CRISPR-Cas12a system for one-step detection of tumor marker APE1 based on autocatalytic strand displacement reaction

Abstract

The invention relates to the technical field of tumor detection, in particular to a CRISPR-Cas12a system for one-step detection of a tumor marker APE1 based on an autocatalytic strand displacement reaction. According to the system, the trans-cleavage activity of Cas12a and the dynamic characteristic of a nucleic acid strand displacement reaction are coupled to form a self-sustaining positive feedback cycle. A template probe is constructed by designing a blocking chain containing an AP site and an activation chain, and crRNA invasion, Cas12a activation and feedback cutting of the blocking chain are realized under the triggering of APE1, so that a binding domain is continuously regenerated, multiple rounds of chain replacement and Cas12a reactivation are driven, and a self-circulation amplification detection platform is established. According to the technical scheme, the technical problem that in the prior art, a novel detection system which does not need exogenous amplification, does not depend on additional enzymes, has self-driven and positive feedback amplification capabilities and is used for accurate, rapid and on-site detection of APE1 is lacked can be solved, and the method has ideal application prospects.

Description

Technical Field

[0001] This invention relates to the field of tumor detection technology, and more specifically to a CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on an autocatalytic chain displacement reaction. Background Technology

[0002] APE1 (apurinic / apyrimidinic endonuclease 1), also known as Ref-1 (Redox Effector Factor-1), is a key protein with both DNA base excision and repair functions and redox regulatory activity, playing a central role in maintaining genome stability and regulating the activity of various transcription factors. Numerous clinical and basic studies have shown that APE1 is significantly overexpressed in various malignant tumors (including non-small cell lung cancer, breast cancer, colorectal cancer, glioblastoma, and ovarian cancer), and is closely associated with increased invasiveness, metastatic potential, resistance to radiotherapy and chemotherapy, and poor prognosis. Therefore, APE1 has been widely recognized as a cancer biomarker with significant clinical value, and it holds promise for applications in early tumor screening, auxiliary diagnosis, dynamic monitoring of treatment efficacy, and recurrence risk assessment.

[0003] However, current APE1 detection primarily relies on traditional immunological methods (such as ELISA and immunohistochemistry) or functional assays based on its endonuclease activity. These methods generally suffer from insufficient sensitivity, cumbersome operation, difficulty in achieving precise quantification, and susceptibility to interference in complex body fluids (such as serum and cerebrospinal fluid), failing to meet clinical demands for rapid, highly sensitive, quantifiable, and point-of-care testing (POCT). The limitations of existing technologies are particularly pronounced in scenarios requiring dynamic tracking of APE1 levels to guide individualized treatment. Therefore, there is an urgent need to develop a novel APE1 detection strategy that is highly specific, highly sensitive, easy to operate, and suitable for complex samples.

[0004] In recent years, molecular diagnostic platforms based on CRISPR-Cas systems have become an important direction for overcoming traditional detection bottlenecks due to their high specificity, rapid response, and visual readout capabilities. Among them, Cas12a, with its highly efficient trans-cleavage activity activated after target recognition, has been widely used to construct various biosensor systems, covering the detection of nucleic acids, proteins, and even small molecules. Theoretically, if the enzyme activity of APE1 can be converted into a nucleic acid signal that can be recognized by Cas12a, highly sensitive detection of its functional state can be achieved. However, most current Cas12a detection systems still heavily rely on the pre-amplification of nucleic acid targets (such as PCR or isothermal amplification), which not only introduces operational complexity, aerosol contamination risks, and cost burdens, but also makes it difficult to apply to key application scenarios such as point-of-care testing, resource-limited environments, or in situ analysis of live cells.

[0005] To reduce reliance on pre-amplification, researchers have attempted to introduce enzyme-free signal amplification strategies, such as footpoint-mediated chain substitution, hybridization chain reaction (HCR), or catalytic hairpin assembly (CHA). While these methods achieve signal amplification to some extent, they are still limited by thermodynamic equilibrium, resulting in limited gain. Furthermore, complex nucleic acid circuits are prone to non-specific hybridization, kinetic stagnation, or side reactions in closed reaction systems, affecting detection stability. More critically, in existing CRISPR coupling systems, Cas12a is typically used only as a readout tool for endpoint signals; its dual "recognition-cutting" function is not fully integrated into the signal amplification loop. Moreover, once activated, Cas12a may non-specifically degrade functional nucleic acid templates in the circuit, causing off-target cleavage and signal leakage, further weakening the reliability and reproducibility of the detection.

[0006] In summary, although APE1's importance as a key cancer biomarker is increasingly evident, existing detection technologies (whether traditional immunoassays or emerging CRISPR platforms) struggle to simultaneously achieve high sensitivity, high specificity, ease of operation, and system stability. In particular, efficiently converting APE1's specific enzymatic activity into a cyclically amplified CRISPR signal without the need for pre-amplification remains a core technical challenge. Therefore, developing a novel CRISPR detection system that requires no exogenous amplification, does not rely on additional enzymes, and possesses self-driven and positive feedback amplification capabilities is of significant scientific value and clinical translational importance for achieving accurate, rapid, and on-site detection of APE1. Summary of the Invention

[0007] The present invention aims to provide a CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction, in order to solve the technical problem of the lack of a novel CRISPR detection system for APE1 that is accurate, rapid, and on-site without the need for exogenous amplification, does not rely on additional enzymes, and has self-driven and positive feedback amplification capabilities.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: A CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction includes reaction reagents, which include: template probe, Cas12a protein, crRNA, and fluorescently quenched labeled single-stranded DNA. The template probe is formed by complementary pairing of an activation strand and a blocking strand, and the blocking strand has an AP site. The activation strand is complementary to the spacer sequence of the crRNA.

[0009] Furthermore, the working environment of the reaction reagent is a buffer environment containing 0.08-0.12 M NaCl, 40-60 mM Tris-HCl, 8-12 mM MgCl2, 0.8-1.2 mM DTT, and with a pH of 7.8-8.0.

[0010] Furthermore, the working environment also contains a ribonuclease inhibitor at a final concentration of 0.32-0.48 U / μL.

