 g, 21.1 mmol) in 75 mL of triethylamine at 0 °C. Then, formic acid (58.1 mL, 1.54 mol) was added dropwise to the mixture at 0 °C, followed by stirring at 100 °C for 6 hours. After the reaction was complete, the reaction mixture was cooled, quenched with water (50 mL) at 0 °C, and extracted with ethyl acetate (50 mL × 3). The organic layer was washed with saturated brine (30 mL × 3), dried over anhydrous sodium sulfate, and concentrated to give the crude product. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to give a white solid B3-3 (4.0 g, yield 67.5%). 1 H NMR (400MHz, CDCl3): δppm 7.36 (d, J=2.0Hz, 1H), 7.17 (dd, J=8.8, 2.0Hz, 1H), 3.16–3.02 (m, 2H), 2.66–2.56 (m, 2H).

[0273] 3) Step Three

[0274] Under a nitrogen atmosphere, a solution of B3-3 (1.5 g, 5.3 mmol) in thionyl chloride (15 mL) was stirred at 80 °C for 1 hour. After the reaction was complete, the mixture was cooled and concentrated to obtain a residue. This residue was dissolved in tetrahydrofuran (15 mL), cooled to 0 °C, and ammonia was added dropwise at 0 °C until the pH value was greater than 7, while stirring for 1 hour. The mixture was then concentrated to obtain a residue, which was washed with saturated brine (10 mL × 3), dried with anhydrous sodium sulfate, and concentrated again to give a white solid B3-4 (0.8 g, yield 53.5%). LCMS ESI m / z [M+H] + 281.9.

[0275] 4) Step Four

[0276] Under a nitrogen atmosphere, sodium hydride (427 mg, 60% purity, 10.7 mmol) was added dropwise to a solution of B3-4 (1.5 g, 5.3 mmol) in 50 mL of N,N-dimethylacetamide at 0 °C. The mixture was then stirred at 120 °C for 2 hours. After the reaction was complete, the reaction mixture was cooled to 0 °C, quenched with water (50 mL), and extracted with ethyl acetate (50 mL × 3). The organic layer was washed with saturated brine (50 mL × 6), dried over anhydrous sodium sulfate, and concentrated to give a residue. The residue was ground with dichloromethane (15 mL) for 30 minutes to give a white solid B3-5 (1.2 g, yield 86.1%). LCMS ESI m / z [M+H] + 261.9.

[0277] 5) Step Five

[0278] Under a nitrogen atmosphere, benzophenone imine (292 mg, 1.6 mmol), sodium tert-butoxide (310 mg, 3.2 mmol), Pd2(dba)3 (60 mg, 0.07 mmol), and Xantphos (76 mg, 0.1 mmol) were added to a 3 mL solution of 1,4-dioxane (280 mg, 1.1 mmol) of B3-5. The mixture was stirred at 90 °C for 1 hour. After the reaction was complete, the reaction solution was concentrated to give a brown oily B3-6 (250 mg, crude product). LCMS ESI m / z [M+H] + 361.0.

[0279] 6) Step Six

[0280] Hydroxylamine hydrochloride (374 mg, 5.4 mmol) was added to a methanol (5 mL) solution of B3-6 (387 mg, 1.1 mmol), and the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the mixture was concentrated to obtain a crude product, which was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 15:1) to give a yellow solid B3-7 (300 mg, two-step reaction yield 37.9%). LCMS ESI m / z [M+H] + 197.0.

[0281] 7) Step Seven

[0282] Under a nitrogen atmosphere, TCFH (228 mg, 0.8 mmol) and N-methylimidazole (167 mg, 2.0 mmol) were added to a mixture of B3-7 (80 mg, 0.4 mmol) and A1-11 (89 mg, 0.4 mmol) in acetonitrile (ACN, 1 mL). The mixture was stirred at room temperature for 2 hours. After the reaction was complete, the mixture was concentrated to obtain a crude product, which was purified by silica gel column chromatography (eluting with ethyl acetate) to give B3 (30 mg, yield 18.4%). 1 H NMR (400MHz, DMSO-d6): δppm 10.46(brs,1H),10.39(brs,1H),8.54–8.45(m,2H),8.17(d,J=1.2Hz,1H),7.75(d,J=8.0Hz,1H),7.51(d,J=2.0Hz, 1H),7.35(d,J=2.0Hz,1H),7.30(dd,J=8.0,4.8Hz,1H),2.93(d,J=8.0Hz,2H),2.54(s,3H),2.53–2.42(m,2H).LCMS ESI m / z[M+H]+ 398.0.

[0283] Example 9. Synthesis of compound B9

[0284]

[0285] 1) Step One

[0286] 5-Bromopyrimidine (300 mg, 2.5 mmol), 3,3-difluoropyrrolidine hydrochloride (300 mg, 2.09 mmol), Pd2(dba)3 (191 mg, 0.20 mmol), BINAP (260 mg, 0.41 mmol), and sodium tert-butoxide (602 mg, 6.27 mmol) were dissolved in toluene (10 mL). The reaction mixture was replaced with N2 three times and stirred overnight at 110 °C. After the reaction was complete, the reaction solution was concentrated. The crude product was purified by silica gel column chromatography (eluent: dichloromethane:methanol = 20:1) to give a yellow solid B9-1 (630 mg, 50% purity, 81%). LCMS ESI m / z [M+H] + 186.1.

[0287] 2) Step Two

[0288] B9-1 (630 mg, 50% purity, 1.70 mmol) was dissolved in acetonitrile (15 mL). NBS (302 mg, 1.70 mmol) was added in portions to the reaction solution at 0 °C. After stirring at room temperature for 1 hour, the reaction solution was cooled back to 0 °C, and NBS (302 mg, 1.70 mmol) was added to the reaction solution. The reaction solution was then stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was diluted with water (100 mL) and extracted with dichloromethane (3 × 40 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (eluent: ethyl acetate: petroleum ether = 1:6) to give a yellow oily substance B9-2 (100 mg, 22%). LCMS ESI m / z [M+H] + :264.0 / 266.0.

[0289] 3) Step Three

[0290] B9-2 (160 mg, 0.60 mmol), A14-3 (256 mg, 0.90 mmol), Pd(dppf)Cl2 (49 mg, 0.06 mmol), and potassium carbonate (248 mg, 1.80 mmol) were dissolved in 1,4-dioxane / water (10 mL, v / v 4 / 1). The reaction mixture was replaced three times with N2 and stirred at 90 °C for 1 hour. After the reaction was complete, the reaction mixture was diluted with water (100 mL) and extracted with ethyl acetate (3 × 30 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (eluent: ethyl acetate: petroleum ether = 1:4) to give a yellow solid B9-3 (100 mg, 49%). LCMSESI m / z [M+H] + 340.1.

[0291] 4) Step Four

[0292] B9-3 (40 mg, 0.12 mmol) was dissolved in tetrahydrofuran and methanol (1 mL / 1 mL), and lithium hydroxide monohydrate (9 mg, 0.24 mmol) was dissolved in water (1 mL) and added dropwise to the reaction solution. The reaction solution was stirred overnight at room temperature. After the reaction was complete, the pH of the reaction solution was adjusted to 2–3 with 1 N hydrochloric acid solution, and extracted with ethyl acetate (3 × 15 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain B9-4 (40 mg, crude product). LCMS ESI m / z [M+H] + 326.1 [M+H] + ; 1 H NMR (400MHz, DMSO-d6) δ8.30(s,2H),8.10(s,1H),3.84(t,J=13.2Hz,2H),3.62(t,J=7.3Hz,2H),2.78(s,3H),2.61–2.53(m,2H).

[0293] 5) Step Five

[0294] B9-4 (15 mg, 0.04 mmol), B2-11 (8 mg, 0.03 mmol), and N-methylimidazole (18 mg, 0.22 mmol) were dissolved in acetonitrile (1.5 mL), and TCFH (32 mg, 0.11 mmol) was added to the reaction solution. The reaction solution was stirred at room temperature for 1 hour. After the reaction was complete, the solvent was removed by vacuum concentration, and the crude product was purified by preparative chromatography to obtain B9 (5.2 mg, 27%). LCMS ESI m / z [M+H] + 518.1; 1H NMR (400MHz, DMSO-d6) δ10.47(s,1H),9.78(s,1H),8.58(s,1H),8.31(s,2H),7.74(d,J=2.0Hz,1H),7.48(d,J=2.0Hz,1H), 3.87(t,J=13.1Hz,2H),3.64(t,J=7.3Hz,2H),2.85–2.79(m,5H),2.65–2.54(m,2H),2.21–2.15(m,2H),2.11–2.03(m,2H).

