Method for improving pig somatic cell nucleus embryo transfer efficiency

By using NaB to inhibit HDAC and overexpress KDM2A, the blastocyst formation rate of porcine somatic cell nuclear transfer embryos was improved, solving the problems of low efficiency and cytotoxicity in existing technologies and achieving a more efficient reprogramming effect.

CN121737014APending Publication Date: 2026-03-27CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-30
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Porcine somatic cell nuclear transfer to embryos has low efficiency, and existing methods are cytotoxic and have limited effectiveness, which hinders industrial application.

Method used

Sodium butyrate (NaB) was used to treat porcine somatic cell nuclear transfer remodeling embryos to inhibit HDAC activity, increase H3K27Ac levels, and improve epigenetic reprogramming by overexpressing KDM2A to remove H3K36me2.

Benefits of technology

It significantly improved the blastocyst formation rate of porcine somatic cell nuclear transfer embryos, overcame the problem of incomplete epigenetic reprogramming, and reduced the risk of cytotoxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121737014A_ABST
    Figure CN121737014A_ABST
Patent Text Reader

Abstract

The invention discloses a method for improving pig somatic cell nucleus embryo transfer efficiency, and belongs to the technical field of pig somatic cell nucleus transfer. The method comprises the following steps: treating a reconstructed embryo subjected to pig somatic cell nuclear transfer by using sodium butyrate to improve the acetylation level of the reconstructed embryo, or overexpressing KDM2A to reduce the methylation level of the reconstructed embryo so as to improve the efficiency of transferring the embryo by using the pig somatic cell nuclear transfer. According to the present invention, the research results show that the high enrichment of the ZGA gene promoter region H3K36me2 and the enrichment reduction of the far-end cis-regulatory element H3K27ac result in the existing unrepresented epigenetic disorder, such that the SCNT efficiency is limited; therefore, the H3K36me2 is deleted through the demethylase KDM2A, or the HDAC for inhibiting the deacetylation of the H3K27ac in a NaB-mediated manner is used, so that the development arrest of the SCNT embryo is relieved, and the blastocyst forming efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of pig somatic cell nuclear transfer, and particularly relates to a method for improving the efficiency of pig somatic cell nuclear transfer embryos. BACKGROUND

[0002] Somatic cell nuclear transfer (SCNT), also known as somatic cloning, has extremely important application value in the fields of excellent pig propagation, rare pig species resource protection, etc. However, the overall efficiency of pig somatic cell nuclear transfer technology is still very low, which seriously restricts its industrial application. At present, the blastocyst development rate of pig somatic cell nuclear transfer embryos is generally less than 30%, and the pregnancy rate and farrowing rate after implantation are even lower. The main reasons for the low efficiency are: incomplete epigenetic reprogramming, low quality of oocytes, inaccurate nuclear removal operation, low cell fusion and activation efficiency, and imperfect in vitro culture system, etc.

[0003] In order to overcome the above-mentioned problems, some researchers use TSA (trichostatin A) to change the histone acetylation level of donor nuclei to promote reprogramming, or add signal molecules to the culture medium. However, these methods often have limited effect, or have cytotoxicity. Therefore, it is very necessary to develop a method without cytotoxicity and capable of improving the efficiency of pig somatic cell nuclear transfer embryos. SUMMARY

[0004] In order to solve the above-mentioned deficiencies existing in the prior art, the purpose of the present application is to provide a method for improving the efficiency of pig somatic cell nuclear transfer embryos, so as to solve the problems of cytotoxicity and low efficiency of pig somatic cell nuclear transfer embryos existing in the prior art.

[0005] The technical scheme for solving the above-mentioned technical problems of the present application is as follows: a method for improving the efficiency of pig somatic cell nuclear transfer embryos is provided, comprising the following steps: Using sodium butyrate to treat the reconstructed embryos of pig somatic cell nuclear transfer to improve the acetylation level thereof, or overexpressing KDM2A to reduce the methylation level of the reconstructed embryos, so as to improve the efficiency of pig somatic cell nuclear transfer embryos.

[0006] The present application has the following beneficial effects: HDAC is a histone deacetylase, which removes acetyl groups from histones, and H3K27Ac (histone H3 lysine acetylation at position 27) is one of the substrates of HDAC. By inhibiting the activity of HDAC with NaB, the deacetylation of H3K27Ac can be prevented, and the overall level of H3K27Ac in the cell can be improved, thereby improving the success rate of SCNT.