[0011] Furthermore, the nucleotide sequence of the activation chain is as follows: 5'-ATATTGTGCTGCCATATCTACTTCACTA-3'; The nucleotide sequence of the blocking strand is inversely complementary to that of the activating strand, and any one of the deoxyribonucleic acid positions 4 to 22 of the blocking strand is set as the AP site.

[0012] Furthermore, the nucleotide sequence of the blocking strand is as follows: 5'-TAGTGAAGTAGX1X2X3X4X5X6X7X8X9CACAATAT-3'; Among them, X1 is an AP site or A, X2 is an AP site or T, X3 is an AP site or A, X4 is an AP site or T, X5 is an AP site or G, X6 is an AP site or G, X7 is an AP site or C, X8 is an AP site or A, and X9 is an AP site or G; and, among X1-X9, there is only one AP site.

[0013] Furthermore, the nucleotide sequence of the blocking strand is as follows: 5'-TAGTGAAGTAGATX3X4X5X6X7AGCACAATAT-3'; Among them, X3 is an AP site or A, X4 is an AP site or T, X5 is an AP site or G, X6 is an AP site or G, and X7 is an AP site or C; and, there is only one AP site among X3-X7.

[0014] Furthermore, the nucleotide sequence of the blocking strand is as follows: 5'-TAGTGAAGTAGATATXGCAGCACAATAT-3'; Where X represents the AP site.

[0015] Furthermore, the nucleotide sequence of crRNA is as follows: 5'-UAAUUUCUACUAAGUGUAGAUUGAAGUAGAUAUGGCAGCAC-3'; The nucleotide sequence of the fluorescently quenched labeled single-stranded DNA is as follows: 5'-TTATT-3'; and the 5' end is connected to a fluorescent group, and the 3' end is connected to a fluorescence quencher group.

[0016] Furthermore, the CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction operates under the following conditions: incubation at 35-37℃ for 40-50 min.

[0017] Furthermore, the working concentration of the template probe is 0.004-0.012 μM, the working concentration of Cas12a protein is 0.016-0.024 μM, the working concentration of crRNA is 0.004-0.07 μM, and the working concentration of fluorescently quenched labeled single-stranded DNA is 0.4-0.6 μM; The template probe is obtained by mixing the activating and blocking chains in a molar ratio of 1:1.2-2, heating at 80-95℃ for 5-15 min, and then annealing at 35-40℃ for 40 min-4 h to form the template probe.

[0018] In summary, the technical principle of this solution is as follows: This invention, based on the innovative coupling of autocatalytic chain displacement reaction and the CRISPR-Cas12a system, constructs a closed-loop detection system of target triggering, cascade activation, and self-sustaining amplification. Through nucleic acid circuit design, the specific enzymatic activity of APE1 is converted into a signal that can be amplified exponentially, realizing a one-step detection of APE1 without exogenous amplification or dependence on additional enzymes. Its core mechanism is a positive feedback loop of target triggering and autocatalytic amplification, as detailed below: The core component of this system is a template probe, formed by complementary pairing of an activation strand and a blocking strand, with an AP site (purine-free / pyrimidine-free site) specifically introduced on the blocking strand. In its initial conformation, the blocking strand effectively inhibits the binding of crRNA to the activation strand through steric hindrance. The spacer sequences of the activation strand and crRNA are complementary, and the steric hindrance of the blocking strand directly prevents the activation of the Cas12a protein, keeping the entire system in a low-background quiescent state and reducing non-specific signal leakage at the source.

[0019] When the target APE1 is present in the system, it acts as a purine-free / pyrimidine-free endonuclease, specifically recognizing and cleaving the AP site on the blocking strand. This cleavage reaction breaks the blocking strand structure, exposing the anchorage sequence hidden within the complementary region, breaking the initial blocking state and providing the initiation conditions for the subsequent strand displacement reaction, thus achieving the initial conversion of target enzyme activity into nucleic acid structural signals. The exposed anchorage sequence provides a specific binding site for crRNA. The crRNA invades the hybridization region between the activating and blocking strands through base complementarity, initiating the strand displacement reaction and releasing the activating strand from the template probe. The released activating strand forms a ternary complex with crRNA and Cas12a protein. Due to the precise complementarity of the spacer sequence between the activating strand and crRNA, this complex can rapidly activate the trans-cleavage activity of Cas12a, transforming Cas12a from an inactive state to a catalytic state with highly efficient cleavage capabilities.

[0020] Activated Cas12a efficiently cleaves fluorescently quenched single-stranded DNA in the system, freeing the fluorescent group from the inhibition of the quenching group and generating a detectable fluorescent signal. Simultaneously, its trans-cleavage activity acts on the blocking strand of the remaining template probe in the system, specifically cleaving the region adjacent to the AP site. This cleavage process not only eliminates byproducts from the strand displacement reaction but also continuously regenerates new site sequences, driving a new round of crRNA invasion, strand displacement, and Cas12a activation. This cycle forms a self-sustaining positive feedback loop of "Cas12a activation → trans-cleavage → site regeneration → more Cas12a activation," achieving exponential amplification of the detection signal.

[0021] The core innovation of this technology lies in the discovery and utilization of the key phenomenon of "activated Cas12a can reverse cleave the AP site region of the blocking strand". The initial cleavage event of the target APE1 is deeply coupled with the catalytic function of Cas12a, enabling the system to generate its own reaction "fuel" (site sequence) and construct a dynamic and autonomous nucleic acid circuit, completely eliminating the dependence on pre-amplification technology and exogenous enzymes.

[0022] This invention addresses the technical problems of existing APE1 detection technologies, such as insufficient sensitivity, cumbersome operation, reliance on pre-amplification or exogenous enzymes, and poor stability. Through innovative design of the technical principle, it achieves multi-dimensional performance breakthroughs, possessing significant technical advantages and clinical application value. The specific beneficial effects are as follows: (1) Ultra-high detection sensitivity, breaking through the bottleneck of low abundance target detection This system achieves exponential signal amplification through a self-catalytic positive feedback loop, significantly improving the detection sensitivity for APE1 and achieving an ultra-low detection limit. Compared to traditional ELISA methods, the sensitivity is improved by several orders of magnitude. This performance can accurately capture extremely low abundances of APE1 in clinical samples, meeting the needs for low-concentration biomarker detection in scenarios such as early tumor screening and monitoring of minimal residual disease, providing technical support for early tumor diagnosis.