[0295] Example 10. Synthesis of compound B49

[0296]

[0297] 1) Step One

[0298] Under nitrogen protection, 4,6-dichloropyrimidine (200 mg, 1.34 mmol) and N-methylpiperazine (135 mg, 1.36 mmol) were dissolved in dioxane (4 mL). Pd2(dba)3 (122 mg, 0.13 mmol), XantPhos (155 mg, 0.26 mmol), and cesium carbonate (1.3 g, 4.02 mmol) were added to the reaction solution. The reaction solution was purged three times with N2 and stirred at 120 °C for 3 hours. The reaction solution was diluted with water (60 mL) and extracted with ethyl acetate (3 × 20 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 20:1) to give a yellow solid B49-1 (160 mg, 56%). LCMS ESI m / z [M+H] + 213.1.

[0299] 2) Step Two

[0300] Under nitrogen protection, B49-1 (150 mg, 0.71 mmol), compound A14-3 (238 mg, 0.84 mmol), Pd(dppf)Cl2 (52 mg, 0.70 mmol), and potassium carbonate (292 mg, 2.11 mmol) were dissolved in 1,4-dioxane (6 mL) and water (1.5 mL). The reaction solution was replaced with N2 three times and stirred at 105 °C for 3.5 hours. After the reaction was complete, the reaction solution was diluted with water (60 mL) and extracted with ethyl acetate (3 × 20 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (dichloromethane:methanol = 25:1) to give a yellow oil B49-2 (170 mg, 72%). LCMS ESI m / z [M+H] + 333.2.

[0301] 3) Step Three

[0302] Compound B49-2 (170 mg, 0.51 mmol) was dissolved in tetrahydrofuran / methanol / water (1 mL / 1 mL / 1 mL), and lithium hydroxide monohydrate (43 mg, 1.02 mmol) was slowly added. The reaction mixture was stirred at 60 °C for 2 hours. After the reaction was complete, the pH of the reaction mixture was adjusted to 3–4 with 1 N hydrochloric acid solution, and the solution was concentrated under reduced pressure to obtain B49-3, which was directly used in the next reaction. LCMS ESIm / z [M+H] + 319.1.

[0303] 4) Step Four

[0304] B2-11 (15 mg, 0.07 mmol, 1.0 eq), B49-3 (28 mg, 0.08 mmol, 1.2 eq), and N-methylimidazole (35 mg, 0.42 mmol, 6.0 eq) were dissolved in acetonitrile (2 mL). TCFH (62 mg, 0.21 mmol, 3.0 eq) was added to the reaction mixture, and the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the solvent was removed by vacuum concentration. The crude product was purified by preparative chromatography to obtain B49 (6.1 mg, 17%, formate form). LCMS ESI m / z [M+H] + :511.2; 1H NMR (400MHz, DMSO-d6) δ10.38(s,1H),9.82(s,1H),8.58(s,1H),8.36(s,1H),8.16(s,1H,HCOOH),7.72(d,J=2.0Hz,1H),7.44(d,J=2.0Hz,1H),6 .99(s,1H),3.69(t,J=4.8Hz,4H),2.81(t,J=7.0Hz,2H),2.73(s,3H),2 .40(t,J=5.0Hz,4H),2.23(s,3H),2.19–2.15(m,2H),2.11–2.06(m,2H).

[0305] Example 11. Synthesis of compound B50

[0306]

[0307] 1) Step One

[0308] B50-1 (250 mg, 1.07 mmol) and N,N-diisopropylethylamine (207 mg, 1.6 mmol) were dissolved in dichloromethane (8 mL), and propionyl chloride (109 mg, 1.17 mmol) was added at 0 °C. The reaction mixture was stirred overnight at room temperature. After the reaction was complete, the reaction mixture was directly concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 9 / 1) to give a pale yellow solid B50-2 (250 mg, 94%). 1 H NMR (400MHz, CDCl3) δ10.50(s,1H),9.00(s,1H),7.32(d,J=2.0Hz,1H),2.50(q,J=7.6Hz,2H),1.27(t,J=7.6Hz,3H).

[0309] 2) Step Two

[0310] B50-2 (630 mg, 2.17 mmol) was dissolved in DMF (15 mL), and cesium carbonate (1.42 g, 4.34 mmol) was slowly added at 0 °C. The reaction mixture was stirred overnight at 60 °C. After the reaction was complete, the reaction mixture was poured into water (100 mL) and stirred for 10 minutes. The precipitated solid was filtered to obtain 630 mg of crude product. The crude product was added to a petroleum ether / ethyl acetate mixture (1 / 1, 12 mL), ground, and filtered to obtain a light yellow solid B50-3 (332 mg, 56%). 1 H NMR (400MHz, DMSO-d6) δ12.04(s,1H),7.92(s,1H),7.52(s,1H),7.44(s,1H),2.13(s,3H).

[0311] 3) Step Three

[0312] B50-3 (100 mg, 0.36 mmol) and benzophenone imine (100 mg, 0.56 mmol) were dissolved in dioxane (4 mL). Pd2(dba)3 (34 mg, 0.036 mmol), XantPhos (44 mg, 0.08 mmol), and cesium carbonate (240 mg, 0.74 mmol) were added to the reaction solution. The reaction solution was replaced three times with N2 and stirred overnight at 100 °C. After the reaction was complete, the reaction solution was diluted with water (60 mL) and extracted with ethyl acetate (3 × 20 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain crude B50-4 (500 mg), which was used directly in the next step. LCMS ESI m / z [M+H] + :373.1.

[0313] 4) Step Four

[0314] Crude B50-4 (500 mg, 0.36 mmol) was dissolved in methanol (6 mL). Potassium acetate (263 mg, 3.35 mmol) and hydroxylamine hydrochloride (189 mg, 2.69 mmol) were added to the reaction solution. The reaction solution was stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (dichloromethane / methanol = 60 / 1, v / v) to obtain a yellow solid B50-5 (55 mg, 49%). 1 H NMR (400MHz, DMSO-d6) δ11.49(s,1H),7.66(s,1H),6.55(d,J=2.0Hz,1H),6.33(d,J=2.0Hz,1H),5.90(s,2H),2.02(d,J=1.2Hz,3H).

[0315] 5) Step Five

[0316] B50-5 (22 mg, 0.11 mmol), A14-5 (36 mg, 0.11 mmol), N-methylimidazole (52 mg, 0.63 mmol), and TCFH (89 mg, 0.32 mmol) were dissolved in anhydrous acetonitrile (3 mL), and the reaction mixture was stirred overnight at room temperature. After the reaction was complete, the reaction mixture was diluted with water (45 mL) and extracted with ethyl acetate (3 × 15 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by preparative thin-layer chromatography (dichloromethane / methanol = 20:1) to obtain B50 (15 mg, 27%). LCMS ESI m / z [M+H] +:531.1; 1 H NMR (400MHz, DMSO-d6) δ12.00(s,1H),10.44(s,1H),8.07(s,1H),7.87(s,1H),7.84(s,1H),7.71(d,J=2.0Hz,1H),7 .63(d,J=2.0Hz,1H),6.76(d,J=2.4Hz,1H),4.43(t,J=12.4Hz,4H),3.84(s,3H),2.39(s,3H),2.12(d,J=1.2Hz,3H).

[0317] Example 12. Synthesis of compounds B77 and B41

[0318]

[0319] 1) Step One

[0320] 5-Bromo-2-iodopyrimidine (431.18 mg, 3.19 mmol), A14-3 (300 mg, 1.06 mmol), Pd(dppf)Cl2 (77.56 mg, 0.106 mmol), and potassium acetate (439.51 mg, 3.18 mmol) were dissolved in dioxane (12 mL) and water (3 mL). The reaction mixture was purged three times with nitrogen and stirred at 70 °C for 1.5 hours. After the reaction was complete, the reaction mixture was diluted with water (100 mL) and extracted with ethyl acetate (3 × 30 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and the crude product was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 30:1) to give a white solid B41-1 (240 mg, 61.78%). 1 HNMR (400MHz, DMSO-d6)δ

[0321] 9.05(s,2H),8.25(s,1H),3.83(s,3H),2.83(s,3H).

[0322] 2) Step Two

[0323] B41-1 (5.0 g, 6.39 mmol), (S)-1-Boc-3-methylpiperazine (9.5 g, 19.16 mmol), Pd2(dba)3 (733 mg, 0.32 mmol), Xantphos (925 mg, 0.64 mmol), and cesium carbonate (10.4 g, 12.77 mmol) were dissolved in dioxane (125 mL). The reaction mixture was stirred overnight at 110 °C under nitrogen protection. After the reaction was complete, the reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 7:1) to give a yellow solid B41-2 (3.5 g, 51%). LCMS m / z = 433.2 [M+H] + .

[0324] 3) Step Three

[0325] B41-2 (3.5 g, 8.09 mmol) was dissolved in tetrahydrofuran (30 mL), and an aqueous solution of lithium hydroxide monohydrate (510 mg, 12.14 mmol) (30 mL) was slowly added. The reaction mixture was stirred at 60 °C for 2 h. After the reaction was complete, the reaction mixture was concentrated to remove the tetrahydrofuran, and then the pH of the reaction mixture was adjusted to about 4 with 3N HCl solution under ice bath conditions. A solid precipitated out; it was filtered, washed twice with pure water, collected, and dried to obtain brown solid B41-3 (3.4 g, 98%). LCMS m / z = 419.2 [M+H] + .