[0007] H3K36me2 is the abbreviation of dimethylation of lysine 36 of histone H3, and KDM2A is a histone demethylase, which mainly removes dimethylation modification of lysine 36 of histone H3, and when KDM2A is overexpressed, H3K36me2 can be reduced, thereby improving the success rate of SCNT.

[0008] On the basis of the above technical scheme, the application can also be improved as follows: Further, a method for improving the efficiency of pig somatic cell nuclear transfer embryos comprises the following steps: (1) collecting oocytes and mature culture; (2) isolating and culturing donor cells; (3) removing the nucleus of the mature oocyte and the first polar body, injecting the donor cells into the perivitelline space, electrically fusing the reconstructed embryos and activating the reconstructed embryos; (4) culturing the activated reconstructed embryos in a culture medium containing NaB; or injecting KDM2A mRNA into the reconstructed embryos.

[0009] Further, the reconstructed embryos of pig somatic cell nuclear transfer are cultured in a culture medium containing NaB within 24 hours after activation.

[0010] Further, the concentration of NaB in the culture medium is 0.1-1mM; preferably, the concentration of NaB in the culture medium is 0.5mM.

[0011] Further, the culture conditions are 38.5℃ and 5% CO2; and the culture medium is PZM-3 culture medium.

[0012] Further, injecting KDM2A mRNA into the pig reconstructed embryos reduces the methylation level of the reconstructed embryos.

[0013] Further, the concentration of KDM2A mRNA is 20-500ng / μL.

[0014] The application has the following beneficial effects: The application researches and finds that the high enrichment of H3K36me2 in the promoter region of ZGA gene and the reduction of the enrichment of H3K27ac in the distal cis-regulatory element appear an existing uncharacterized epigenetic disorder, which limits the efficiency of SCNT. Therefore, by removing H3K36me2 through demethylase KDM2A or inhibiting H3K27ac deacetylation of HDAC mediated by NaB, the development stagnation of SCNT embryos is reduced, and the blastocyst formation efficiency is improved. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1Immunofluorescence images of MLT2B2+ and MLT2B2-4 cell embryos (activated for 72h) for H3K9me3, H3K4me3, H3K27Ac and DAPI staining; Bubble plot showing the fluorescence intensity for each modification.

[0016] Figure 2 Heatmap showing enrichment of H3K9me3, H3K4me3 and H3K27Ac in ZGA / PFF aCREs in MLT2B2+ and MLT2B2- embryos.

[0017] Figure 3 Expression levels of histone acetyltransferases KAT2B and EP300 in MLT2B2+ and MLT2B2- embryos.

[0018] Figure 4 NaB treatment schematic for porcine SCNT embryos.

[0019] Figure 5 Representative images of NaB-treated SCNT embryos after 6.5 days of in vitro culture.

[0020] Figure 6 Bar plot of blastocyst formation rate after NaB treatment; N≥3, data are mean ± SD, statistical significance was determined using t-test, *P<0.05.

[0021] Figure 7 Expression analysis of H3K36me2 regulatory enzymes in MLT2B2+ and MLT2B2-4 cell embryos.

[0022] Figure 8 Immunofluorescence images of H3K36me2 in MLT2B2+ and MLT2B2-4 cell embryos; DAPI staining of nuclei.

[0023] Figure 9 Scatter plot of H3K36me2 and MLT2B2 signal intensity distribution in individual 4-cell embryos.

[0024] Figure 10 Cut&Tag heatmaps showing enrichment of H3K9me3, H3K4me3 and H3K36me2 at promoters in MLT2B2+ and MLT2B2 embryos; where the color scale represents the filtered average signal (CPM).

[0025] Figure 11 Cut&Tag heatmaps showing enrichment of fully and partially ZGA-ON / OFF and PFF-ON / OFF genes at distal aCREs in MLT2B2+ and MLT2B2 embryos; where the color scale represents the filtered average signal (CPM).

[0026] Figure 12 Representative images of SCNT embryos injected with KDM2A mRNA at 20, 100 or 500 ng / μL dose and non-injected controls.

[0027] Figure 13 Blastocyst formation rate of control and KDM2A mRNA injected SCNT embryos; data are mean ± SD, t-test, *P<0.05, **P<0.01. DETAILED DESCRIPTION

[0028] The following examples are intended to be illustrative only and are not intended to limit the scope of the present application. Unless otherwise indicated, conventional conditions or manufacturer's recommended conditions were employed in the examples. Unless otherwise indicated, the reagents or instruments used were conventional products available commercially.