[0023] (2) Extremely low background signal, combining high specificity and high signal-to-noise ratio Initially, the blocking chain completely inhibits Cas12a activity through steric hindrance, resulting in extremely low background signal. Subsequent cascade reactions are triggered only in the presence of the target APE1, achieving specific signal activation. Experimental validation shows that this system is unresponsive to various homologous interfering proteins such as FEN1 and T4 Ligase, and the signal-to-noise ratio (S / B) in fluorescence mode is significantly improved compared to traditional methods, effectively avoiding false-positive results caused by non-specific reactions and ensuring the accuracy of clinical testing.

[0024] (3) One-step constant temperature operation, suitable for real-time detection scenarios This invention constructs a fully enclosed homogeneous detection system that seamlessly integrates target identification, signal conversion, and exponential amplification into a single step, eliminating the need for complex sample pretreatment, pre-amplification, and exogenous enzyme addition. The entire detection process can be completed within 40 minutes under a constant temperature of 37°C. The operation is simplified to: sample addition, constant temperature incubation, and signal reading. It eliminates the need for specialized large-scale instruments and skilled operators, effectively reducing operational complexity and shortening the detection cycle. At the same time, it avoids the risk of aerosol contamination caused by pre-amplification, making it perfectly suited for point-of-care testing (POCT) applications in resource-constrained environments.

[0025] (4) Eliminate dependence on external sources and reduce detection costs and complexity. This system achieves autonomous signal amplification through self-catalytic cycling, completely eliminating the dependence on pre-amplification technologies such as polymerase chain reaction (PCR) and recombinase polymerase amplification (RPA) as well as additional exogenous enzymes. This not only reduces the types of detection reagents and lowers reagent costs, but also avoids the cumbersome operation, contamination risks, and instrument dependence caused by pre-amplification steps. It significantly improves the practicality and economy of the detection system, facilitating the clinical translation and popularization of the technology.

[0026] (5) It has a wide range of applications and outstanding compatibility and practicality. This system boasts excellent sample adaptability and can be successfully applied to various scenarios, including real-time imaging of APE1 activity in live cells and clinical serum sample diagnosis. It not only meets the needs of basic research for dynamic tracking of intracellular APE1 activity but also enables rapid and accurate detection of clinical samples. Furthermore, it can be adapted for on-site testing through visual readout, demonstrating its potential for application across all scenarios, from basic research to clinical diagnosis.

[0027] (6) Significant technological innovation has driven the upgrade of the CRISPR detection system. This invention introduces the novel concept of "CRISPR autocatalysis" for the first time, transforming Cas12a from a traditional endpoint signal output device into a catalytic engine driving cyclic amplification, and constructing a completely new dynamic nucleic acid circuit design paradigm. This technology overcomes the performance limitations of existing CRISPR detection systems, providing a new technical approach for the highly sensitive and rapid detection of biomarkers such as proteases, nucleic acids, and small molecules, and has significant scientific value and technological dissemination effects. Attached Figure Description

[0028] Figure 1 This is a schematic diagram of the working principle of the CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction of the present invention (a shows the basic activation and trans-cleavage function of Cas12a; b shows the inhibitory effect of the blocking chain; c shows the triggering step of the target enzyme APE1; d shows the cascade reaction self-circulating amplification detection process).

[0029] Figure 2 This is a schematic diagram of crRNA, activation strand, and blocking strand in Example 2.

[0030] Figure 3 The test results for the reaction systems containing different blocking chains in Example 2 are as follows: (a: Statistical results of the endpoint fluorescence intensity of the reaction systems containing different blocking chains; b: Statistical results of the signal-to-noise ratio of the reaction systems containing different blocking chains; data are presented as "mean ± standard deviation", n=3; AS / BS-1 to AS / BS-19 represent template probe types, a total of 10 types).

[0031] Figure 4 The results of polyacrylamide gel electrophoresis (PAGE) analysis in Example 2 are as follows (BS, BS-1 to BS-19 represent different types of blocking strands, as described in Example 1; AS is the activating strand; APE1 is purine-free / pyrimidine-free endonuclease 1; crRNA is CRISPR RNA, a cluster of regularly spaced short palindromic repeat ribonucleic acid sequences; M is the marker).

[0032] Figure 5The results are the fluorescence kinetic analysis results of Example 3.

[0033] Figure 6 The signal-to-noise ratio statistics for Example 4 using different buffer systems are shown (a, b, and c represent NEBuffer 4.0 buffer, NEBuffer 2.1 buffer, and NEBuffer 3.0 buffer, respectively; data are presented as mean ± standard deviation, n=3).

[0034] Figure 7 The signal-to-noise ratio statistics for template probes with different concentrations in Example 5 are presented as “mean ± standard deviation”, n=3.

[0035] Figure 8 The signal-to-noise ratio statistics for different concentrations of crRNA in Example 6 are presented (data are presented as mean ± standard deviation, sample size 3).

[0036] Figure 9 The signal-to-noise ratio statistics for different reaction times in Example 7 are presented as “mean ± standard deviation”, n=3.

[0037] Figure 10 The results of the limit of detection test in Example 8 are shown (lgC is the logarithm of APE1 concentration, and the data are presented as "mean ± standard deviation", n=3).

[0038] Figure 11 The results of the system specificity test in Example 9 are as follows (FEN1: valve endonuclease 1, T4 ligase: T4 ligase, Exo I: exonuclease I, GOX: glucose oxidase, BSA: bovine serum albumin, T7 Exo: T7 exonuclease; Blank is a blank control; data are presented as mean ± standard deviation, n=3). Detailed Implementation

[0039] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the technical means used in the following embodiments and experimental examples are conventional means well known to those skilled in the art, and the materials and reagents used can all be obtained commercially.

[0040] The key technical terms used in this solution are explained as follows: CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats.

[0041] crRNA: CRISPR RNA; a cluster of regularly spaced short palindromic repeats of ribonucleic acid.