[0326] 4) Step Four

[0327] B2-11 (25 mg, 0.12 mmol) and B41-3 (50 mg, 0.12 mmol) were dissolved in acetonitrile (3 mL), and NMI (59 mg, 0.72 mmol) and TCFH (101 mg, 0.36 mmol) were added. The reaction mixture was stirred overnight at room temperature. After the reaction was complete, the reaction mixture was diluted with water (40 mL) and extracted with ethyl acetate (3 × 20 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by thin-layer chromatography (dichloromethane:methanol = 20:1) to obtain B77 (60 mg, 82.1%). LCMS m / z = 611.3 [M+H] + .

[0328] 5) Step Five

[0329] B77 (60 mg, 0.098 mmol) was dissolved in dichloromethane (2 mL), and HCl / 1,4-dioxane solution (4 M, 2 mL) was slowly added dropwise to the reaction solution. The reaction solution was stirred at room temperature for 2 h. After the reaction was complete, the reaction solution was concentrated under reduced pressure, and the resulting solid was washed three times with dichloromethane to obtain B41 hydrochloride (37.7 mg, 75.2%). LCMS m / z = 511.2 [M+H] + ; 1 H NMR (400MHz, DMSO-d6)δ

[0330] 10.52(s,1H),9.81(s,1H),9.62–9.42(m,1H),9.09(s,1H),8.64–8.57(m,3H),7.74(s,1H),7.48(s,1H),4.39(d,J=7.8Hz,1H),3.78 –3.75(m,1H),3.34–3.23(m,4H),3.15–3.06(m,1H),2.85–2.78(m,5H),2.20–2.14(m,2H),2.12–2.04(m,2H),1.21(d,J=6.7Hz,3H).

[0331] Example 13. Synthesis of compounds B78 and B57

[0332]

[0333] 1) Step One

[0334] B41-1 (120 mg, 0.38 mmol) was dissolved in tetrahydrofuran (2 mL), and lithium hydroxide monohydrate (24 mg, 0.57 mmol) was dissolved in water (2 mL) and added dropwise to the reaction solution. The reaction solution was stirred at 60 °C for 2 h. After the reaction was complete, the reaction solution was diluted with water (40 mL), the pH was adjusted to 3-4 with hydrochloric acid aqueous solution (3 M), and then extracted with ethyl acetate (3 × 20 mL). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a yellow solid B57-1 (110 mg, 97.3%). LCMS m / z = 298.9 [M + H] + .

[0335] 2) Step Two

[0336] B57-1 (110 mg, 0.38 mmol) and B2-11 (77 mg, 0.38 mmol) were dissolved in acetonitrile (6 mL), and NMI (187 mg, 2.28 mmol) and TCFH (320 mg, 1.14 mmol) were added. The reaction mixture was stirred overnight at room temperature. After the reaction was complete, the reaction mixture was poured into water (40 mL), the precipitated solid was filtered and dried, and the crude product was washed twice with acetonitrile to obtain a white solid B78 (130 mg, 69.8%). LCMS m / z = 491.0 [M+H] + .

[0337] 3) Step Three

[0338] B78 (60 mg, 0.12 mmol), (S)-3-pyrrolidone (32 mg, 0.37 mmol), Pd2(dba)3 (6 mg, 0.006 mmol), XantPhos (7 mg, 0.012 mmol), and cesium carbonate (80 mg, 0.24 mmol) were dissolved in 1,4-dioxane (1.5 mL). The reaction solution was purged with nitrogen three times and stirred overnight at 110 °C. The reaction solution was diluted with water (40 mL), extracted with ethyl acetate (3 × 20 mL), and the combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by thin-layer chromatography (dichloromethane:methanol = 15:1) to give B57 (16.9 mg, 23.8%). LCMS m / z = 498.2 [M+H] + ; 1 H NMR (400MHz, DMSO-d6) δ10.47(s,1H),9.80(s,1H),8.57(s,1H),8.21(s,2H),7.74(d,J=2.1Hz,1H),7.49(d,J=2.1Hz,1H),5.04(d,J=3.9Hz,1H), 4.45(s,1H),3.53–3.48(m,1H),3.47–3.40(m,2H),3.22(d,J=10.7Hz,1H ),2.84–2.78(m,5H),2.21–2.15(m,2H),2.11–2.03(m,3H),1.96(s,1H).

[0339] Example 14. Synthesis of compound B54

[0340]

[0341] Following the synthesis method of B57, (R)-3-pyrrolanol was used instead of (S)-3-pyrrolanol in step 3 to synthesize B54. LCMS m / z = 498.2 [M+H]+ ; 1 H NMR (400MHz, DMSO-d6) δ10.47(s,1H),9.80(s,1H),8.57(s,1H),8.21(s,2H),7.77–7.71(m,1H),7.53–7.45(m,1H),5.05(d,J=3.8Hz ,1H),4.45(s,1H),3.52–3.41(m,3H),3.24–3.20(m,1H),2.84–2.78(m,5H),2.20–2.14(m,2H),2.10–2.06(m,2H),2.03–1.90(m,2H).

[0342] Example 15. Synthesis of compound B69

[0343]

[0344] 1) Step One

[0345] B41-3 (5.0 g, 11.94 mmol) was dissolved in dichloromethane (60 mL), and HCl / 1,4-dioxane solution (4 M, 60 mL, 238.8 mmol) was slowly added dropwise to the reaction solution. The reaction solution was stirred at room temperature for 2 h. The reaction solution was concentrated under reduced pressure, and the resulting solid was washed three times with dichloromethane to obtain a yellow solid B69-1 (5.7 g, crude product). LCMS m / z = 319.1 [M+H] + .

[0346] 2) Step Two

[0347] B69-1 (5.6 g, 15.78 mmol) and 3-oxetane (3.41 g, 47.34 mmol) were dissolved in methanol (120 mL). Sodium cyanoborohydride (2.97 g, 47.34 mmol, 3.0 eq) was added in portions under ice bath conditions. The reaction mixture was stirred at room temperature for 3 h. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by reversed-phase column chromatography (acetonitrile: 0.5% formic acid aqueous solution = 28:72) to give a pale yellow solid B69-2 (2.7 g, 45.7%). LCMS m / z = 375.2 [M+H] + .

[0348] 3) Step Three

[0349] B69-2 (1.76 g, 4.70 mmol) and B2-11 (1.09 g, 5.17 mmol) were dissolved in acetonitrile (80 mL), and NMI (2.03 g, 28.20 mmol) was added. Then, TCFH (3.96 g, 14.10 mmol) was added in portions under ice bath conditions. The reaction mixture was stirred overnight at room temperature. The reaction mixture was diluted with water (400 mL) and extracted with ethyl acetate (3 × 100 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (dichloromethane:methanol = 30:1) to obtain B69 (1.61 g, 60.6%). LCMS m / z = 567.2 [M+H] + ; 1 H NMR (400MHz, DMSO-d6) δ10.49(s,1H),9.80(s,1H),8.59(s,1H),8.53(s,2H),7.74(d,J=2.0H z,1H),7.48(d,J=2.0Hz,1H),4.62–4.55(m,2H),4.50(t,J=6.0Hz,1H),4.44(t,J=6.0Hz,1H) ,4.29–4.19(m,1H),3.60(d,J=11.8Hz,1H),3.46–3.38(m,1H),3.13–3.03(m,1H),2.86–2.75 (m,6H),2.62(d,J=11.0Hz,1H),2.24–2.14(m,3H),2.12–2.00(m,3H),1.15(d,J=6.3Hz,3H).

[0350] Example 16. Synthesis of compound B70

[0351]

[0352] B41 hydrochloride (70 mg, 0.128 mmol) was dissolved in ethanol (4 mL) and water (1 mL), followed by the addition of anhydrous potassium carbonate (88 mg, 0.639 mmol) and ethylene oxide (0.85 mL, 2.56 mmol). The reaction mixture was stirred in a microwave reactor at 100 °C for 30 minutes. Ethanol was removed from the reaction mixture under reduced pressure, followed by dilution with water (50 mL), extraction with dichloromethane (3 × 20 mL), and the combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by thin-layer chromatography (dichloromethane:methanol = 15:1) to obtain B70 (20 mg, 28%). LCMS m / z = 555.2 [M+H] + ; 1H NMR (400MHz, DMSO-d6) δ10.49(s,1H),9.80(s,1H),8.59(s,1H),8.52(s,2H),7.74(d,J=2.1Hz,1H),7.48(d,J= 2.1Hz,1H),3.67–3.47(m,4H),3.11–2.79(m,9H),2.23–1.94(m,6H),1.35–1.22(m,2H),1.13(d,J=6.4Hz,3H).