[0029] Example 1: I. Experimental materials and cells 1. Cell lines Primary PEFs (porcine embryonic fibroblasts) were isolated from 2-month-old Bama piglets, and were prepared as follows: the pig ear tissue was cut into pieces and digested with 0.25% trypsin-EDTA (Gibco, 15050057) at 37°C for 30 minutes. The digested cells were cultured in MEMa (Gibco, 12571063) containing 15% FBS, 1% penicillin / streptomycin (Gibco, 15104122), NEAA (Gibco, 11140050) and sodium pyruvate, under the conditions of 37°C and 5% CO2. The cells of passages 3-5 were used as SCNT donor cells.

[0030] 2. Plasmid structure ① The ERV reporter vector was constructed as follows: the pig MLT2B2 sequence disclosed in the DFAM database (https: / / www.dfam.org / family / DF000001030 / summary) was synthesized according to the disclosure, and then the sequence was cloned into a GFP reporter vector to replace the promoter, thereby constructing the ERV-GFP reporter vector.

[0031] ② The MLT2B2 sequence was inserted into pGL3-Basic (Promega, E1751) for promoter activity determination, or pGL3-Promega (Promega, E1761) for enhancer activity determination. The Renilla luciferase vector pRL-TK (Promega, E2241) was used as an internal control.

[0032] The nucleotide sequence of MLT2B2 is as follows: TGTGATGGTTAATTTTATGTGTCAACTTGACTGGGCTAAGGGATGCCCAGATAGCTGGTAAAACATTATTTCTGGGTGTGTCTGTGAGGGTGTTTCCGGAAGAGATTAGCATTTGAATCAGTAGACTGAGTAAAGAAGATCCGCCCTCACCAATGTGGGCGGGCATCATCCAATCCGTTGAGGGCCCGAATAGAACAAAAAGGCGGAGGAAGGGCGAATTCNCTCTCTCTTCTTGAGCTGGGACATCCATCTTCTCCTGCCCTCGGACATCGGAGCTCCTGGTTCTCGGGCCTTCGGACTCCGGGACTTACACCAGCGGCCCCCCTGGTTCTCAGGCCTTCGGACTCGGACTGAATTACACCACCGGCTTTCCTGGTTCTCCAGCTTGCAGACGGCANATCGTGGGACTTCTCGGCCTCCATAATCGCGTGAGCCAATTCCCATAATAAATCTCCTCTTATATATCTCTATATATCCTATTGGTTCTGTTTCTCTGGAGAACCCTGACTAATACA (SEQ ID NO. 1).

[0033] II. Experimental Methods 1. SCNT and embryo culture ① Collection and in vitro maturation of porcine oocytes The ovaries of prepubertal gilts were collected from slaughterhouse and cumulus-oocyte complexes (COCs) were aspirated from 3-6 mm follicles. The COCs were washed three times in in vitro maturation medium and then cultured at 38.5°C in 5% CO2 for 42 h. The cumulus cells were removed by 0.1% hyaluronidase and the oocytes with the first polar body were obtained, which were called MII oocytes.

[0034] ② Somatic cell nuclear transfer The MII oocytes were transferred into the perivitelline space of the enucleated oocytes in the presence of 7.5 mg / mL cytochalasin B without Ca 2+NCSU-23 (5% FBS added) and enucleated by pipetting the first polar body and adjacent cytoplasm; single donor fibroblast cells were injected into the perivitelline space. Reconstructed embryos were activated in activation medium (280 mM mannitol, 0.001 mM calcium chloride, 0.05 mM magnesium chloride) using a 1.2 kV / cm, 30 ms direct current pulse (2 pulses). After activation, embryos were cultured in PZM-3 medium at 38.5 °C, 5% CO2.

[0035] 2. Real-time imaging and fluorescence analysis (1) Dynamic tracking of MLT2B2-GFP: Using a microscope, embryos were imaged at 20x objective at 4-cell stage, and embryos were divided into MLT2B2+ and MLT2B2- types according to the GFP expression pattern.

[0036] 3. Sample collection Embryos were cultured to 4-cell stage (58 h), and MLT2B2-GFP positive and negative embryos were isolated.