[0042] Cas12a protein (also known as Cpf1) is an RNA-guided nuclease derived from the type V CRISPR-Cas system. Guided by crRNA, it specifically recognizes and cleaves double-stranded DNA containing PAM sequences. Unlike Cas9, Cas12a requires only a single crRNA and no tracrRNA, and produces staggered cuts with 5' overhangs when cleaving the target DNA, which is beneficial for homologous recombination repair in gene editing. More importantly, Cas12a exhibits strong "trans-cleavage" activity upon activation, meaning it non-specifically degrades single-stranded DNA in the surrounding environment.

[0043] APE1 protein: APE1 (Apurinic / Apyrimidinic Endonuclease 1) is a key DNA repair enzyme in the human body, mainly involved in the Base Excision Repair (BER) pathway. Its core function is to recognize and cleave AP sites (depurinic / depyrimidine sites) in the DNA strand, thereby initiating the DNA repair process.

[0044] CASCADE: A cascade reaction, a chain reaction process that is triggered step by step and amplified at each stage.

[0045] Ape sites (AP sites): These are a form of damage in DNA molecules where a purine or pyrimidine base is lost at a position in the DNA nucleotide sequence where it should normally be present, leaving a debased sugar-phosphate backbone. AP sites are one of the most common types of DNA damage and can be caused by spontaneous hydrolysis during cellular metabolism, chemical reactions, or radiation.

[0046] Example 1 The CRISPR-Cas12a system, based on an autocatalytic chain displacement reaction, is a one-step detection method for the tumor marker APE1. It is a highly sensitive CASCADE detection system, and its specific components are as follows: In 1×NEBuffer 3.0 buffer, the following detection components for detecting APE1 in the sample are added: 0.004-0.012 μM (preferably 0.01 μM) template probe, 0.32-0.48 U / μL (preferably 0.4 U / μL) ribonuclease inhibitor, 0.016-0.024 μM (preferably 0.02 μM) Cas12a protein, 0.004-0.07 μM (preferably 0.01-0.07 μM, most preferably 0.05 μM) crRNA, and 0.4-0.6 μM (preferably 0.5 μM) fluorescently quenched labeled single-stranded DNA (FQ-ssDNA). Depending on the actual situation, an appropriate amount of the sample is added to the above CRISPR-Cas12a system to form a reaction system. After incubation, APE1 in the sample can be detected. The incubation reaction can be carried out under the following conditions: incubation at 35-37℃ for 10-50 min (optional range 40-50 min), preferably at 37℃ for 40 min. After the reaction is completed, the fluorescence signal is detected using a fluorescence spectrophotometer (model: FS5).

[0047] Taking a 100 μL reaction system as an example, the reaction system is prepared as follows: Add 1 μL of 1 μM template probe (optional 0.4-1.2 μM, preferably 0.6-1.2 μM, further preferably 1.0-1.2 μM), 10 μL of 10×NEBuffer 3.0 buffer, 1 μL of 40 U / μL ribonuclease inhibitor, 1 μL of 2 μM Cas12a protein, 1 μL of 5 μM (optional 0.4-7.0 μM, preferably 1.0-7.0 μM) crRNA, and 1 μL of 50 μM fluorescently quenched labeled single-stranded DNA (FQ-ssDNA) to an appropriate amount of the sample to be tested (purpose: to detect the concentration of tumor marker APE1 in the sample), and then add deionized water to bring the total volume to 100 μL.

[0048] The 10×NEBuffer 3.0 buffer was purchased from New England Biolabs (NEB) and its components were: 1M NaCl (sodium chloride), 500mM Tris-HCl (tris(hydroxymethyl)aminomethane)-hydrochloric acid buffer), 100mM MgCl2 (magnesium chloride), 10mM DTT (dithiothreitol), pH 7.9. In practical use, the following formulation can also be used: 0.8-1.2 M NaCl (sodium chloride), 400-600mM Tris-HCl (tris(hydroxymethyl)aminomethane)-hydrochloric acid buffer), 80-120mM MgCl2 (magnesium chloride), 8-12mM DTT (dithiothreitol), pH 7.8-8.0. The reaction was carried out in 1×NEBuffer 3.0 buffer, diluted 100 times with the original stock solution.

[0049] The ribonuclease inhibitor was purchased from Takara Biotech Inc., specifically the LbaCas12a enzyme (engineered). Lachnospiraceae bacterium The Cas12a nuclease was purchased from New England Biolabs (NEB).

[0050] The crRNA sequence is as follows (SEQ ID NO.1, bold italic text represents the spacer sequence): 5'-UAAUUUCUACUAAGUGUAGAU UGAAGUAGAUAUGGCAGCAC -3'.

[0051] The template probe is formed by denaturing and annealing the activating and blocking strands. More specifically, the activating and blocking strands are mixed in 1×NEBuffer 3.0 buffer at a molar ratio of 1:1.2-2 (preferably 1:1.2, with an excess of the blocking strand), denatured by heating at 80-95℃ (preferably 90℃) for 5-15 min (preferably 10 min), and then annealed at 35-40℃ (preferably 37℃) for 40 min-4 h (preferably 1 h) to form the template probe.

[0052] The activation strand sequence is as follows (AS; SEQ ID NO.2; AS can be complementary to the spacer sequence of crRNA, see the sequence portions represented by bold italics in SEQ ID NO.1 and SEQ ID NO.2 for details): 5'-ATATT GTGCTGCCATATCTACTTCA CTA-3'.