[0353] Example 17. Synthesis of compound B71

[0354]

[0355] 1) Step One

[0356] B71-1 (1.0 g, 5.23 mmol) was dissolved in concentrated sulfuric acid (10 mL), and dibromohydantoin (4.5 g, 15.69 mmol) was slowly added under ice bath conditions. The reaction mixture was stirred overnight at 100 °C. The reaction mixture was added dropwise to ice water (100 mL), and extracted with ethyl acetate (3 × 40 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (ethyl acetate: petroleum ether = 10:90) to give yellow solid B71-2 (480 mg, 21%). 1 H NMR (400MHz, CDCl3) δ8.99(d,J=2.4Hz,1H),8.65(d,J=2.4Hz,1H),3.24–3.19(m,2H),3.16–3.10(m,2H).

[0357] 2) Step Two

[0358] B71-2 (480 mg, 1.12 mmol), iron powder (313 mg, 5.61 mmol), and ammonium chloride (300 mg, 5.61 mmol) were dissolved in ethanol / water (15 mL, 2 / 1 v / v). The reaction mixture was stirred at 80 °C for 2 h. The reaction mixture was filtered through diatomaceous earth, the filtrate was diluted with water (60 mL), and then extracted with ethyl acetate (3 × 30 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to give a brown solid B71-3 (210 mg, 44%). LCMS m / z = 240.0 [M+H] + .

[0359] 3) Step Three

[0360] B71-3 (210 mg, 0.87 mmol) and hydroxylamine hydrochloride (67 mg, 0.96 mmol) were dissolved in pyridine (2 mL), and the reaction mixture was stirred at 50 °C for 2 h. After the reaction was complete, the reaction mixture was added dropwise to water (40 mL), the precipitated solid was filtered and dried to obtain brown solid B71-4 (190 mg, 86%). LCMS m / z = 256.1 [M+H] + .

[0361] 4) Step Four

[0362] Polyphosphoric acid (3.0 g) was heated to 110 °C in a single-necked flask. B71-4 (190 mg, 0.74 mmol) was added in portions, and the reaction mixture was stirred at 120 °C for 2 h. The hot mixture was then diluted with 60 mL of ice water, and the pH was adjusted to 9-10 with 10 M sodium hydroxide solution. The mixture was extracted with ethyl acetate (3 × 30 mL), and the combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (ethyl acetate: petroleum ether = 70:30) to give a brown solid B71-5 (30 mg, 16%). LCMS m / z = 255.1 [M+H] + .

[0363] 5) Step Five

[0364] B41-1 (150 mg, 0.48 mmol), (R)-3-pyrrolidone (125 mg, 1.44 mmol), Pd2(dba)3 (21 mg, 0.024 mmol), XantPhos (28 mg, 0.048 mmol), and cesium carbonate (313 mg, 0.96 mmol) were dissolved in 1,4-dioxane (3.5 mL). The reaction solution was purged with nitrogen three times and stirred overnight at 95 °C. The reaction solution was concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography (ethyl acetate: petroleum ether = 70%) to give a yellow solid B71-6 (100 mg, 65%). LCMS m / z = 320.0 [M+H] + .

[0365] 6) Step Six

[0366] B71-6 (100 mg, 0.31 mmol) was dissolved in tetrahydrofuran (2 mL), and lithium hydroxide monohydrate (20 mg, 0.47 mmol) was dissolved in water (2 mL). These solutions were then added dropwise to the reaction mixture, which was stirred at 60 °C for 2 h. After the reaction was complete, the mixture was diluted with water (20 mL), and the pH was adjusted to 3-4 with 3 M hydrochloric acid solution. The precipitated solid was collected by filtration and dried to obtain a yellow solid, B71-7 (90 mg, 96%). LCMS m / z = 306.1 [M+H]+ .

[0367] 7) Step Seven

[0368] B71-7 (36 mg, 0.12 mmol) and B71-5 (30 mg, 0.12 mmol) were dissolved in acetonitrile (2 mL), and NMI (59 mg, 0.72 mmol) and TCFH (101 mg, 0.36 mmol) were added. The reaction mixture was stirred overnight at room temperature. The reaction mixture was diluted with water (40 mL) and extracted with ethyl acetate (3 × 20 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by thin-layer chromatography (dichloromethane:methanol = 10:1) to give B71 (20.6 mg, 32%). LCMS m / z = 542.1 [M+H] + ; 1 H NMR(400MHz,DMSO-d6)δ10.46(s,1H),9.80(s,1H),8.57(s,1H),8.20(s,2H) ,7.90(d,J=2.0Hz,1H),7.53(d,J=2.0Hz,1H),5.05(d,J=3.8Hz,1H),4.48–4. 42(m,1H),3.50(dd,J=10.4,4.8Hz,1H),3.46–3.39(m,2H),3.25–3.20(m,1H) ,2.87–2.78(m,5H),2.10–2.13(m,2H),2.11–2.02(m,3H),1.97–1.91(m,1H).

[0369] Example 18. Synthesis of compound B66

[0370]

[0371] 1) Step One

[0372] 3-Bromo-5-chlorobenzoic acid (3.0 g, 13 mmol) was dissolved in toluene (45 mL), oxalyl chloride (3.2 g, 38 mmol) was slowly added, followed by DMF (1 mL) being slowly added. The mixture was heated to 60 °C and stirred overnight. The solution was then concentrated under reduced pressure to obtain crude product B66-1 (3.2 g, 99%).

[0373] 2) Step Two

[0374] Trimethyl sulfoxide (8.3 g, 38 mmol) and potassium tert-butoxide (5.7 g, 50 mmol) were dissolved in tetrahydrofuran (60 mL), heated to 75 °C and stirred for 2 h, then cooled to 0 °C. B66-1 (3.2 g, 12.6 mmol) was dissolved in tetrahydrofuran (20 mL) and added to the reaction mixture. The reaction mixture was stirred at room temperature for 3 h. The reaction mixture was diluted with water (500 mL), extracted with ethyl acetate (3 × 500 mL), and the combined organic phases were dried over anhydrous sodium sulfate. The mixture was filtered, and the filtrate was concentrated under reduced pressure to give a yellow solid B66-2 (2.2 g, 56%). LCMS m / z = 309.65, 310.65 [M+H] + .

[0375] 3) Step Three

[0376] Under a nitrogen atmosphere, B66-2 (2.2 g, 7.11 mmol), allyl acetate (50 mL), [Cp*RhCl2]2 (220 mg, 0.36 mmol), silver bis(trifluoromethanesulfonyl)imide (551.42 mg, 1.42 mmol), and chloroacetic acid (672 mg, 7.11 mmol) were dissolved in acetonitrile (50 mL), and the mixture was heated to 60 °C and stirred for 48 h. The reaction solution was diluted with water (500 mL) and extracted with ethyl acetate (3 × 300 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate = 3:1) to give a yellow solid B66-3 (900 mg, 46%). LCMS m / z = 270.80, 272.80 [M+H] + .

[0377] 4) Step Four

[0378] B66-3 (900 mg, 3.31 mmol) and hydroxylamine hydrochloride (253 mg, 3.65 mmol) were dissolved in pyridine (10 mL), and the reaction mixture was heated to 50 °C and stirred for 2 h. The reaction mixture was diluted with water (200 mL) and extracted with dichloromethane (3 × 200 mL). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to give crude yellow solid B66-4 (1.2 g). LCMS m / z = 285.80, 287.80 [M+H] + .

[0379] 5) Step Five

[0380] B66-4 (900 mg, 3.14 mmol) was dissolved in dichloromethane (150 mL), and trifluoromethanesulfonic anhydride (5.32 g, 18.84 mmol) was slowly added. The reaction mixture was stirred overnight at room temperature. The reaction mixture was diluted with water (500 mL) and extracted with dichloromethane (3 × 300 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain the crude product. The crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate = 1:1) to give a yellow solid B66-5 (500 mg, 56%). LCMS m / z = 285.85, 287.85 [M+H] + .

[0381] 6) Step Six

[0382] Under a nitrogen atmosphere, B66-5 (300 mg, 1.05 mmol), benzophenone imine (285 mg, 1.57 mmol), Pd2(dba)3 (96 mg, 0.11 mmol), Xantphos (121 mg, 0.21 mmol), and sodium tert-butoxide (302 mg, 3.14 mmol) were dissolved in 1,4-dioxane (12 mL). The reaction mixture was purged with nitrogen and heated to 95 °C with stirring overnight. The reaction mixture was diluted with water (100 mL) and extracted with ethyl acetate (3 × 80 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to give crude brown solid B66-6 (650 mg). LCMS m / z = 387.15 [M+H] + .

[0383] 7) Step Seven

[0384] B66-6 (650 mg crude, 1.68 mmol), hydroxylamine hydrochloride (233.5 mg, 3.36 mmol), and potassium acetate (412.21 mg, 4.2 mmol) were dissolved in methanol (15 mL) and stirred at room temperature for 2 h. The reaction solution was diluted with water (100 mL) and extracted with ethyl acetate (3 × 80 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was then purified by reversed-phase chromatography to obtain a brown solid, B66-7 (120 mg, 32%). LCMS m / z = 222.95 [M+H] + .