[0037] 4. Histone modification analysis ① Immunofluorescence Embryos were fixed in 4% PFA for 30 min, permeabilized with 0.5% Triton X-100 for 20 min, and blocked with 3% BSA for 1 h. The primary antibodies used were: anti-H3K27ac (Abeam, ab4729, 1:2000), anti-H3K36me2 (Abeam, ab9049, 1:2000), anti-H3K9me3 (Abeam, ab8898, 1:2000), anti-H3K4me3 (Abeam, ab8580, 1:2000), anti-sox2 (Abeam, ab97959, 1:2000), and anti-gata3 (Abeam, ab199428, 1:2000). The secondary antibody (Alexa Fluor 594-conjugated goat anti-rabbit IgG, Invitrogen, A11037, 1:1000) was incubated for 1 h, and the nuclei were counterstained with DAPI (Sigma-Aldrich, D9542). Images were collected using an LSM880, and the fluorescence intensity was quantified using Image J.

[0038] ② Cleavage and labeling One hundred 4-cell stage embryos per group were processed using the Hyperactive In Situ Microarray Kit (Vazyme, TD902). Purified DNA libraries were sequenced on an Illumina NovaSeg 6000 platform (150 bp at paired ends). Data quality was checked using FastQC, aligned to Sus scrofa 11.1 using Bowtie2, and repetitive sequences (Picard tool) and low-quality reads were filtered out. Reads were normalized to CPM (Counts Per Million). The normalized CPM signals for histone modifications (H3K27Ac, ​​H3K4me3, H3K9me3, H3K36me2) in the positive / negative groups were extracted using the GenomicRanges R package (stored in a BigWig file). The average signal was calculated after filtering out the top 1% of extreme values ​​and visualized as a heatmap using pheatmap.

[0039] 5. Functional Verification Analysis ①HDAC inhibitors Within 24 hours of reconstructed embryo activation, SCNT embryos were cultured for 6.5 days in PZM-3 containing 0.5 mM NaB at 38.5°C and 5% CO2, with the culture medium being changed during the period, and the blastocyst formation rate was recorded.

[0040] ②KDM2A overexpression The KDM2A coding sequence was cloned into a T7 promoter-driven vector, and the linearized plasmid was transcribed in vitro using the HiScribe® T7 ARCA mRNA Kit (NEB, E2060) to generate 5' KDM2A mRNA. The mRNA was purified, diluted to 20-500 ng / μL, and ~10 pg was microinjected into reconstructed embryos. The control group consisted of an equal volume of sterile water.

[0041] II. Experimental Results 1. Histone acetylation drives MLT2B2+ embryo-specific distal enhancer activation. Based on the immunofluorescence results of the 4-cell phase ( Figure 1 As can be seen, H3K9me3 in MLT2B2+ embryos showed a decreasing trend, indicating reduced heterochromatization. H3K4me3 did not show a significant trend, indicating a stable promoter state. However, H3K27Ac showed an increasing trend in MLT2B2+ embryos, indicating enhanced enhancer activation.

[0042] Cut & Tag ( Figure 2The study validated the distal regulatory region, specifically: ZGA-related aCREs in MLT2B2+ embryos showed an enrichment trend of H3K27Ac and a depletion trend of H3K9me3. In contrast, MLT2B2- embryos showed the opposite pattern, with lower H3K27Ac and higher H3K9me3, indicating epigenetic specialization at the distal element.

[0043] RNA-seq analysis of histone acetyltransferases ( Figure 3 The results indicate a link between elevated H3K27Ac levels and increased enzyme activity: KAT2B (H3K27Ac protein) and EP300 (a member of the p300 / CBP family) are upregulated in MLT2B2+ embryos, which suggests enhanced enzyme function.

[0044] Functional validation of HDAC (histone deacetylase) inhibitor NaB (sodium butyrate) Figure 4 This further demonstrates that H3K27Ac plays a role in overcoming developmental arrest during SCNT, while NaB treatment increases the blastocyst formation rate of SCNT embryos. Figure 5 and 6 This indicates that targeting H3K27Ac can improve the efficiency of SCNT reprogramming.

[0045] 2. H3K36me2 deletion in MLT2B2+ embryos promotes promoter demethylation and enhances SCNT efficiency via KDM2A. The focus of this invention is the regulation of promoter methylation, and a good relationship has been established between H3K36me2-a modification and DNA methylation kinetics, especially in recruiting DNA methyltransferases to the promoter region. This characteristic makes H3K36me2 a strong candidate for MLT2B2+ embryo-mediated promoter hypomethylation.