[0053] The blocking strand was designed in various forms, with AP sites added at different locations, as detailed below: BS (SEQ ID NO.3, no designed AP site): 5'-TAG TGAAGTAGATATGGCAGCAC AATAT-3'; BS-1 (SEQ ID NO.4, X represents the AP site): 5'-TAG XGAAGTAGATATGGCAGCAC AATAT-3'; BS-3 (SEQ ID NO.5, X represents the AP site): 5'-TAG TGXAGTAGATATGGCAGCAC AATAT-3'; BS-5 (SEQ ID NO. 6, X represents the AP site): 5'-TAG TGAAXTAGATATGGCAGCAC AATAT-3'; BS-7 (SEQ ID NO.7, X represents the AP site): 5'-TAG TGAAGTXGATATGGCAGCAC AATAT-3'; BS-9 (SEQ ID NO.8, X represents the AP site): 5'-TAG TGAAGTAGXTATGGCAGCAC AATAT-3'; BS-11 (SEQ ID NO.9, X represents the AP site): 5'-TAG TGAAGTAGATXTGGCAGCAC AATAT-3'; BS-13 (SEQ ID NO.10, X represents the AP site): 5'-TAG TGAAGTAGATATXGCAGCAC AATAT-3'; BS-15 (SEQ ID NO.11, X represents the AP site): 5'-TAGT GAAGTAGATATGGXAGCAC AATAT-3'; BS-17 (SEQ ID NO.12, X indicates AP site): 5'-TAG TGAAGTAGATATGGCAXCAC AATAT-3'; BS-19 (SEQ ID NO.13, X represents the AP site): 5'-TAG TGAAGTAGATATGGCAGCXC AATAT-3'.

[0054] The specific fluorescently quenched labeled single-stranded DNA sequence is as follows: 5'-TTATT-3'; A fluorescent group is attached to the 5' end, and a conventional fluorescent group FAM (6-carboxyfluorescein) can be used; a fluorescent quencher group is attached to the 3' end, and a conventional fluorescent quencher group BHQ1 (black hole quencher 1) can be used.

[0055] All of the above oligonucleotide chains were synthesized and purified by Shanghai Sangon Biotech Co., Ltd.

[0056] For details on the reaction principle of the CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction, please refer to [link to relevant documentation]. Figure 1 This figure illustrates the working mechanism of the CASCADE self-circulating amplification detection platform for detecting APE1 activity. Its core is the coupling of the trans-cleavage activity of CRISPR-Cas12a with the chain substitution reaction to construct a self-sustaining positive feedback loop. The specific principle is described below: Figure 1 This demonstrates the basic activation and trans-cleavage functions of Cas12a. Unactivated Cas12a binds to crRNA to form a complex; when the activated strand pairs complementary with crRNA, Cas12a enters an activated state, at which point it exhibits trans-cleavage activity, cleaving fluorescently quenched single-stranded DNA. This is Cas12a's basic signal output capability, but at this stage, an amplification cycle has not yet been established.

[0057] Figure 1 b demonstrates the inhibitory effect of the blocking strand. The system uses a pre-designed template probe with an "activating strand + blocking strand." The blocking strand prevents the activating strand from binding to the Cas12a / crRNA complex, thus preventing Cas12a activation and trans-cleavage. This is the "inhibited state" in the absence of the target enzyme, avoiding the generation of nonspecific signals.

[0058] Figure 1 c illustrates the triggering steps of the target enzyme APE1. The blocking strand of the template probe contains an AP site. When the target enzyme APE1 is present, it specifically recognizes and cleaves this AP site, causing the blocking strand to be released after cleavage. This exposes the crRNA-binding domain of the activating strand, which is the key "trigger switch" for initiating the subsequent amplification reaction.

[0059] Figure 1This paper demonstrates a CASCADE (cascade reaction) self-circulating amplification detection process. APE1 (or a sample containing APE1) is added to the system (containing the Cas12a / crRNA complex, template probe, and fluorescently quenched single-stranded DNA). After APE1 releases the blocking strand, the activating strand binds to the Cas12a / crRNA complex, activating Cas12a. The activated Cas12a trans-cleaves the fluorescently labeled single-stranded DNA to generate a detection signal and simultaneously feeds back to cleave the blocking strand, regenerating the primer-binding domain of the activating strand. The regenerated binding domain drives multiple rounds of strand displacement reactions, allowing more activating strands to bind to Cas12a / crRNA, achieving the "reactivation" of Cas12a, ultimately forming a self-sustaining positive feedback loop that continuously amplifies the signal. This design corresponds to an innovative approach in this study that overcomes the limitations of traditional methods such as pre-amplification dependence and limited signal amplification, providing a new pathway for high-sensitivity protease activity detection.

[0060] Example 2: Design of the blocking chain The study evaluated how introducing AP sites at different positions on the blocking strand affected its ability to block the activating strand. For example... Figure 1 As shown, the activating strand is complementary to the spacer sequence of crRNA, while the blocking strand is complementary to the activating strand, forming a template probe. An AP site is systematically introduced every two nucleotides within the complementary region of the spacer sequence on the blocking strand, resulting in a series of strands named BS-1 to BS-19. Cleavage of the AP sites in the blocking strand by APE1 releases the fragmented blocking strand from the activating strand, allowing crRNA invasion and strand substitution, thereby activating the trans-cleavage activity of Cas12a.

[0061] The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on an autocatalytic chain displacement reaction was prepared according to the optimal method of Example 1. APE1 was then added (1 μL of 1×10⁻⁶ HCl was added to 100 μL of the reaction mixture). -2 U / μL APE1, final APE1 concentration 1×10 -4 Incubate at 37°C for 40 min (U / μL) or without APE1. After the reaction is complete, the fluorescence signal is detected using an FS5 fluorescence spectrophotometer to evaluate the performance of different blocking strand designs.

[0062] For detailed experimental results, please refer to Figure 3 , Figure 3 a. Directly statistically analyze the endpoint fluorescence intensity of the reaction system corresponding to different blocking chains; Figure 3 In step b, the ratio of the fluorescence intensity of the experimental group (containing APE1 in the system) to the fluorescence intensity of the control group (not containing APE1 in the system) in the reaction system corresponding to each blocking chain was calculated to obtain the S / B Ratio (signal-to-noise ratio), thereby reflecting the difference in activation efficiency of Cas12a by different blocking chains. Figure 3 In this context, AS / BS-1, AS / BS-3, AS / BS-5, AS / BS-7, AS / BS-9, AS / BS-11, AS / BS-13, AS / BS-15, AS / BS-17, and AS / BS-19 are template probes formed by using blocking chains BS-1, BS-3, BS-5, BS-7, BS-9, BS-11, BS-13, BS-15, BS-17, and BS-19 with the activating chain AS, respectively.