[0385] 8) Step Eight

[0386] B66-7 (11.89 mg, 0.05 mmol), B69-2 (26 mg, 0.05 mmol), and NMI (17.54 mg, 0.21 mmol) were dissolved in acetonitrile (2 mL), and then TCFH (29.97 mg, 0.11 mmol) was added. The mixture was stirred at room temperature for 1 h. The reaction solution was diluted with water (40 mL) and extracted with ethyl acetate (3 × 20 mL). The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain the crude product. The crude product was purified by preparative chromatography to obtain B66 (13.3 mg, 46%). LCMS m / z = 579.2 [M+H] + . 1 HNMR(400MHz,DMSO-d6)δ10.48(s,1H),9.77(s,1H),8.60–8.50(m,3H),7.69–7.63(m,1H),7. 50–7.40(m,1H),4.64–4.55(m,2H),4.53–4.40(m,2H),4.25(s,1H),3.65–3.55(m,1H),3.47–3 .39(m,1H),3.29–3.24(m,1H),3.13–3.02(m,1H),2.82–2.61(m,6H),2.23–2.18(m,1H),2.07 –1.98(m,1H),1.69–1.60(m,2H),1.16(d,J=5.8Hz,3H),0.91–0.80(m,1H),0.71–0.64(m,1H).

[0387] Example 19. Synthesis of compound B53

[0388]

[0389] Following the synthesis method of B70, B53 was synthesized by replacing ethylene oxide with 2,2-dimethylethylene oxide. LCMSm / z = 583.2 [M+H] + ; 1 H NMR (400MHz, DMSO-d6) δ10.48(s,1H),9.79(s,1H),8.58(s,1H),8.50(s,2H),7.74(d,J=2.1Hz,1H),7.48(d,J=2.1Hz,1H),4.21–4.1 1(m,2H),3.51(d,J=11.7Hz,1H),3.11–3.02(m,2H),2.93(d,J=11.2Hz,1H),2.86–2.78(m,5H),2.33–1.96(m,8H),1.18–1.12(m,9H).

[0390] Biological testing section

[0391] Experimental Example 1. Cell Proliferation Inhibition Test

[0392] LS411N (MSI), LoVo (MSI), and HT29 (MSS) cells were cultured in RPMI 1640 medium.

[0393] The normally growing cells were digested with trypsin cell digestion solution, centrifuged, counted, and seeded into 96-well plates at a density of 1000 cells per well. After 24 hours of cell seeding, the cells were treated with 10 μL of an inhibitor at different concentration gradients per well, with three replicates for each concentration point. The starting concentration was 10 μM, and the cells were diluted eight times in a 4-fold gradient. A corresponding 0.1% DMSO negative control group was also included. After 72 hours of drug treatment, the cell culture plates were removed from the incubator, the culture medium in the 96-well plates was aspirated, and 190 μL of culture medium was added again. The cells were then cultured again for 72 hours. The 96-well plates were removed and allowed to equilibrate to room temperature for 10 minutes. The culture medium in the 96-well plates was aspirated, and 200 μL of CellTiter-Lumi was added. TM Chemiluminescence cell viability assay solution (mixed 1:1 with culture medium) was shaken for two minutes and then reacted at room temperature for 10 minutes. 150 μL of the solution was transferred from a clear 96-well plate to a 96-well white plate for chemiluminescence readings. Cell viability was calculated by subtracting the background value from the reading in each well. Viability (%) = (Sample / Vehicle-1)*100. Sample represents the chemiluminescence of the drug-treated group, and Vehicle represents the absorbance of the DMSO control group. An S-shaped dose-viability curve was plotted using a nonlinear regression model in GraphPad Prism 7.0 software, and the IC50 was calculated. 50 value.

[0394]

[0395]

[0396] It can be seen that the disclosed compound is effective against MSI (microsatellite unstable) cells LS411N and LoVo, but ineffective against MSS (microsatellite stable) cells HT29, indicating that the disclosed compound has good selectivity.

[0397] Experimental Example 2. ADP-Glo ​​Test

[0398] Using Promega's ADP-Glo TMThe kinase assay kit (Catalog number: V9102) measures the in vitro activity of DHX9 by detecting the level of ADP in the reaction system. The reaction buffer contains the following components: 40 mM HEPES pH 7.5, 0.01% Tween 20, 0.01% BSA, 1 mM DTT, 20 mM MgCl2, and 0.004 U / ml RNaseOUT; cat DHX9 (151-1151) protein was diluted with the reaction buffer to a 6 nM reaction solution; the substrate reaction solution consisted of ATP diluted with the reaction buffer to 30 μM and dsRNA to 90 nM. Simultaneously, 30 μM ginsenoside tricarboxylic acid was used as a positive control.

[0399] The test compound was initially diluted at 26.67 μM to ten different concentrations using a 1:4 gradient. Then, cat DHX9 (151-1151) protein was added, and the mixture was reacted with the substrate at room temperature for 45 minutes. Next, 5 μL of sample was added to a 384 white plate, followed by 5 μL of ADP-Glo ​​reagent, and the mixture was reacted at room temperature for 40 minutes. Finally, 10 μL of the detection reagent was added, and the mixture was reacted at room temperature for 30 minutes. The chemiluminescence intensity was then detected using a multi-mode microplate reader. The inhibition rate was calculated as follows: Inhibition rate (%) = 100 - (Signal...) cmpd -Signal Ave_PC ) / (Signal Ave_VC -Signal Ave_PC )×100. Where Signal cmpd For the chemiluminescence readings of the drug treatment group, Signal Ave_PC The average chemiluminescence reading for the gold-containing tricarboxylic acid + DHX9 group is Signal. Ave_VC The average luminescence readings for the buffer + DHX9 group are given. Using GraphPad Prism 7.0 software, an S-shaped dose-inhibition rate curve was plotted using a nonlinear regression model, and EC50 was calculated. 50 value.

[0400] compound <![CDATA[EC 50 (μM)]]> A1 0.269

[0401] compound <![CDATA[EC 50 (μM)]]> B2 0.118 B1 0.027 B3 0.041 B4 0.085 B9 0.023 B49 0.007 B53 0.045 B54 0.022 B57 0.014 B66 0.026 B69 0.011 B70 0.009 B71 0.0086

[0402] Experimental Example 3. Detection of Circular RNA

[0403] LoVo(MSI) cells were cultured in RPMI 1640 complete medium.

[0404] The normally growing cells were digested with trypsin cell digestion solution, centrifuged, counted, and seeded into 96-well plates at a density of 1000 cells per well. After 24 hours of cell seeding, the cells were treated with 10 μL of an inhibitor at different concentration gradients per well, with three replicates for each concentration point. The starting concentration was 10 μM, and the cells were diluted eight times in four-fold increments. A corresponding 0.1% DMSO negative control group was also included. After 72 hours of drug treatment, RNA was extracted using the TaKaRa MiniBEST Universal RNA Extraction Kit, followed by PrimeScript. TM Reverse transcription was performed using RT Master Mix (Takara). Finally, qPCR experiments were conducted using SYBR Green Master Mix to detect the levels of circular and linear RNA of the target gene.

[0405] The primers used are as follows:

[0406] BRIP1-Circular-Forward(SEQ ID NO:1):TCTGTGTGCCAGACTGTGAG

[0407] BRIP1-Circular-Reverse (SEQ ID NO:2): ACACCAGTTCTGACGAAAAGG

[0408] BRIP1-Linear-Forward(SEQ ID NO:3):GTCCATCCTGAGGTAGTCGG

[0409] BRIP1-Linear-Reverse(SEQ ID NO:4):TTCCCCAGGCTGACAAGTTC

[0410] After the reaction, the amplification and melting curves of Real-Time PCR were confirmed. After data export, the average of three biological replicates was calculated using the following formulas: Step 1: ΔCt = CT of the target gene - CT of the internal reference gene; Step 2: ΔΔCt = ΔCt of the experimental group - ΔCt of the control group; Step 3: 2^-ΔΔCt was calculated using the POWER function. The obtained data were then used in GraphPad Prism 7.0 software to plot inhibition curves using a nonlinear regression model and calculate EC50. 50 value.

[0411]

[0412] Experimental Example 4. Liver Microsomal Stability Test

[0413] The phase-dependent metabolic stability of the test compounds in liver microsomes of CD-1 mice, Sprague-Dawley rats, beagle dogs, cynomolgus monkeys, and humans was assessed.

[0414] Experimental system:

[0415] The animal and human liver microsomes used in this testing system were purchased from Xenotech, Corning, or other qualified suppliers and stored in a freezer at -60°C before use.

[0416] Experiment Introduction:

[0417] The test sample and control compound were incubated with animal and human liver microsomes at 37±1℃ for a specified time, with a maximum incubation time of 60 minutes. Samples were removed at designated time points, and the reaction was terminated with acetonitrile containing an internal standard or other organic solvent. After centrifugation, the supernatant was analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS).