[0046] Analysis of H3K36me2 regulatory enzyme ( Figure 7 This study revealed a consistent trend in MLT2B2+ embryos: upregulation of demethylases and downregulation of methyltransferases. Specifically, the expression levels of H3K36me2 demethylases KDM2A and KDM2B were significantly upregulated, while the expression level of the H3K36me2 methyltransferase NSD2 was significantly downregulated. This enzyme imbalance led to widespread H3K36me2 depletion, which was confirmed by immunofluorescence to be a declining trend in MLT2B2+ embryos. Figures 8-9 MLT2B2+ embryos exhibited reduced H3K36me2 and reduced promoter methylation at the promoter, suggesting that H3K36me2 may play a potential role in promoting promoter demethylation. Figure 10Extensive depletion of H3K36me2 in distal regions, synergistically with increased aCRE accessibility, enhanced activation of ZGA-related genes. H3K36me2 depletion showed a consistent trend across two key genomes: H3K36me2 levels were significantly reduced in both the promoter and distal regions of ZGA-related and PFF-related genes in MLT2B2+ embryos. Figure 11 Unlike the heterogeneous H3K27Ac pattern, the synergistic downregulation of H3K36me2 across functionally opposite gene sets identifies H3K36me2 as a key regulator driving genome-wide epigenetic reprogramming. Functional validation was achieved through KDM2A overexpression. Figure 12 This confirmed the importance of this mechanism: injecting KDM2A mRNA into SCNT embryos at a concentration of 20 ng / μL increased blastocyst formation from 22.1% (control group) to 38.7%. Figure 13 These results indicate that targeting H3K36me2 is a key regulatory target for improving SCNT efficiency.

[0047] In summary, the abnormally high enrichment of H3K36me2 in the ZGA gene promoter region, synergistically with high levels of promoter DNA methylation, coupled with low H3K27Ac levels and insufficient chromatin accessibility in the distal regulatory region, collectively forms a multilayered epigenetic repression, limiting MLT2B2 activation and embryonic development. This multilayered repression mechanism explains why some SCNT embryos are difficult to reprogram effectively. The demethylase KDM2A, by removing H3K36me2, can disrupt this repression, significantly improving blastocyst formation rate, highlighting the potential for targeted regulation of these barriers.

[0048] KDM2A overexpression and HDAC repression improve reprogramming efficiency by enhancing the epigenetic signature of key regions (reducing H3K36me2 and increasing H3K27Ac), suggesting that targeted epigenetic editing is a viable strategy to improve SCNT success rates.

[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for improving the efficiency of porcine somatic cell nuclear transfer embryos, characterized in that, Includes the following steps: Treatment of reconstructed embryos from porcine somatic cell nuclear transfer with sodium butyrate to increase their acetylation level, or overexpression of KDM2A to reduce the methylation level of the reconstructed embryos, can improve the efficiency of porcine somatic cell nuclear transfer embryos.

2. The method for improving the efficiency of porcine somatic cell nuclear transfer embryos according to claim 1, characterized in that, Includes the following steps: (1) Collection and maturation culture of oocytes; (2) Isolation and culture of donor cells; (3) Remove the nucleus and first polar body of the mature oocyte, inject the donor cell into the space around the follicle, electro-fuse the reconstructed embryo and activate the reconstructed embryo; (4) The activated reconstructed embryos are cultured in a medium containing NaB; or KDM2A mRNA is injected into the reconstructed embryos.

3. The method for improving the efficiency of porcine somatic cell nuclear transfer embryos according to claim 2, characterized in that, Reconstructed embryos with porcine somatic cell nuclear transfer were cultured in a medium containing NaB within 24 hours after activation.

4. The method for improving the efficiency of porcine somatic cell nuclear transfer embryos according to claim 2 or 3, characterized in that, The concentration of NaB in the culture medium is 0.1-1 mM.

5. The method for improving the efficiency of porcine somatic cell nuclear transfer embryos according to claim 4, characterized in that, The concentration of NaB in the culture medium is 0.5 mM.

6. The method for improving the efficiency of porcine somatic cell nuclear transfer embryos according to claim 2, characterized in that, The culture conditions were 38.5℃ and 5% CO2.

7. The method for improving the efficiency of porcine somatic cell nuclear transfer embryos according to claim 2, characterized in that, The culture medium was PZM-3 medium.

8. The method for improving the efficiency of porcine somatic cell nuclear transfer embryos according to claim 1 or 2, characterized in that, Injecting KDM2A mRNA into reconstructed porcine embryos reduced the methylation level of the reconstructed embryos.

9. The method for improving the efficiency of porcine somatic cell nuclear transfer embryos according to claim 8, characterized in that, The concentration of KDM2AmRNA is 20-500 ng / μL.