[0063] The fluorescence intensity produced by different reaction systems reflected the difference in Cas12a activation efficiency of template probes located at different positions on the blocking strand. This was achieved by monitoring the fluorescence signal generated by the Cas12a-mediated trans-cleavage fluorescence-quenched labeling single-stranded DNA reporter probe. Results showed: When the AP site is located within 7 nucleotides of the fragment corresponding to the spacer sequence (counting from the 4th base from the 5' end of the overall blocking strand as the 1st nucleotide of the fragment corresponding to the spacer sequence), the activation level of Cas12a is low. When the AP site is located at positions 9 to 17 of the fragment corresponding to the spacer sequence, the fluorescence signal increases significantly, reaching a peak at the 13th nucleotide of the fragment corresponding to the spacer sequence. This indicates that for toe regions longer than 7 nucleotides (and within 17 nucleotides), the efficiency of crRNA invasion and subsequent strand substitution is positively correlated with the length of the toe region. Based on the fluorescence intensity analysis, the reaction system shows the most ideal signal intensity using blocking strands BS-9, BS-11, BS-13, BS-15, and BS-17, especially BS-13. In other words, when the AP site is located at positions 12 to 20 of the blocking strand, the fluorescence intensity of the reaction system is high, which is beneficial for the detection of APE1 and improves detection sensitivity. Placing AP sites at positions before the 12th position or after the 20th position of the blocking chain will cause a significant drop in the detection signal. This shows that the choice of AP site location is crucial to achieving ideal detection results.

[0064] In terms of signal-to-noise ratio, BS-13 shows a more significant advantage. Considering an even more ideal signal-to-noise ratio, blocking strands such as BS-11, BS-13, and BS-15 can be further preferred, with BS-13 being the most preferred. Specifically, the AP sites are located at positions 14-18 of the blocking strand, preferably at position 16.

[0065] To further investigate the crRNA-mediated strand displacement reaction after AP site cleavage, additional polyacrylamide gel electrophoresis (PAGE) analysis was performed. Figure 4Lane 1: Activating strand AS only. Lane 2: crRNA and blocking strand BS. Lane 3: Activating strand AS and blocking strand BS hybridization to generate a template probe. Lane 4: Activating strand AS and blocking strand BS-1 hybridization to generate a template probe, crRNA, and APE1, incubated in buffer for 40 min. Lane 5: Activating strand AS and blocking strand BS-3 hybridization to generate a template probe, crRNA, and APE1, incubated in buffer for 40 min. Lane 6: Activating strand AS and blocking strand BS-5 hybridization to generate a template probe, crRNA, and APE1, incubated in buffer for 40 min. Lane 7: Activating strand AS and blocking strand BS-7 hybridization to generate a template probe, crRNA, and APE1, incubated in buffer for 40 min. Lane 8: Activating strand AS and blocking strand BS-9 hybridization to generate a template probe, crRNA, and APE1, incubated in buffer for 40 min. Lane 9: The product of hybridization of the activating strand AS and the blocking strand BS-11, followed by incubation of the template probe, crRNA, and APE1 in buffer for 40 min. Lane 10: The product of hybridization of the activating strand AS and the blocking strand BS-13, followed by incubation of the template probe, crRNA, and APE1 in buffer for 40 min. Lane 11: The product of hybridization of the activating strand AS and the blocking strand BS-15, followed by incubation of the template probe, crRNA, and APE1 in buffer for 40 min. Lane 12: The product of hybridization of the activating strand AS and the blocking strand BS-17, followed by incubation of the template probe, crRNA, and APE1 in buffer for 40 min. Lane 13: The product of hybridization of the activating strand AS and the blocking strand BS-19, followed by incubation of the template probe, crRNA, and APE1 in buffer for 40 min. More specifically, the amounts of each component added to the reaction system are as follows: 1 μL of 5 μM activating chain AS, 1 μL of all blocking chains BS / BS-1 to BS-19 at a concentration of 6 μM, 1 μL of 10 μM crRNA, and 1 × 10⁻⁶ ppm. -2 Add 1 μL of U / μL APE1, then add 1 μL of deionized water and 10×Buffer 3.0 until the final volume is 10 μL. Then, incubate at 37°C for 40 min.

[0066] The experimental results show that, in the presence of both APE1 and crRNA, cleavage at the AP site allows crRNA to invade the double-stranded structure (template probe) formed by the activating and blocking strands, creating an activating strand / crRNA complex (which migrates more slowly than the original template probe) behind the template probe band, while the displaced blocking strand fragment migrates forward. Lane 4 (AS / BS-1) shows a weak activating strand / crRNA complex band, while a distinct AS / BS-1 main band is present, further confirming its low crRNA invasion efficiency. In contrast, lane 10 (AS / BS-13) shows the strongest activating strand / crRNA complex band, while the AS / BS-13 template probe main band is almost completely absent, indicating extremely high crRNA invasion efficiency and near-complete strand displacement. These results again demonstrate that the location of the AP site in the blocking strand plays a crucial role in regulating crRNA invasion and strand displacement efficiency.

[0067] Example 3: Study on the recognition and cleavage activity of Cas12a protein at AP sites This study is the first to discover that the trans-cleavage activity of Cas12a can not only mediate non-specific cleavage of single-stranded DNA, but also effectively recognize and cleave AP sites, thereby driving an autocatalytic cascade amplification process. This study experimentally demonstrated these phenomena.

[0068] The 5' end of the activating strand AS and the 3' end of the blocking strand BS-13 were labeled with FAM (6-carboxyfluorescein, a fluorescent reporter group) and BHQ1 (black hole quencher 1, a fluorescent quencher group), respectively. The two strands hybridized to form a double-stranded template probe for subsequent detection. The specific sequence is as follows: AS*: FAM-5'-ATATTGTGCTGCCATATCTACTTCACTA-3' (SEQ ID NO. 2).

[0069] BS-13*: 5'-TAGTGAAGTAGATATXGCAGCACAATAT-3'-BHQ1 (SEQ ID NO. 10).

[0070] Prepare the following reaction system: Add 1 μL of 50 μM template probe (annealed from AS* and BS-13*, fluorescently labeled), 10 μL of 10×NEBuffer 3.0 buffer, 1 μL of 40 U / μL ribonuclease inhibitor, and 1 μL of 2 μM Cas12a protein (…). Figure 5 Experiment a did not include Cas12a protein. Figure 5 Experiment b: Add Cas12a protein, 1 μL 5 μM crRNA, or 1 μL 1×10⁻⁶ PCR protein (optional). -2 Add U / μL APE1, then add deionized water to bring the total volume to 100μL. Place the reaction system at 37°C and perform fluorescence kinetic analysis in direct detection mode.