[0418] Experimental methods:

[0419] 1. Preparation of buffer solution

[0420] Dissolve 73.21 g of dipotassium hydrogen phosphate trihydrate and 10.78 g of potassium dihydrogen phosphate in 4000 mL of ultrapure water. Adjust the pH of the solution to between 7.40 ± 0.10 using 10% phosphoric acid or 1M potassium hydroxide, with a final concentration of 100 mM.

[0421] 2. Preparation of working solution

[0422] The sample powder is prepared into a stock solution of a certain concentration using DMSO or other organic solvents, and then further diluted with a suitable organic solvent.

[0423] The control compounds testosterone, diclofenac and propafenone were prepared into 10 mM stock solutions using DMSO and then further diluted with a suitable organic solvent.

[0424] 3. Preparation of liver microsomal solution

[0425] The microsomes of various genera were diluted to a 2× working solution using 100 mM potassium phosphate buffer. The final concentration of microsomes in the reaction system was 0.5 mg / mL.

[0426] 4. Formulation of reduced nicotinamide adenine dinucleotide phosphate (NADPH) regeneration system

[0427] Weigh appropriate amounts of nicotinamide adenine diphosphate (NADP) and isocitrate (ISO) powder, dissolve them in magnesium chloride solution, and vortex to mix. Add an appropriate amount of isocitrate dehydrogenase (IDH), and gently invert to mix thoroughly. The final concentrations in the reaction system are: 1 mM NADP, 1 mM magnesium chloride, 6 mM ISO, and 1 unit / mL IDH.

[0428] 5. Preparation of the stop solution

[0429] The stop solution is prepared using acetonitrile or other organic solvents containing an internal standard (tolbutamide or other suitable compound). The prepared stop solution should be stored in a refrigerator at 2-8°C.

[0430] 6. Incubation process

[0431] Incubation will be performed in 96-well plates. Prepare eight incubation plates, named T0, T5, T15, T30, T45, T60, Blank60, and NCF60. The reaction time points for the first six plates are 0, 5, 15, 30, 45, and 60 minutes, respectively. Do not add the test or control compound to the Blank60 plate, and take a sample after 60 minutes of incubation. In the NCF60 plate, use potassium phosphate buffer instead of the NADPH regeneration solution for 60 minutes of incubation. All conditions are tested in triplicate.

[0432] Mix the microparticles with the test or control compound, then incubate the following plates (Blank60, T5, T15, T30, T45, and T60, excluding T0 and NCF60) in a 37°C water bath for approximately 10 minutes. For plate T0, add the stop solution first, then add the NADPH regeneration working solution. For plate NCF60, add 98 μL of potassium phosphate buffer to each well to initiate the reaction. After pre-incubation of plates Blank60, T5, T15, T30, T45, and T60, add 98 μL of NADPH regeneration working solution to each well to initiate the reaction. The reaction temperature is 37 ± 1°C, and the final reaction volume is 200 μL. The reaction system includes 0.5 mg / mL microparticles, 1.0 μM substrate, 1 mM NADP, 6 mM ISO, and 1 unit / mL IDH.

[0433] The reaction was terminated by adding cold stop solution containing internal standard to the reaction plate at 5, 15, 30, 45 and 60 minutes.

[0434] After termination, all reaction plates were shaken well and centrifuged at 3220×g for 20 minutes at 4°C. The supernatant was diluted to a certain proportion and then analyzed by LC-MS / MS.

[0435] Sample Analysis

[0436] Sample analysis was performed using liquid chromatography-tandem mass spectrometry (LC-MS / MS), excluding standard curves and quality control samples. Semi-quantitative determination was performed using the ratio of analyte peak area to internal standard peak area. Retention times of analytes and internal standards, chromatogram acquisition, and chromatogram integration were processed using Analyst software (Sciex, Framingham, Massachusetts, USA).

[0437] The CV of the internal standard peak area in each matrix in each analytical batch should be within 20%.

[0438] Data Analysis

[0439] The in vitro elimination rate constant ke of the compound is obtained by converting the ratio of the peak area of ​​the compound to that of the internal standard into the residual rate using the following formula:

[0440]

[0441] CL int(mic) =0.693 / T 1 / 2 / Microsomal protein content (microsomal concentration during incubation, mg / mL)

[0442] CL int(liver) =CL int(mic) × Liver microsomal protein content (mg / g) × Liver weight to body weight ratio

[0443] According to the well stir model, the intrinsic liver clearance and liver clearance rate can be converted using the following formula.

[0444] CL (liver) =(CL) int(liver) *Q h ) / (CL int(liver) +Q h )

[0445] The parameters in the formula are shown in the table below.

[0446] Parameters in data analysis formulas

[0447]

[0448] Experimental Example 5. Hepatocyte Metabolic Stability Test

[0449] This experimental example is used to test the metabolic stability of the compound in hepatocytes.

[0450] Prepare 0.5 x 10⁻⁶ mol / L medium using preheated medium. 6198 μL of preheated cell suspension was added to each well of a 96-well plate. 2 μL of the test compound was added to each well of the 96-well plate to achieve a final concentration of 1 μM, with two replicates. For samples at T=0 min, the compound was thoroughly mixed with the cells for 1 min, and then 25 μL of the sample was immediately added to 125 μL of stop solution (containing 200 ng / mL tolbutamide and 200 ng / mL labetalol in acetonitrile) in an ice bath and mixed. Simultaneously, all plates were placed in a 37°C, 5% CO2 incubator with a shaker set to 600 rpm. Samples were mixed at 15, 30, 60, and 90 min of incubation, and 25 μL of the sample was added to 125 μL of stop solution (containing 200 ng / mL tolbutamide and 200 ng / mL labetalol in acetonitrile) in an ice bath, mixed, and then shaken at 500 rpm for 10 min. Subsequently, the plates were centrifuged at 3220×g for 20 minutes at 4°C. After centrifugation, 80 μL of supernatant was transferred from each well to another 96-well plate containing 240 μL of ultrapure water. The intrinsic scavenging rate (CLint) and half-life (T1 / 2) were then analyzed and calculated by LC-MS / MS.

[0451] Experimental Example 6. Rat Pharmacokinetic Test

[0452] In this experimental example, the pharmacokinetic behavior of the compound was tested in SD rats after intravenous (IV) and oral (PO) administration.

[0453] On the day of administration, the actual body weight of rats was measured and the volume of administration was calculated. Three rats were used in each group, and two tests were conducted for each compound: one group received a single intravenous injection, and the other group received a single gavage administration. Whole blood samples were collected via jugular vein at specified time points (0.25, 0.5, 1, 2, 4, 8, and 24 hours after administration). Immediately after collection, the blood samples were transferred to labeled commercially available sample tubes containing K2-EDTA (0.85–1.15 mg), centrifuged (3200 x g, 4°C, 10 min), and plasma was collected. The plasma was transferred to pre-chilled centrifuge tubes, flash-frozen on dry ice, and then stored at -60°C or lower until LC-MS / MS analysis.

[0454] Plasma concentrations were determined using LC-MS / MS. The plasma drug concentration data were processed using WinNonlin Version 6.3 (Pharsight, Mountain View, CA) pharmacokinetic software with a non-compartmental model. Relevant pharmacokinetic parameters were calculated using the linear logarithmic trapezoidal method.

[0455] Experimental Example 7. Pharmacokinetic Test in Mice

[0456] This experiment tested the pharmacokinetic behavior of the compound in BALB / c mice after intravenous (IV) and oral (PO) administration.

[0457] On the day of administration, the actual body weight of mice was measured and the volume of medication administered was calculated. Nine mice were used in each group, and two tests were conducted for each compound: one group received a single intravenous injection, and the other group received a single gavage administration. Whole blood samples were collected via orbital sampling at specified time points (0.25, 0.5, 1, 2, 4, 8, and 24 hours after administration). Immediately after collection, the blood samples were transferred to labeled commercially available sample tubes containing K2-EDTA (0.85–1.15 mg), centrifuged (3200 x g, 4°C, 10 min), and plasma was collected. The plasma was transferred to pre-chilled centrifuge tubes, flash-frozen on dry ice, and then stored at -60°C or lower until LC-MS / MS analysis.

[0458] Plasma concentrations were determined using LC-MS / MS. The plasma drug concentration data were processed using WinNonlin Version 6.3 (Pharsight, Mountain View, CA) pharmacokinetic software with a non-compartmental model. Relevant pharmacokinetic parameters were calculated using the linear logarithmic trapezoidal method.