[0071] In the presence of APE1, the cleavage of the AP site in BS-13 by APE1 triggers the invasion of crRNA into AS and the replacement of the cleaved BS-13 fragment, disrupting the fluorescence resonance energy transfer between FAM and BHQ1, resulting in a fluorescence signal that gradually increases over time. Figure 5 a), but the increase was relatively slow. In the experimental group without APE1, the fluorescence signal remained essentially unchanged.

[0072] Under conditions of coexistence of Cas12a and crRNA, crRNA invasion and strand displacement triggered by APE1 cleavage further activate the trans-cleavage activity of Cas12a. This activity then targets the AP site, continuously initiating a new round of crRNA invasion and strand displacement, and gradually releasing more BS-13 fragments, thereby establishing a positive feedback loop that can repeatedly activate Cas12a, ultimately achieving exponential amplification of the fluorescence signal. Figure 5 (b) The observed time-dependent signal enhancement confirms the crucial role of the Cas12a-mediated autocatalytic cascade in signal amplification. Activated Cas12a can feedback cleave the blocking strand, regenerate the primer-binding domain of the activated strand, further amplify the signal, and improve detection sensitivity.

[0073] Example 4: Screening of reaction buffer This example evaluated three buffer systems: NEBuffer 2.1, 3.0, and 4.0, all purchased from New England Biolabs (NEB). The reaction system was prepared according to the optimal method described in Example 1, wherein 100 μL of the reaction mixture contained: 1 μL of 1×10⁻⁶ HCl. -2 The following reagents were prepared: 1 μL APE1 protein (New England Biolabs, NEB), 1 μL 1 μM template probe (AS / BS-13), 1 μL Cas12a protein, 1 μL 5 μM crRNA, 1 μL 40 U / μL RNase inhibitor, and 1 μL 50 μM fluorescence-quenched labeled single-stranded DNA, with the volumes made up to the appropriate 1× buffer. The control mixture was identical to the corresponding experimental group except that it did not contain APE1. All reactions were incubated at 37°C for 40 min, followed by fluorescence detection. The results are presented as signal-to-noise ratio, and the calculation method is described in Example 2. Detailed experimental results can be found in [link to example]. Figure 6 The experimental results show that using NEBuffer 3.0 can achieve a significantly higher signal-to-noise ratio than other buffer solutions, making it the preferred choice for this approach.

[0074] Example 5: Optimization of Template Probe (AS / BS-13) Concentration The effect of the template probe (AS / BS-13) concentration on the detection results was tested. Concentrations were set to 0.4, 0.6, 0.8, 1.0, and 1.2 μM (1 μL of each added to the system), meaning the final concentrations of the template probe (AS / BS-13) in the reaction system were 0.004, 0.006, 0.008, 0.01, and 0.012 μM, respectively. 100 μL of the reaction mixture contained 1 μL of 1×10⁻⁶... -2 1 μL of APE1 protein (New England Biolabs, NEB), 1 μL of template probes of different concentrations (AS / BS-13), 1 μL of 2 μM Cas12a protein, 1 μL of 5 μM crRNA, 1 μL of 40 U / μL RNase inhibitor, and 1 μL of 50 μM fluorescently quenched labeled single-stranded DNA were incubated in 1×NEBuffer 3.0 buffer at 37°C for 40 min. See below for experimental results. Figure 7 Experimental results show that template probes with a strength of 0.6-1.2 μM all have ideal performance, with 1.0-1.2 μM being the optimal choice.

[0075] Example 6: crRNA Concentration Optimization The crRNA concentrations were tested at 0.4, 1.0, 3.0, 5.0, and 7.0 μM (1 μL of each), resulting in final crRNA concentrations of 0.004, 0.01, 0.03, 0.05, and 0.07 μM in the reaction system. 100 μL of the reaction mixture contained 1 μL of 1×10⁻⁶ ppm of the compound. - 2 1 μL of APE1 (U / μL), 1 μL of 2 μM Cas12a, 1 μL of different concentrations of crRNA, 1 μL of 1 μM template probe AS / BS-13, 1 μL of 40 U / μL RNase inhibitor, and 1 μL of 50 μM fluorescently quenched labeled single-stranded DNA were incubated in 1×NEBuffer 3.0 at 37°C for 40 min. See attached table for experimental results. Figure 8 crRNA concentrations of 1.0–7.0 μM can all produce ideal signal-to-noise ratios, making it an optimized choice.

[0076] Example 7: Optimization of Cas12a incubation time Incubation times were set to 10, 20, 30, 40, and 50 minutes. The reaction system and reaction temperature were set according to the optimal method described in Example 1. Detailed experimental results can be found in [link to example]. Figure 9 An incubation time of 30-50 minutes is ideal.

[0077] Example 8: Detection of the lowest detection limit Under optimized experimental conditions (using the optimal method described in Example 1), the analytical performance of this protocol was evaluated by detecting different concentrations of APE1. The experimental results can be found in [reference needed]. Figure 10 , at 1.0×10 -7 U / μL to 1.0×10 -2 Within the APE1 concentration range of U / μL, fluorescence intensity increases proportionally with increasing concentration. Within this range, the fluorescence intensity at 520 nm shows a strong linear correlation with the logarithm of the APE1 concentration. Based on this linear relationship, the determined regression equation is: Y = 159237.68lgC + 1124253.11 (R² + π / μL). 2 =0.987), where Y represents fluorescence intensity and C represents APE1 concentration, and the limit of detection (LOD) is calculated. LOD is calculated as the blank mean plus three standard deviations, resulting in 9.27 × 10⁻⁶. -8 U / μL. This sensitivity is superior to previous studies (Table 1), marking a significant improvement in detection capability.