[0459] Experimental Example 8. hERG Inhibition Test

[0460] HEK293 cells were cultured in DMEM medium containing 10% fetal bovine serum and 0.8 mg / mL G418 at 37°C and 5% CO2. Cells were then subjected to TrypLE... TM After digestion with Express, the cells were centrifuged and the cell density was adjusted to 2 × 10⁶ cells / year. 6 Cells / mL were prepared and gently mixed on a shaker at room temperature for 15-20 min before patch-clamp assays. The culture medium for the prepared cells was replaced with extracellular fluid. Intracellular and extracellular fluids were aspirated from the liquid pool and added to the intracellular fluid pool and cell / substrate pool of the QPlate chip, respectively. Whole-cell patch-clamp recordings of whole-cell hERG potassium current voltage stimulation were performed, and the data were acquired and stored by Qpatch. The compound was started at 30 μM, diluted 3-fold, and six concentration points were set. Each drug concentration was administered twice, with a duration of at least 5 minutes. The current detected in extracellular fluid without the compound was used as a control group for each cell. Each concentration was measured independently in duplicate using at least two cells. All electrophysiological experiments were performed at room temperature.

[0461] Data analysis first involves standardizing the current and blank control current after each drug concentration. Then calculate the inhibition rate corresponding to each drug concentration. Calculate the mean and standard error for each concentration, and calculate the half-inhibitory concentration for each compound: The dose-dependent effect was nonlinearly fitted using the above equation, where Y represents the inhibition rate, C represents the concentration of the test substance, and IC50 is the concentration of the test substance. 50 The half-inhibitory concentration is represented by HillSlope, and the curve fitting and IC50 are shown. 50 The calculations were performed using Graphpad software.

[0462] Experimental Example 9. Cytochrome oxidase P450 inhibition test

[0463] 1) Preparation of buffer solution:

[0464] 100mM K-Buffer: Mix 9.5mL of stock solution A into 40.5mL of stock solution B, adjust the total volume to 500mL with ultrapure water, and titrate the buffer to pH 7.4 with KOH or H3PO4.

[0465] Raw material A (1M potassium dihydrogen phosphate): 136.5g potassium dihydrogen phosphate in 1L of water;

[0466] Reserve B (1M potassium dihydrogen phosphate): 174.2g potassium dihydrogen phosphate in 1L of water.

[0467] 2) Preparation of the test substance

[0468] The test sample powder is prepared into a stock solution of a certain concentration using DMSO or other organic solvents, and then further diluted with a suitable organic solvent.

[0469] 3) In vitro incubation

[0470] The in vitro incubation system for liver microsomes in CYP450 enzyme metabolic phenotype studies involves preparing liver microsomes, supplementing them with redox coenzymes, and then adding enzyme-specific selective inhibitors, and conducting biochemical reactions under conditions simulating physiological temperature and environment.

[0471] 4) Detection of the original drug or metabolites

[0472] The concentration of the parent drug or its metabolites in the warm incubation solution was determined by LC-MS / MS.

[0473] Experimental Example 10. Mouse Tumor Pharmacodynamic Model

[0474] In this experimental example, the in vivo efficacy of the compound in a mouse xenograft model was tested after administration by gavage (PO).

[0475] Healthy female nude mice (BALB / c nu / nu) aged 6–8 weeks were housed in an SPF environment under animal ethics guidelines. Well-developed LS411N / SW48 / LoVo cells were obtained by trypsin digestion, washed in phosphate-buffered saline (PBS), and then resuspended in PBS containing 50% Matrigel (BD Biosciences). 0.1 mL (10 7 (Number) cells were subcutaneously injected into the right posterior dorsal region of each mouse. Tumor volume was measured every three days after cell inoculation. When the tumor volume reached 150-200 mm², the tumor was considered complete. 3 At approximately 10:00 AM, mice were randomly assigned to groups and administered the drug via gavage, with changes in body weight and tumor volume recorded. The experiment was terminated after a certain number of days of administration. Changes in tumor volume and body weight were statistically analyzed.

[0476] In addition to those described herein, various modifications of the invention will be apparent to those skilled in the art based on the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. All references cited in this application (including all patents, patent applications, journal articles, books, and any other disclosures) are incorporated herein by reference in their entirety.

Claims

1. A compound or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug thereof, wherein the compound has the structure of formula (I): in: Ring A is selected from C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic rings and 5-14 heterocyclic aromatic rings; Ring B is a 3-10 membered heterocyclic ring or a 5-14 membered heteroaromatic ring; preferably, Selected from in Indicates a single or double bond; and Y is selected from CH2, CHR 0 C(R) 0 2. NH, NR 0 O, S, and S(O)2; and when W is connected to a double bond, W is independently selected from CH, CR each time it appears. 0 And N, when W is not connected to a double bond, W is independently selected from CH2 and CHR each time it appears. 0 C(R) 0 2. NH, NR 0 O, S and S(O)2; When X is connected to a double bond, X is N; when X is not connected to a double bond, X is -NR. a -; R and R 1 Each occurrence is independently selected from D, halogen, -CN, and C. 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups and -OC 1-6 alkyl; R 0 and R 2 Each occurrence is independently selected from D, halogen, -OH, -NH2, -CN, -NO2, -SF5, and C. 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R a -OC(=O)R a -C(=O)OR a -OR a -SR a -S(=O)R a -S(=O)2R a -S(=O)2NR a R b -S(=O)(=NR) a )R b -NR a R b -C(=O)NR a R b -NR a -C(=O)R b -NR a -C(=O)OR b -NR a -S(=O)2-R b -NR a -C(=O)-NR a R b -N = S(=O)R a R b -P(=O)R a R b -C 1-6 Alkylene-R a -C 1-6 Alkylene-OR a -C 1-6 Alkylene-NR a R b -OC 1-6 Alkylene-NR a R b 、(-C 3-6 (-CN and (-C) 3-6 (Hydrocyclic hydrocarbon group)-C 1-6 alkyl; Or two Rs 0 Together they form = O or = CR a R b Or two Rs 0 Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings or 3-10 membered heterocyclic rings; Or two Rs 2 Together they form = O or = CR a R b Or two Rs 2 Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings or 3-10 membered heterocyclic rings; Z independently represents a direct bond, -CH2-, -O-, or -OC each time it appears. 1-4 Alkylene-*, -C 1-4 Alkylenes -O-*, -C(=O)-, -C(=O)O-*, -OC(=O)-*, -S(=O)2-, -S(=O)2N(Z) a )-*、-N(Z a )S(=O)2-*、-N(Z a )-、-N(Z a )-C 1-4 Alkylene-*, -C 1-4 Alkylene-N(Z) a )-*、-C(=O)N(Z a )-*、-N(Z a )C(=O)-* or -C(=O)N(Z a )-C 1-4 Alkylene-*, where * indicates resemblance to R 3 The connection point; Z a Is it H or C? 1-4 alkyl; R 3 Each time it appears, it is independently selected from C. 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl and 5-14 membered heteroaryl groups; each of the cyclic hydrocarbon group, heterocyclic group, aryl group, and heteroaryl group is optionally substituted by one or more substituents independently selected from the following: D, halogen, -OH, =O, -NH2, -CN, -NO2, -SF5, =CH2, C 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R a -OC(=O)R a -C(=O)OR a -OR a -SR a -S(=O)R a -S(=O)2R a -S(=O)2NR a R b -S(=O)(=NR) a )R b -NR a R b -C(=O)NR a R b -NR a -C(=O)R b -NR a -C(=O)OR b -NR a -S(=O)2-R b -NR a -C(=O)-NR a R b -N = S(=O)R a R b -P(=O)R a R b -C 1-6 Alkylene-R a -C 1-6 Alkylene-OR a -C 1-6 Alkylene-NR a R b -OC 1-6 Alkylene-NR a R b 、(-C 3-6 (-CN and (-C) 3-6 (Hydrocyclic hydrocarbon group)-C 1-6 alkyl; When Z is a direct bond, R 3 The substituents on R are optionally with R 2 Connection constitutes C 3-10 Hydrocarbon rings or 3-10 membered heterocyclic rings; R a and R b Each time it appears, it is independently selected from H and C. 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl alkyl; or R a and R b Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic rings or 5-14 heterocyclic aromatic rings; The aforementioned alkylene, alkyl, alkenyl, alkynyl, cyclic alkylene, cyclic alkylene, alkyl ring, heterocyclic, heterocyclic, aryl, aromatic ring, heteroaryl, heteroaromatic ring, and aralkyl groups are each optionally substituted by one or more substituents independently selected from the following: deuterium atom, halogen, -OH, =O, -NH2, -CN, -NO2, =CH2, =CF2, -CH=CR c R d C 1-6 Alkyl, deuterated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R c -OC(=O)R c -C(=O)OR c -OR c -SR c -S(=O)R c -S(=O)2R c -S(=O)2NR c R d -NR c R d -C(=O)NR c R d -NR c -C(=O)R d -NR c -C(=O)OR d -NR c -S(=O)2-R d -NR c -C(=O)-NR c R d -N = S(=O)R c R d -P(=O)R c R d -C 1-6 Alkylene-OR c -C 1-6 Alkylene-NR c R d and -OC 1-6 Alkylene-NR c R d The alkylene, alkyl, alkenyl, =CH2, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, and aralkyl groups are each optionally further substituted by one or more substituents independently selected from the following: halogen, -OH, =O, -C(=O)O-tert-butyl, -NH2, -CN, -NO2, =CH2, =CF2, C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 1-6 Haloalkyl, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl group, -C 1-6 Alkylene-C 3-6 Cyclic hydrocarbon groups, -OC 1-6 Alkyl, -OC 1-6 Halogenated alkyl groups and -C 1-6 Alkylene-OC 1-6 alkyl; R c and R d Each time it appears, it is independently selected from H and C. 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl alkyl, or R c and R d Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic ring or 5-14 membered heteroaromatic ring, wherein the alkyl, cycloalkyl, hydrocarbon ring, heterocyclic group, heterocyclic group, aryl, aromatic ring, heteroaryl, heteroaromatic ring and aralkyl group are further optionally substituted by one or more substituents independently selected from the following: halogen, -OH, =O, -C(=O)O-tert-butyl, -NH2, -CN, -NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl groups and -C 1-6 Alkylene-OC 1-6 alkyl; m is an integer selected from 0, 1, 2 or 3; n is an integer selected from 0, 1, or 2; p is an integer selected from 0, 1, 2, 3, 4, 5 or 6; q is an integer selected from 0, 1, or 2; The condition is when for When p is not 0, and when p = 1, R 0 no 2. The compound of claim 1 or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug thereof, wherein the compound has a structure of formula (II), (III), (IV), (V), (VI) or (VII): in: p' is an integer selected from 0, 1, 2 or 3.

3. The compound of claim 1 or 2, or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound, or prodrug thereof, wherein ring A is selected from: Preferably, ring A is selected from Each of the above groups is marked with 0, 1, or 2 R groups. 2 and 0 or 1 ZR 3 replace.

4. The compound of any one of claims 1-3, or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound, or prodrug thereof, wherein... Selected from: Preferably, Selected from 5. The compound of any one of claims 1-4, or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound, or prodrug thereof, wherein R 2 Each time it appears, it is independently a halogen or a carbon. 1-6 Alkyl, C 3-6 Cycloalkyl group or 3-10 membered heterocyclic group, preferably fluorine, chloro, methyl or cyclopropyl; and m is an integer that is either 0 or 1.

6. The compound of any one of claims 1-5, or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound, or prodrug thereof, wherein Z is a direct bond, -OC 1-4 Alkylene-*, -C 1-4 Alkylene -O-*, -C(=O)N(Z) a )-*、-N(Z a )C(=O)-* or -C(=O)N(Z a )-C 1-4 Alkylene-*, where * indicates resemblance to R 3 The connection point; and n is 1 When Z is a direct bond, R 3 The substituents on R are optionally with R 2 The links form a 6-8 membered heterocycle, preferably a 7-membered heterocycle, wherein the heterocycle contains one or two heteroatoms selected from O and N.

7. The compound of any one of claims 1-6, or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound, or prodrug thereof, wherein R 3 Each time it appears, it is independently for Each of the above groups may be optionally substituted by one or more substituents independently selected from the following: D, halogen, -OH, =O, -NH2, -CN, -NO2, -SF5, =CH2, =CF2, C 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)R a -OC(=O)R a -C(=O)OR a -OR a -SR a -S(=O)R a -S(=O)2R a -S(=O)2NR a R b -S(=O)(=NR) a )R b -NR a R b -C(=O)NR a R b -NR a -C(=O)R b -NR a -C(=O)OR b -NR a -S(=O)2-R b -NR a -C(=O)-NR a R b -N = S(=O)R a R b -P(=O)R a R b -C 1-6 Alkylene-R a -C 1-6 Alkylene-OR a -C 1-6 Alkylene-NR a R b -OC 1-6 Alkylene-NR a R b 、(-C 3-6 (-CN and (-C) 3-6 (Hydrocyclic hydrocarbon group)-C 1-6 alkyl; R a and R b Each time it appears, it is independently selected from H and C. 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl alkyl; or R a and R b Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings, 3-10 membered heterocycles, C 6-10 Aromatic rings or 5-14 heterocyclic aromatic rings; The aforementioned alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, and aralkyl groups are each optionally substituted by one or more substituents independently selected from the following: halogen, -OH, C. 1-6 Alkyl, deuterated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl, -O(C 1-6 Alkyl), -C(=O)O-tert-butyl, -S(=O)2(C 1-6 Alkyl groups and -P (=O)(C 1-6 Alkyl)2, wherein the above-mentioned alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, and aralkyl groups are each optionally further selected independently by one or more elements selected from halogen, -OH, -NH2, -CN, and C. 1-6 Alkyl substituents.

8. A compound of any one of claims 1-7, or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound, or prodrug thereof, wherein R 3 Each time it appears, it is independently for Each of the above groups may be optionally substituted by one or more substituents independently selected from the following: halogen, -CN, C. 1-6 Alkyl, deuterated C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 aryl, 5-14 heteroaryl and -OR a ; R a Selected from H, C 1-6 Alkyl, C 3-10 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 quinone heteroaryl and C 6-12 Aryl groups; The aforementioned alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, and aralkyl groups are each optionally substituted by one or more substituents independently selected from the following: halogen, -OH, C. 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, -O(C 1-6 Alkyl), -C(=O)O-tert-butyl, -S(=O)2(C 1-6 Alkyl groups and -P (=O)(C 1-6 Alkyl)2, wherein the above-mentioned alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups are each optionally further selected independently by one or more halogens, -OH, -NH2, -CN, and C. 1-6 Alkyl substituents.

9. A compound of any one of claims 1-8, or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound, or prodrug thereof, wherein R 1 Each time it appears, it is independently a halogen, -CN, or C. 1-6 Alkyl, Halogenated C 1-6 Alkyl or -OC 1-6 Alkyl groups, preferably each of which is independently F, Cl, Br, methyl, ethyl, trifluoromethyl or -O-methyl, each time they appear.

10. A compound of any one of claims 1-9 or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug thereof, wherein R 0 Each time it appears, it is independently selected from halogen, -OH, -NH2, -CN, C. 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, 3-10 membered heterocyclic groups, C 6-10 Aryl, 5-14 heteroaryl, C 6-12 Aryl alkyl group, -C(=O)-C 1-6 Alkyl, -OC 1-6 Alkyl, -C 1-6 Alkylene-OC 1-6 Alkyl and -C 1-6 Alkylene-OC 3-10 Cycloalkyl group, wherein the alkylene group, alkyl group, alkenyl group, alkynyl group, cycloalkyl group, heterocyclic group, aryl group, heteroaryl group, and aralkyl group are each optionally selected independently by one or more halogens or C. 1-6 Alkyl substituents; Or two Rs 0 Together with the groups it is attached to, they constitute C 3-6 Hydrocarbon rings (e.g., cyclopropyl rings); Preferably, R 0 Each of these groups is independently selected from F, Cl, Br, -OH, -NH2, -CN, methyl, -CHF2, -CF3, ethyl, n-propyl, isopropyl, vinyl, propenyl, allyl, ethynyl, cyclopropyl, cyclopentyl, cyclohexyl Phenyl, benzyl, -C(=O)CH3, -O-CH3, -O-CHF2, -O-CF3, -CH2-O-CH3; More preferably, Selected from 11. A compound of any one of claims 1-10, or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound, or prodrug thereof, wherein R 0 Each time it appears, it is independently selected from halogen, -OH, -NH2, -CN, C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 Cyclic hydrocarbon groups, -OC 1-6 Alkyl and -C 1-6 Alkylene-OC 1-6 alkyl; Preferably, R 0 Each of these groups is independently selected from F, Cl, Br, -OH, -NH2, -CN, methyl, ethyl, ethynyl, cyclopropyl, -O-methyl, and -CH2-O-CH3 each time it appears.

12. A compound of any one of claims 1-11, or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound, or prodrug thereof, wherein the compound is selected from:

13. A pharmaceutical composition comprising a compound of any one of claims 1-12 or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug, and one or more pharmaceutically acceptable carriers.

14. Use of any compound of claims 1-12 or a pharmaceutically acceptable salt, ester, stereoisomer, tautomer, polymorph, solvate, metabolite, isotopically labeled compound or prodrug, or the pharmaceutical composition of claim 13, in the preparation of a medicament for the prevention or treatment of DHX9-mediated diseases or conditions.

15. The use of claim 14, wherein the DHX9-mediated disease or condition is cancer, viral infection, or autoimmune disease; Preferably, the cancer is selected from colorectal cancer, endometrial cancer, ovarian cancer, gastric cancer, breast cancer, brain cancer, skin cancer, lung cancer, leukemia, prostate cancer, head and neck cancer, pancreatic cancer, bladder cancer, bone cancer, soft tissue cancer, kidney cancer, and liver cancer; Preferably, the cancer is a microsatellite instability (MSI) cancer; Preferably, the cancer has mutations or defects in DNA mismatch repair (MMR), and / or mutations or defects in RNA splicing and kinetochore complex; Preferably, the cancer is a BRCA1 / 2 mutated cancer.

Images