[0078] Table 1: Comparison of the detection effects of different detection methods on APE1 concentration

[0079] The references in Table 1 are as follows: Chen, X., Cao, G., Zhang, J., Deng, Y., Luo, X., Yang, M., Huo, D.,Hou, C., 2021. An ultrasensitive and point-of-care strategy for enzymesactivity detection based on enzyme extends activators to unlock the ssDNaseactivity of CRISPR / Cas12a (EdU-CRISPR / Cas12a). Sens. Actuators B Chem. 333,129553; Dai, K., Wang, Z., Gao, B., Li, L., Gu, F., Tao, X., You, W., Wang,Z., 2024. APE1 regulates mitochondrial DNA damage repair after experimentalsubarachnoid haemorrhage in vivo and in vitro. Stroke Vasc. Neurol. 9 (3),230–242; Dai, N., Cao, X.J., Li, M.X., Qing, Y., Liao, L., Lu, X.F., Zhang,S.H., Li, Z., Yang, Y.X., Wang, D., 2013. Serum APE1 autoantibodies: a novelpotential tumor marker and predictor of chemotherapeutic efficacy in non-small cell lung cancer. PLoS One 8 (3), e58001; Huang, X., He, Z., Zhou, K., Zhi, H., Yang, J., 2021. Fabrication ofbifunctional G-quadruplex-hemin DNAzymes for colorimetric detection ofapurinic / apyrimidinic endonuclease 1 and microRNA-21. Analyst 146 (24), 7379–7385; Li, F., Xie, Q., Qin, Y., Tong, C., Liu, B., Wang, W., 2021. Real-time monitoring and effector screening of APE1 based on rGO assisted DNAnanoprobe. Anal. Biochem. 633, 114394; Zhou, XM, Zhuo, Y., Tu, TT, Yuan, R., Chai, YQ, 2022. Construction of fast-walking tetrahedral DNA walker with four arms for sensitive detection and intracellular imaging of apurinic / apyrimidinicendonuclease 1. Anal. Chem. 94 (24), 8732–8739.

[0080] Example 9: Specificity Study The specificity of the biosensor for several potential interfering proteins was evaluated, including FEN1 (valve endonuclease 1), T4 ligase (T4 ligase), Exo I (exonuclease I), GOX (glucose oxidase), BSA (bovine serum albumin), and T7 Exo (T7 exonuclease). The reaction system followed the optimal method of Example 1, except that the target substances were changed. Detailed experimental results can be found in [link to experimental results]. Figure 11 As shown, only the target APE1 produced a strong fluorescent signal, while the signals from non-target proteins and the blank control were negligible, approaching background levels. This indicates minimal cross-reactivity or interference, confirming the high selectivity of this method for APE1 detection.

[0081] The above descriptions are merely embodiments of the present invention, and common knowledge such as specific technical solutions and / or characteristics are not described in detail here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the technical solutions of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.

Claims

1. A CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on an autocatalytic chain displacement reaction, characterized in that, It includes reaction reagents, which include: template probe, Cas12a protein, crRNA, and fluorescently quenched labeled single-stranded DNA; The template probe is formed by complementary pairing of an activation strand and a blocking strand, and the blocking strand has an AP site. The activation strand is complementary to the spacer sequence of the crRNA.

2. The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction according to claim 1, characterized in that, The working environment of the reaction reagent is a buffer environment containing 0.08-0.12 M NaCl, 40-60 mM Tris-HCl, 8-12 mM MgCl2, 0.8-1.2 mM DTT, and with a pH of 7.8-8.

0.

3. The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction according to claim 1, characterized in that, The working environment also contains a ribonuclease inhibitor at a final concentration of 0.32-0.48 U / μL.

4. The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction according to claim 1, characterized in that, The nucleotide sequence of the activation chain is as follows: 5'-ATATTGTGCTGCCATATCTACTTCACTA-3'; The nucleotide sequence of the blocking strand is inversely complementary to that of the activating strand, and any one of the deoxyribonucleic acid positions 4 to 22 of the blocking strand is set as the AP site.

5. The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction according to claim 1, characterized in that, The nucleotide sequence of the blocking strand is as follows: 5'-TAGTGAAGTAGX1X2X3X4X5X6X7X8X9CACAATAT-3'; Among them, X1 is an AP site or A, X2 is an AP site or T, X3 is an AP site or A, X4 is an AP site or T, X5 is an AP site or G, X6 is an AP site or G, X7 is an AP site or C, X8 is an AP site or A, and X9 is an AP site or G; and, among X1-X9, there is only one AP site.

6. The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction according to claim 5, characterized in that, The nucleotide sequence of the blocking strand is as follows: 5'-TAGTGAAGTAGATX3X4X5X6X7AGCACAATAT-3'; Among them, X3 is an AP site or A, X4 is an AP site or T, X5 is an AP site or G, X6 is an AP site or G, and X7 is an AP site or C; and, there is only one AP site among X3-X7.

7. The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction according to claim 6, characterized in that, The nucleotide sequence of the blocking strand is as follows: 5'-TAGTGAAGTAGATATXGCAGCACAATAT-3'; Where X represents the AP site.

8. The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction according to claim 1, characterized in that, The nucleotide sequence of crRNA is as follows: 5'-UAAUUUCUACUAAGUGUAGAUUGAAGUAGAUAUGGCAGCAC-3'; The nucleotide sequence of the fluorescently quenched labeled single-stranded DNA is as follows: 5'-TTATT-3'; and the 5' end is connected to a fluorescent group, and the 3' end is connected to a fluorescence quencher group.

9. The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction according to claim 1, characterized in that, Its working conditions are: incubation at 35-37℃ for 40-50 minutes.

10. The CRISPR-Cas12a system for one-step detection of the tumor marker APE1 based on autocatalytic chain displacement reaction according to claim 1, characterized in that, The working concentrations of the template probes are 0.004-0.012 μM, the working concentrations of Cas12a protein are 0.016-0.024 μM, the working concentrations of crRNA are 0.004-0.07 μM, and the working concentrations of fluorescently quenched labeled single-stranded DNA are 0.4-0.6 μM. The template probe is obtained by mixing the activating and blocking chains in a molar ratio of 1:1.2-2, heating at 80-95℃ for 5-15 min, and then annealing at 35-40℃ for 40 min-4 h to form the template probe.

Images